Les bases de données transcriptionnelles en ligne

Save this PDF as:
Dimension: px
Commencer à balayer dès la page:

Download "Les bases de données transcriptionnelles en ligne"

Transcription

1 Les bases de données transcriptionnelles en ligne

2 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

3 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

4 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

5 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

6 Quelques bases de données

7 base de donnée commerciale (licence payante publique gratuite ) + version

8 Qualité des sites Transfac Scores de qualité 1 : Functionally confirmed factor binding site 2: Binding of pure protein (purified or recombinant) 3: Immunologically characterized binding activity of a cellular extract 4: Binding activity characterized via a known binding sequence 5: Binding of uncharacterized extract protein to a bone fide element 6: No quality assigned

9 Recherche E2F dans Transfac publique classification interacteurs matrices

10 Recherche E2F dans Transfac publique sites de fixation références

11 3 Matrices E2F Transfac quelles différences?

12 [Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B.] alternative open-source à Transfac taille plus réduite: 459 matrices (oct. 2009) Répartition taxonomique des matrices Origine des données JASPAR in vitro in vivo g fun v i eb e rt es ra t in ts sec es nts te s d a a l o t d p r ma ho c ne o ur 0 PB M I q A D ip E X al 1H A se L -se PILE MS ip-ch p E i i E r N S D M Ch cte Ch CO ba essentiellement des données in-vitro, donc pas de gène cible!

13 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

14 E2F dans Jaspar

15 But: standardiser et centraliser les informations sur la régulation transcriptionnelle inclut certaines bases de données mise en place d'une architecture unifiée: tout le monde peut mettre ses données dans PAZAR et les rendre publiques ou non... open-access et open-source (TRANSFAC n'en fait pas partie) standards GFF (localisation génomique) et XML

16 aucun gène cible aucun facteur de transcription spécifique d'un gène cible ("gene centric") spécifique d'un FT ("TF centric")

17 E2F dans PAZAR

18 Navigateur UCSC target gene

19 [ Griffith OL et al.] Idée: aller chercher les informations dans la littérature scientifique Comment? en mettant à contribution la communauté scientifique Oreganno met à disposition des curateurs un corpus d'articles scientifiques soumis par des experts identifiés par des approches de text-mining automatiques (recherche de mots typiques comme "transcription factor", "binding site",...)

20 Oreganno inclut également des données provenant d'autres projets à grande échelle

21 E2F dans Oreganno site de fixation polymorphisme

22 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

23 [Gallo, S. M., Li, L., Hu, Z. and Halfon, M. S] base de données de modules cis-régulateurs et de TFBS chez la drosophile CRM sans TFBS CRM avec TFBS

24 Take home messages nombreuses bases de données, contenant différents types d'information information généralement parcellaire: TF mais pas de gène cible, CRM sans TF, etc... les matrices des différentes bases de données sont souvent différentes: impact de cette différence? attention à l'origine des données: in-vivo, in-vitro, in-silico

PLATEFORME DE SUPERVISION

PLATEFORME DE SUPERVISION PLATEFORME DE SUPERVISION ACCOR SOLUTIONS - Page 1/10 - PRESENTATION GENERALE SMART VE est une plateforme de supervision développée par Accor, spécifiquement dédiée aux infrastructures de recharge pour

Plus en détail

AU CONTACT DE L ENVIRONNEMENT DES ENTREPRISES

AU CONTACT DE L ENVIRONNEMENT DES ENTREPRISES AU CONTACT DE L ENVIRONNEMENT DES ENTREPRISES En l espace de 25 ans, SI Contact est devenu le premier intégrateur régional de solutions audiovisuelles & aménagements de bureaux. Cette double compétence

Plus en détail

INTERPRÉTATION DES CODES RETOUR DANS LE PRÉFIXE A1

INTERPRÉTATION DES CODES RETOUR DANS LE PRÉFIXE A1 INTERPRÉTATION DES CODES RETOUR DANS LE PRÉFIXE A1 Contenu 1 INTRODUCTION...1 2 EXPLICATIONS GÉNÉRALES...1 2.1 CAS IDÉAL...1 2.2 QUESTIONS GÉNÉRALES...2 2.3 EXAMEN DES SITUATIONS POSSIBLES...2 2.3.1 Ceci

Plus en détail

Cognit Ive Cas d utilisation

Cognit Ive Cas d utilisation Cognit Ive Cas d utilisation 96-98, rue de Montreuil - 75011 Paris _ opicot@ _ + 33 (0)1 40 09 71 55 Sommaire Présentation de la plateforme Cognit Ive SemanticMail : Traitement sémantique des mails Projets

Plus en détail

Digital Workplace et Gestion des connaissances Concepts et mise en oeuvre

Digital Workplace et Gestion des connaissances Concepts et mise en oeuvre Avant-propos 1. Objectif du livre 17 2. Illustrations des exemples de ce livre 18 2.1 Office 365 comme plateforme technologique pour une digital workplace 18 2.2 SharePoint et Yammer à l honneur 18 3.

Plus en détail

JFB MEDICAL 04 74 70 89 08

JFB MEDICAL 04 74 70 89 08 Modalités DE RECHARGE Écran et interface Nom du Programme Temps total de Travail Résistive-Capacitive Temps restant de travail Graphique d'émission Crédit. heures et minutes restant Utilisateur Alarme

Plus en détail

OPEN SYSTEM Pour les locations de vacances Clévacances, Gîtes de France ou classées avec le nouveau classement préfecture

OPEN SYSTEM Pour les locations de vacances Clévacances, Gîtes de France ou classées avec le nouveau classement préfecture OPEN SYSTEM Pour les locations de vacances Clévacances, Gîtes de France ou classées avec le nouveau classement préfecture Comité Départemental du Tourisme de la Vendée PRESENTATION Le Comité du Tourisme

Plus en détail

M@gistère Glossaire des outils

M@gistère Glossaire des outils DSDEN du Rhône M@gistère Glossaire des outils Les blocs : bandeau gris Nous vous présentons les items que nous avons testés qui nous paraissent fonctionner. L astérisque devant le nom d un bloc indique

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Cours PHP. Cours en ligne Développement web PHP. Académie Libre info@academielibre.fr

Cours PHP. Cours en ligne Développement web PHP. Académie Libre info@academielibre.fr Cours PHP Cours en ligne Développement web PHP Académie Libre info@academielibre.fr Programme général du Cours PHP Module 1 Introduction et installation d un environnement PHP Unité 1 Introduction à PHP

Plus en détail

La démarche d évaluation des dispositifs médicaux Approfondir Les Réflexions des Assises. Pr Eric VICAUT Coordinateur du CEDM

La démarche d évaluation des dispositifs médicaux Approfondir Les Réflexions des Assises. Pr Eric VICAUT Coordinateur du CEDM La démarche d évaluation des dispositifs médicaux Approfondir Les Réflexions des Assises Pr Eric VICAUT Coordinateur du CEDM Partir d une réflexion mille fois entendue Le DM n est pas le médicament Les

Plus en détail

1. Contact avec la clientèle

1. Contact avec la clientèle 1. Contact avec la clientèle Objectif évaluateur 1.1.1 Mener des entretiens Cet objectif est mis en œuvre et évalué en entreprise. Les bases théoriques sont fournies à l école. Je comprends les énoncés

Plus en détail

Internet Module 2 Chèque n 3

Internet Module 2 Chèque n 3 Internet Module 2 Chèque n 3 Par Christophe ROCA et Ludovic RANDU Animateurs du Syndicat Mixte de l'oise Picarde 27/11/2007 Les 3 types de recherche Il est courant de considérer qu il y a 3 types de recherche

Plus en détail

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES QUI SOMMES-NOUS? MEJT, dont le siège est basé à Champagne au Mont d Or (69) a été créée en 1994 par Gilles GUILLERME. A sa création, MEJT

Plus en détail

Catalogue des programmes d ANGLAIS 2015-2016 Hôtellerie - Restauration

Catalogue des programmes d ANGLAIS 2015-2016 Hôtellerie - Restauration Catalogue des programmes d ANGLAIS 2015-2016 Hôtellerie - Restauration 9 modules de formation en ANGLAIS Le service, l accueil et la connaissance de la clientèle sont essentiels dans le processus de séduction

Plus en détail

Progiciel de gestion de la formation Progiciel Centre de formation Progiciel de GPEC Portails RH

Progiciel de gestion de la formation Progiciel Centre de formation Progiciel de GPEC Portails RH Présentation de l offre Progiciel de gestion de la formation Progiciel Centre de formation Progiciel de GPEC Portails RH Mars 2007 page 1/12 Présentation de neuros Synthèse de parcours professionnels riches

Plus en détail

Manuel de transmission des rapports «collecte des données sur les instruments et les opérations de paiement»

Manuel de transmission des rapports «collecte des données sur les instruments et les opérations de paiement» Rapports réglementaires Manuel de transmission des rapports «collecte des données sur les instruments et les opérations de paiement» Version 1.1 Ne pas communiquer ou reproduire sans autorisation de la

Plus en détail

Google AdWords. Fiche formation Google AdWords - N : 13601 - Mise à jour : 07/04/2015

Google AdWords. Fiche formation Google AdWords - N : 13601 - Mise à jour : 07/04/2015 Impression à partir du site https://offredeformation.picardie.fr le 09/11/2015. Fiche formation Google AdWords - N : 13601 - Mise à jour : 07/04/2015 Google AdWords Mentalworks Rue Robert Schuman CS 70454

Plus en détail

Module de gestion des contacts et échanges avec les clients et fournisseurs (CRM)

Module de gestion des contacts et échanges avec les clients et fournisseurs (CRM) bmi-fact+ Module de gestion des contacts et échanges avec les clients et fournisseurs (CRM) Module commun aux applications bmi-fact, bmi-compta, POWERGES et Gest-Office. Qu est-ce qu un CRM (Customer Relationship

Plus en détail

RÈGLEMENT (CE) No 1898/2006 DE LA COMMISSION. du 14 décembre 2006

RÈGLEMENT (CE) No 1898/2006 DE LA COMMISSION. du 14 décembre 2006 RÈGLEMENT (CE) No 1898/2006 DE LA COMMISSION du 14 décembre 2006 portant modalités d application du règlement (CE) no 510/2006 du Conseil relatif à la protection des indications géographiques et des appellations

Plus en détail

Vers une typologie des chemins d impacts de l INRA

Vers une typologie des chemins d impacts de l INRA LISIS Vers une typologie des chemins d impacts de l INRA Evaluer l'impact sociétal de la recherche pour apprendre à le gérer 28 septembre 2015 Ariane Gaunand et Mireille Matt Les enjeux Passer des études

Plus en détail

L exploitation des rapports de vérifications réglementaires : quels enjeux, quelle solution?

L exploitation des rapports de vérifications réglementaires : quels enjeux, quelle solution? L exploitation des rapports de vérifications réglementaires : quels enjeux, quelle solution? 5 décembre 2013 Sommaire L exploitation des rapports de vérifications réglementaires : Quels enjeux? Bureau

Plus en détail

Approche Design Méthodologie de conduite de sites web

Approche Design Méthodologie de conduite de sites web Approche Design Méthodologie de conduite de sites web Phase 02 Concevoir le site (C) Conception visuelle N. Vanassche www.nathalievanassche.be Phase 2 (C) : Conception visuelle Facilité d utilisation:

Plus en détail

CONFORT ET SECURITE AMELIORES

CONFORT ET SECURITE AMELIORES GRUES A TOUR : CONFORT ET SECURITE AMELIORES AVEC LA NOUVELLE NORME EUROPEENNE EN 14439 La norme EN 14439 : 2006 sur la «sécurité des grues à tour» a été développée en collaboration avec des experts afin

Plus en détail

A Origine, définition et évolution

A Origine, définition et évolution A Origine, définition et évolution de la mercatique 1 Quel est l équivalent du terme mercatique? a. le terme marketing b. le terme mercantile c. le terme marché 2 Vers quelles années est née la mercatique?

Plus en détail

Affichage de la date d'exigibilité sur les documents FAQ INV 011

Affichage de la date d'exigibilité sur les documents FAQ INV 011 ADAPTATION DANS LA FACTURATION BOB50 Affichage de la date d'exigibilité sur les documents FAQ INV 011 Comment afficher la date d'exigibilité de la TVA sur les factures et notes de crédit? Lorsque le Report

Plus en détail

InvoiceInspector Pour un contrôle efficace des factures

InvoiceInspector Pour un contrôle efficace des factures Pour un contrôle efficace des factures La solution pour contrôler efficacement les factures Activité première de tout assureur, le contrôle des factures est un élément essentiel pour maîtriser les coûts

Plus en détail

Plugin MesEnvois pour Prestashop

Plugin MesEnvois pour Prestashop Plugin MesEnvois pour Prestashop Réduisez vos coûts de transport et augmenter votre satisfaction client en utilisant le plugin MesEnvois pour Prestashop. Proposez les transporteurs et les tarifs mesenvois.fr

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

La Performance Globale en PME / PMI

La Performance Globale en PME / PMI La Performance Globale en PME / PMI L Auvergne et les espaces «Performance Auvergne» Des approches pragmatiques à la portée des PME 1 L historique Près de 20 ans d expérience de l action des CCI d Auvergne

Plus en détail

Tableau pour un déroulé de formation à l utilisation du site Parlons français c est facile!

Tableau pour un déroulé de formation à l utilisation du site Parlons français c est facile! 1 Genèse, historique du, publics visés 2 Objectifs du site Présenter l historique du partenaires impliqués et leur rôle dans le publics visés par le site objectifs Diapo 2 Genèse du et diapo 3 Historique

Plus en détail

Référentiels partagés. Définition et positionnement dans le SI

Référentiels partagés. Définition et positionnement dans le SI Référence : CNRS / DSI / REFERENTIELS / Référentiels_applications_v5.doc Date : janvier 2005 Version : 5.0 Auteurs : Equipe Référentiels du projet RUE (Référentiels Urbanisation EAI) Passage de la version

Plus en détail

Cas de E-Commerce «MASTER CARREFOUR.FR» 1

Cas de E-Commerce «MASTER CARREFOUR.FR» 1 Cas de E-Commerce «MASTER CARREFOUR.FR» 1 Ce cas illustre le cours du 10 décembre 2014. Il sera simplement commenté tout au long de la matinée au fur et à mesure de la progression dans la présentation

Plus en détail

ALCATEL-LUCENT OPENTOUCH NOTIFICATION SERVICE OPTIMISER L EFFICACITE DU TRAITEMENT D ALARME ET LA SÉCURITÉ PERSONNELLE

ALCATEL-LUCENT OPENTOUCH NOTIFICATION SERVICE OPTIMISER L EFFICACITE DU TRAITEMENT D ALARME ET LA SÉCURITÉ PERSONNELLE ALCATEL-LUCENT OPENTOUCH NOTIFICATION SERVICE OPTIMISER L EFFICACITE DU TRAITEMENT D ALARME ET LA SÉCURITÉ PERSONNELLE Dans les domaines de la santé, de l'éducation, des industries à haut risque et de

Plus en détail

Créer un Quizz avec Socrative

Créer un Quizz avec Socrative Créer un Quizz avec Socrative 1/ Se rendre sur le site de Socrative. http://www.socrative.com/ et créer un compte professeur 2/ Création de compte très rapide : 3/ Une fois le compte créé, on peut paramétrer

Plus en détail

Technologie sans fil facile à installer PACK DE DÉMARRAGE HOME VIEW MODE D'EMPLOI. www.my-serenity.ch

Technologie sans fil facile à installer PACK DE DÉMARRAGE HOME VIEW MODE D'EMPLOI. www.my-serenity.ch Technologie sans fil facile à installer PACK DE DÉMARRAGE HOME VIEW MODE D'EMPLOI www.my-serenity.ch Apprendre à connaître votre système Cette caméra IP HD jour/nuit avec détection de mouvement vous permet

Plus en détail

Le logiciel pour la mesure des charges en soins infirmiers. Mars 2003

Le logiciel pour la mesure des charges en soins infirmiers. Mars 2003 Mars 2003 PRNVISUEL Son origine Ses avantages Sa personnalisation Configuration - PRNVISUEL Configuration - PRN 6.0 Ses modules clés: Patients Offre Son évolution page 3 Extrants page 4 page 29 page 8

Plus en détail

L a gamme financière en Belgique

L a gamme financière en Belgique L a gamme financière en Belgique Des outils pour la gestion efficace de vos risques financiers. Tout entrepreneur prend des risques : - accorder des délais de paiements à ses clients, - faire confiance

Plus en détail

Conception et réalisation d un tableau de bord sécurité

Conception et réalisation d un tableau de bord sécurité Conception et réalisation d un tableau de bord sécurité Une approche innovante www.conixsecurity.fr 1 Agenda Définir le «tableau de bord» : mission impossible? Le tableau de bord «sécurité» Notre démarche

Plus en détail

La différenciation cellulaire

La différenciation cellulaire La différenciation cellulaire Définitions Différenciation cellulaire : Processus par lequel une cellule peu ou pas différenciée acquiert les caractéristiques d un type cellulaire sur le plan morphologique

Plus en détail

Laboratoire national de métrologie et d essais

Laboratoire national de métrologie et d essais Séminaire Européen : le marquage CE La pratique d un laboratoire notifié Laboratoire national de métrologie et d essais Francis WELVART Francis.welvart@lne.fr 1 Laboratoire national de métrologie et d

Plus en détail

La comptabilité de l État en Italie : développements et questions d actualité

La comptabilité de l État en Italie : développements et questions d actualité La comptabilité de l État en Italie : développements et questions d actualité Eugenio Anessi Pessina Université Catholique S.C. - Rome Matrice, Paris, 27 Février 2006 Le secteur public en Italie Autorités/

Plus en détail

AURELIE Gestion Commerciale Mode d emploi pour gestion de restaurant

AURELIE Gestion Commerciale Mode d emploi pour gestion de restaurant Table des matières 1/ But :... 2 2/ Paramétrage :... 2 2.1/ Familles de clients :... 2 2.1.1 Comment y aller?... 2 2.2/ Clients :... 2 2.3/ divers :... 2 2.3.1/ Comment y aller?... 2 2.3.2/ Fiches utilisateurs

Plus en détail

CALENDRIER DES RDV CCIMP DES TIC 1 ER SEMESTRE 2011

CALENDRIER DES RDV CCIMP DES TIC 1 ER SEMESTRE 2011 DATE HORAIRE LIEU THEME 27 JANVIER 2011 9h 10h30 Show Room Exploitez les logiciels libres dans votre entreprise Découvrez les opportunités offertes par les logiciels libres pour gérer votre entreprise

Plus en détail

Fiche de l'awt Principes d'élaboration de solutions Web interactives

Fiche de l'awt Principes d'élaboration de solutions Web interactives Fiche de l'awt Principes d'élaboration de solutions Web interactives Présentation des principales catégories d'applications Internet et des composants standards d'une application Web interactive Créée

Plus en détail

Le mangement relationnel et le changement. Présenté par : Sara ZNIBER Amine KHOUYYI

Le mangement relationnel et le changement. Présenté par : Sara ZNIBER Amine KHOUYYI Le mangement relationnel et le changement Présenté par : Sara ZNIBER Amine KHOUYYI Année Universitaire : 2012 / 2013 Introduction Plan Définition du management relationnel Management relationnel et fonction

Plus en détail

Présentation livre Simulation for Supply Chain Management. Chapitre 1 - Supply Chain simulation: An Overview

Présentation livre Simulation for Supply Chain Management. Chapitre 1 - Supply Chain simulation: An Overview Présentation livre Simulation for Supply Chain Management Chapitre 1 - Supply Chain simulation: An Overview G. Bel, C. Thierry et A. Thomas 1 Plan Gestion de chaînes logistiques et simulation Points de

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

SF ou ECS: quel statut choisir? Le reporting prudentiel des SF

SF ou ECS: quel statut choisir? Le reporting prudentiel des SF SF ou ECS: quel statut choisir? Le reporting prudentiel des SF ASFFOR le 13 février 2014 1 Introduction L arrêté du 23 décembre 2013 relatif au régime prudentiel des sociétés de financement a donné à l

Plus en détail

qualité des prestations des

qualité des prestations des Plateforme d appui aux entreprises et à la formation technique du BTP Renforcer la qualité des prestations des entreprises pour augmenter leurs opportunités de marché Renforcer la qualité des prestations

Plus en détail

Réussir le Use Test est une exigence critique pour les assureurs ayant

Réussir le Use Test est une exigence critique pour les assureurs ayant Réussir le Use Test est une exigence critique pour les assureurs ayant demandé la validation de leur sous Solvabilité II. Cet article décrit comment les assureurs peuvent en même temps satisfaire aux exigences

Plus en détail

Introduction à la conduite de projet "systèmes d'information"

Introduction à la conduite de projet systèmes d'information Centre national de la recherche scientifique Direction des systèmes d'information REFERENTIEL QUALITE Guide méthodologique Introduction à la conduite de projet "systèmes d'information" Référence : CNRS/DSI/conduite-projet/principes/guide-introduction

Plus en détail

Bienvenue sur les commandes de préparations magistrales en ligne!

Bienvenue sur les commandes de préparations magistrales en ligne! Bienvenue sur les commandes de préparations magistrales en ligne! Dorénavant les commandes au laboratoire devront se faire automatiquement par ce biais. Concernant toutes les autres commandes (médicaments

Plus en détail

C2i (Certificat Informatique et Internet) Module A1 Deuxième partie. Module A1 Deuxième partie

C2i (Certificat Informatique et Internet) Module A1 Deuxième partie. Module A1 Deuxième partie C2I Certificat Informatique et C2i (Certificat Informatique et Internet) Module A1 Deuxième partie C2I Certificat Internet Plan de la présentation : Module A1 Deuxième partie 1) Tenir compte des problèmes

Plus en détail

igold Manager est une solution de reporting puissante et dynamique, favorisant la visualisation de votre activité.

igold Manager est une solution de reporting puissante et dynamique, favorisant la visualisation de votre activité. 1 2 Présentation igold Manager igold Manager est une solution de reporting puissante et dynamique, favorisant la visualisation de votre activité. Il permet d afficher une synthèse des informations nécessaire

Plus en détail

Questionnaire (Perception) Guide pratique. Section Technopédagogie

Questionnaire (Perception) Guide pratique. Section Technopédagogie Questionnaire (Perception) Guide pratique Section Technopédagogie 01/08/2007 1. QU EST CE QUE QUESTIONNAIRE? Il s agit une application web de création et de publication de questionnaires en ligne, également

Plus en détail

L ESSENTIEL DU PLAN MARKETING OPÉRATIONNEL

L ESSENTIEL DU PLAN MARKETING OPÉRATIONNEL GUÉNAËLLE BONNAFOUX CORINNE BILLON Sous la direction de NATHALIE VAN LAETHEM L ESSENTIEL DU PLAN MARKETING OPÉRATIONNEL LES ESSENTIELS DU MARKETING, 2013 ISBN : 978-2-212-55553-0 Sommaire Introduction

Plus en détail

Séminaire IST: Passage en revue de quelques sujets sur le plan réglementaire en matière de gestion de fortune au sens large. Yvar Mentha Octobre 2014

Séminaire IST: Passage en revue de quelques sujets sur le plan réglementaire en matière de gestion de fortune au sens large. Yvar Mentha Octobre 2014 Séminaire IST: Passage en revue de quelques sujets sur le plan réglementaire en matière de gestion de fortune au sens large Yvar Mentha Octobre 2014 Révision OPP 2, règles de placement Modification des

Plus en détail

COÛTS DE RÉFÉRENCE DES POSTES DE DÉPART

COÛTS DE RÉFÉRENCE DES POSTES DE DÉPART COÛTS DE RÉFÉRENCE DES POSTES DE DÉPART Original : 2006-10-30 Page 1 de 25 TABLE DES MATIÈRES 1 CONTEXTE...5 2 CARACTÉRISTIQUES DES POSTES DE DÉPART...6 3 COÛTS DE RÉFÉRENCE...8 3.1 MODULES...8 3.2 RÈGLES

Plus en détail

3- Fonctionnement de l outil Amadeo starter a. Veille réglementaire

3- Fonctionnement de l outil Amadeo starter a. Veille réglementaire AMADEO STARTER REPONSES AUX QUESTIONS POSEES 1- Informations d ordre général Quel est le coût? Le coût de l outil Amadeo starter, incluant le module plan d actions et l espace document, est de 97 /mois

Plus en détail

Connecteur bi directionnel SAGE MAGENTO

Connecteur bi directionnel SAGE MAGENTO SAGE MAGENT 1.6 Date : 01/01/2011 Editeur : AWEV Logiciel interface entre la gestion commerciale SAGE100 et MAGENT. Comment disposer d un site marchand efficace basé sur la plateforme Magento et couplé

Plus en détail

NET@XIS OFFRE DE SERVICES OFFSHORE SAP

NET@XIS OFFRE DE SERVICES OFFSHORE SAP NET@XIS OFFRE DE SERVICES OFFSHORE SAP SOMMAIRE Introduction... 3 Scénarii & tendances...4 Offre de services Netaxis.8 Méthodologie... 9 Infrastructure Technique...11 Livrables...12 Management de Project...13

Plus en détail

ING Commercial Banking. XML en Europe de l Est : vers de nouvelles opportunités

ING Commercial Banking. XML en Europe de l Est : vers de nouvelles opportunités ING Commercial Banking XML en Europe de l Est : vers de nouvelles opportunités Agenda Typologie des clients Evolution des standards XML o Evolutions universelles o Evolutions dans les marchés/pays spécifiques

Plus en détail

l expert des tailles et du bien-aller de l Habillement

l expert des tailles et du bien-aller de l Habillement l expert des tailles et du bien-aller de l Habillement Pleins feux sur vos tailles et votre bien-aller En tant que pionnier et expert reconnu en la matière dans le secteur de l Habillement, nos conseils

Plus en détail

Groupe Eyrolles, 2003, 2004, 2006, ISBN : 2-212-11916-X

Groupe Eyrolles, 2003, 2004, 2006, ISBN : 2-212-11916-X Groupe Eyrolles, 2003, 2004, 2006, ISBN : 2-212-11916-X Présentation des études de cas 1 SOMMAIRE B Présentation des études de cas B Carnet d adresses B Calcul de mensualités d emprunt B Forum de discussion

Plus en détail

Animation pédagogique

Animation pédagogique Animation pédagogique Proposition d un cadre de réflexion Rédaction Jean- Michel Guilhermet à partir des travaux du groupe EPS 38 - mai 2012 Page 1 Le document précise les professionnelles attendues dans

Plus en détail

Soon_StockReleaser. Module Magento SOON. Rédacteur. Relecture & validation technique. Historique des révisions

Soon_StockReleaser. Module Magento SOON. Rédacteur. Relecture & validation technique. Historique des révisions Module Magento SOON Soon_StockReleaser Rédacteur Hervé G. Lead développeur Magento herve@agence-soon.fr AGENCE SOON 35 avenue Joffre 94160 SAINT-MANDE Tel : +33 (0)1 48 83 95 96 Fax : +33 (0)1 41 81 35

Plus en détail

FICHE TECHNIQUE PRODUIT

FICHE TECHNIQUE PRODUIT FICHE TECHNIQUE PRODUIT 1 FICHE TECHNIQUE PRODUIT DEFINITION Fiche descriptive qui présente avec précision un produit à vendre ou à acheter. Elle reprend les caractéristiques du produit dans le but d informer

Plus en détail

PGSSI-S Référentiel des autorités de certification éligibles pour l authentification publique dans le secteur de la santé

PGSSI-S Référentiel des autorités de certification éligibles pour l authentification publique dans le secteur de la santé Sommaire 1 Objet du document... 3 2 Périmètre d'application du référentiel... 4 3 Définitions... 4 3.1 Prestataire de Service de Confiance (PSCO)... 4 3.2 Prestataire de Service de Certification Electronique

Plus en détail

Annuaire de plateformes

Annuaire de plateformes Annuaire de plateformes Cours et méthodes en vidéo 1 MIN POUR COMPRENDRE http://www.uneminutepourcomprendre.org/ 160 courtes vidéos méthodologiques niveau terminale : rythme rapide mais présentation très

Plus en détail

INTRODUCTION AUX TECHNOLOGIES D INGENIERIE DES DONNEES DIRIGEE PAR LES MODELES

INTRODUCTION AUX TECHNOLOGIES D INGENIERIE DES DONNEES DIRIGEE PAR LES MODELES INTRODUCTION AUX TECHNOLOGIES D INGENIERIE DES DONNEES DIRIGEE PAR LES MODELES Les contenus de ce document sont la propriété exclusive de la société REVER. Ils ne sont transmis qu à titre d information

Plus en détail

PRÉSENTATION DE LOGICIELS DE GESTION DE RÉFÉRENCES BIBLIOGRAPHIQUES

PRÉSENTATION DE LOGICIELS DE GESTION DE RÉFÉRENCES BIBLIOGRAPHIQUES PRÉSENTATION DE LOGICIELS DE GESTION DE RÉFÉRENCES BIBLIOGRAPHIQUES I/ A quoi servent les logiciels de gestion de références bibliographiques? CONTEXTE D UTILISATION ET DEFINITION A QUOI SERVENT LES LOGICIELS

Plus en détail

GUIDE D ACCOMPAGNEMENT DES OUTILS D EVALUATION DE COMPETENCES

GUIDE D ACCOMPAGNEMENT DES OUTILS D EVALUATION DE COMPETENCES GUIDE D ACCOMPAGNEMENT DES OUTILS D EVALUATION DE COMPETENCES AU SERVICE DES ENSEIGNANTS DU 1 er DEGRE SECONDAIRE Ministère de la Communauté française Administration générale de l enseignement et de la

Plus en détail

Design for Six Sigma, pour mieux manager les risques de l innovation

Design for Six Sigma, pour mieux manager les risques de l innovation D F Design for ix igma, pour mieux manager les risques de l innovation Par David Méneur, consultant en amélioration continue à l ARIAQ Le 03 novembre 2010, Yverdon-les-bains, uisse 1 D F Qui est ARIAQ?

Plus en détail

Un temps d apprentissage plus libre en utilisant WIMS

Un temps d apprentissage plus libre en utilisant WIMS Un temps d apprentissage plus libre en utilisant WIMS WIMS (WWW Interactive Multipurpose Server) est un logiciel libre, sous licence GNU GPL. Il s agit d un serveur d exercices interactifs ET d une plateforme

Plus en détail

UN PROJET MULTIMÉDIA avec les classes 702A et 712B et le logiciel MISTRALMOVIE, au Cycle d Orientation des Grandes-Communes

UN PROJET MULTIMÉDIA avec les classes 702A et 712B et le logiciel MISTRALMOVIE, au Cycle d Orientation des Grandes-Communes UN PROJET MULTIMÉDIA avec les classes 702A et 712B et le logiciel MISTRALMOVIE, au Cycle d Orientation des Grandes-Communes Buts Mise en place d une période de révision d allemand en fin de 7e année sous

Plus en détail

STAGE. «Offre modulaire - Recueillir et analyser les besoins et attentes des usagers - Module 4 - L'analyse experte des données statistiques»

STAGE. «Offre modulaire - Recueillir et analyser les besoins et attentes des usagers - Module 4 - L'analyse experte des données statistiques» STAGE «Offre modulaire - Recueillir et analyser les besoins et attentes des usagers - Module 4 - L'analyse experte des données statistiques» PROGRAMME DETAILLE Intervenant : PARIS nicolas Cabinet : OPTIMA

Plus en détail

Module d anti-plagiat Compilatio

Module d anti-plagiat Compilatio Module d anti-plagiat Compilatio Guide d utilisation Le logiciel Compilatio est accessible par l intermédiaire de la plateforme pédagogique Claroline depuis février 2009. Il n est utilisable que pour des

Plus en détail

Les outils marketing. Page 1

Les outils marketing. Page 1 Page 1 Les outils marketing 1 Les abonnées à la Newsletter...2 2 La syndication...4 3 Les bons de réduction...4 3.1 Gérer les bons de réduction...4 3.2 Créer un bon de réduction...5 3.3 Spécificités des

Plus en détail

SEPA, prochaine étape : de la centralisation de trésorerie à la centralisation des paiements. Syrtals Mars 2014. Tous droits réservés SYRTALS SI

SEPA, prochaine étape : de la centralisation de trésorerie à la centralisation des paiements. Syrtals Mars 2014. Tous droits réservés SYRTALS SI SEPA, prochaine étape : de la centralisation de trésorerie à la centralisation des paiements Syrtals Mars 2014 Tous droits réservés SYRTALS SI 1 2 Agenda De quelle centralisation parle-t-on? Pourquoi mettre

Plus en détail

Nouvelles fonctions module sondage de Flexmail

Nouvelles fonctions module sondage de Flexmail Nouvelles fonctions module sondage de Flexmail Module sondage 1. Nouveau type de question : Matrice de réponses En plus des questions ouvertes et à choix multiple, vous pouvez également opter pour une

Plus en détail

Technologies de l information Techniques de sécurité Systèmes de management de la sécurité de l information Vue d ensemble et vocabulaire

Technologies de l information Techniques de sécurité Systèmes de management de la sécurité de l information Vue d ensemble et vocabulaire NORME INTERNATIONALE ISO/CEI 27000 Troisième édition 2014-01-15 Technologies de l information Techniques de sécurité Systèmes de management de la sécurité de l information Vue d ensemble et vocabulaire

Plus en détail

COMMENT DÉFINIR L ORIENTÉ OBJET

COMMENT DÉFINIR L ORIENTÉ OBJET COMMENT DÉFINIR L ORIENTÉ OBJET De manière superficielle, le terme «orienté objet», signifie que l on organise le logiciel comme une collection d objets dissociés comprenant à la fois une structure de

Plus en détail

Plateforme SACADO Aide à la navigation. Bonjour, je suis votre accompagnant pour la formation à distance SACADO.

Plateforme SACADO Aide à la navigation. Bonjour, je suis votre accompagnant pour la formation à distance SACADO. Plateforme SACADO Aide à la navigation Bonjour, je suis votre accompagnant pour la formation à distance SACADO. Configuration minimale Type de poste de travail PC compatible x86 ou Apple PC nomade ou de

Plus en détail

AGENCE DE COMMUNICATION INTERACTIVE BIEN INTERPRETER LES STATISTIQUES DE FREQUENTATION D'UN SITE WEB

AGENCE DE COMMUNICATION INTERACTIVE BIEN INTERPRETER LES STATISTIQUES DE FREQUENTATION D'UN SITE WEB AGENCE DE COMMUNICATION INTERACTIVE BIEN INTERPRETER LES STATISTIQUES DE FREQUENTATION D'UN SITE WEB MM Création 32 Avenue de Wagram 75 008 Paris Tél : 01 45 74 76 00 Fax : 01 45 74 95 06 E-mail : jn@mmcreation.com

Plus en détail

Ecole Préparatoire SNV Université d Oran Semestre 02 2014/2015 Matière : Travaux d Initiative Personnelle Encadrés (TIPE) Prof. M. Z.

Ecole Préparatoire SNV Université d Oran Semestre 02 2014/2015 Matière : Travaux d Initiative Personnelle Encadrés (TIPE) Prof. M. Z. Ecole Préparatoire SNV Université d Oran Semestre 02 2014/2015 Matière : Travaux d Initiative Personnelle Encadrés (TIPE) Prof. M. Z. TALEB Avec quel outil? Comment? Trouvez-vous facilement l information?

Plus en détail

Master Sales Analysis. Analyse et développement des compétences de vente

Master Sales Analysis. Analyse et développement des compétences de vente Master Sales Analysis Analyse et développement des compétences de vente L'essentiel L essentiel à propos du système MSA 360 Description résumée du système MSA 360 Le système Master Sales Analysis (MSA)

Plus en détail

I N F R A S T R U C T U R E T I S É C U R I S É E P O U R L E C O M M E R C E É L E C T R O N I Q U E

I N F R A S T R U C T U R E T I S É C U R I S É E P O U R L E C O M M E R C E É L E C T R O N I Q U E Résumé Le présent rapport de recherche décrit les composantes d une infrastructure TI sécurisée pour le commerce électronique. L objectif est de fournir une description exhaustive des enjeux liés à la

Plus en détail

Moteurs de recommandations & pertinence de la conversation. Hervé Mignot herve.mignot@equancy.com 24 Mai 2011

Moteurs de recommandations & pertinence de la conversation. Hervé Mignot herve.mignot@equancy.com 24 Mai 2011 Moteurs de recommandations & pertinence de la conversation Hervé Mignot herve.mignot@equancy.com 24 Mai 2011 Equancy en quelques mots Un cabinet de conseil spécialisé en marketing et communication. Une

Plus en détail

Orange Réunion. Annexe n 4 Charte d accès. Version 1.0 Novembre 2008

Orange Réunion. Annexe n 4 Charte d accès. Version 1.0 Novembre 2008 Orange Réunion Annexe n 4 Charte d accès Version 1.0 Novembre 2008 Orange Réunion Société Anonyme au capital de 7 661 115 euros Euros - RCS B 432 495 802 35, Boulevard du Chaudron, ZI du Chaudron - 97470

Plus en détail

Catalogue des formations. www.benin.campusfrance.org

Catalogue des formations. www.benin.campusfrance.org Mon Guide illustré : Catalogue des formations www.benin.campusfrance.org 2 SOMMAIRE INTRODUCTION.4 I. COMMENT ACCEDER AU CATALOGUE..4 II. COMMENT EFFECTUER SES RECHERCHES...8 III. COMMENT LIRE ET EXPLOITER

Plus en détail

CCI DE SAÔNE-ET-LOIRE - ATELIER ENP 18 MAI 2011. Le référencement de sites internet

CCI DE SAÔNE-ET-LOIRE - ATELIER ENP 18 MAI 2011. Le référencement de sites internet CCI DE SAÔNE-ET-LOIRE - ATELIER ENP 18 MAI 2011 de sites internet Webmarketing et Référencement Quels enjeux pour votre site internet? Définition naturel, également appelé SEO pour Search Engine Optimization,

Plus en détail

Administration Sites web sous JOOMLA

Administration Sites web sous JOOMLA Tutoriel Site Web Joomla Version : 1.0 by LHarant Page 1 Administration Sites web sous JOOMLA Sommaire 1) Les bases 2 1) Les notions de base de joomla 2 2) Accéder à l'administration du site 3 3) Créer

Plus en détail

Comment utiliser les formulaires dynamiques

Comment utiliser les formulaires dynamiques Comment utiliser les formulaires dynamiques Un formulaire dynamique permet de nombreux contrôles avant son traitement (zones obligatoires, calculs automatiques ). Les formulaires que vous allez utiliser

Plus en détail

CQMS-MetricStream Création et validation d une non-conformité de processus (PNC)

CQMS-MetricStream Création et validation d une non-conformité de processus (PNC) Présentation fonctionnelle de non-conformité Créer Valider mesure corrective Créer Réagir Approuver Écran de contrôle Non-conformité de processus Créer Valider Dans, un échec de processus est enregistré

Plus en détail

Rectorat SAIO 2015/2016 MAJ 08/01/16

Rectorat SAIO 2015/2016 MAJ 08/01/16 1 obligatoire pour vous inscrire en : BTS - BTSA (Brevet de technicien supérieur, BTSA agricoles) DUT (Diplôme universitaire de technologie) CPGE (Classes Préparatoires aux Grandes Ecoles) CPES (Classes

Plus en détail

Dès qu'une action atteint un certain degré de complexité ou qu'il s'agit d'actions collectives il est nécessaire d'organiser, c'est-à-dire de diviser et coordonner. L'organisation suppose donc division

Plus en détail

LIVRE BLANC COMMUNICATIONS MARKETING ET CRM

LIVRE BLANC COMMUNICATIONS MARKETING ET CRM LIVRE BLANC COMMUNICATIONS MARKETING ET CRM LIVRE BLANC COMMUNICATIONS MARKETING ET CRM 2 À PROPOS De nos jours, il est essentiel pour les entreprises de définir une stratégie marketing précise et efficace.

Plus en détail

Guide et conseils généraux pour optimiser le référencement d un site internet

Guide et conseils généraux pour optimiser le référencement d un site internet Guide et conseils généraux pour optimiser le référencement d un site internet Novembre 2010 1 Introduction Le référencement de votre site internet vous permet d être présent dans les différents moteurs

Plus en détail

Entretien portant sur la location (exemple)

Entretien portant sur la location (exemple) Entretien portant sur la location (exemple) Seulement Fiduciaire immobilier Nom/prénom du candidat/de la candidate Arrondissement d'examen Entreprise formatrice Veuillez observer ce qui suit: 1. L'examen

Plus en détail