HEMOGLOBINOPATHIES Professeur Photis BERIS Service d Hématologie Hôpital Cantonal, Genève
Hémoglobinopathies : classification Défaut de synthèse syndromes thalassémiques Protéine anormale hémoglobines anormales Pathologie mixte hémoglobines anormales avec phénotype thalassémique
I Syndromes Thalassémiques α-thalassémies β-thalassémies DELETION mutation MUTATION délétion
Diagnostic des β-thalassémies 1 Hématométrie 2 Frottis (morphologie) 3 Dosage de l Hb A2 4 Séquençage du gène β (cas rares de β-thalassémie à Hb A2 normale, pour identifier la mutation en cas de conseil génétique)
CASE 1: Infant F.L. born on 1990 Hb: 85g/L; MCV 54.5 fl; ferritin; 96 μg/l IEF : no abnormal Hb Hb A2: 6,6 % Hb F: 9,5 % DNA analysis for α-thal and α globin gene triplication by Southern : negative bilirubine, LDH, test de Coombs: neg
Father of portuguese origin Hb 129g/L; MCV 63 fl Hb A 2 5%; Hb F 0.4% Diagnosis : β-thalassemia minor (heterozygous state) secondary to IVS I nt 1 G A (β 0 -thalassemia) mutation
Mother of portuguese origin Hb 146 g/l IEF: no abnormal MCV 86,6 fl MCH 29,2 pg Hb A 2 : 3,6 % MCHC 337 g/l Hb F: 1,6 % Reti 7,9 (39,5 G/L) Screening for α-thal.: negative
Mother of portuguese origin Sequening of the totalityof the β gene : -101 C T (G A complementaryseq) mutation of the distal CACCC box leading to β silent thalassemia
Silent β-thalassemia Promoter mutations: -88 (C A), -87 (C T), -87 (C G), -86 (C A), -86 (C G), in the proximal CACCC box; C>T at nt 101, in the distal CACCC box; C>T at position 92; Generally there is no anemia, no microcytosis, but slight Hb A2 and Hb F increase In combination with β o or severe β + thalassemia alleles a clinical phenotype of thalassemia intermedia results
Silent β-thalassemia 5 untranslated region: CAP (+1) A-C, +33 (C G), +22 (G A), +40 to 43 4bp del, +10 (-T), +20 (C G) and +45 (G C) +22 (G A) +33 (C G) +45 (G C) CAP tgcttacatttgcttctgacacaactgtgttccactagcaacctcaaacagacaccatg +1(A C) +10(-T) +20 (C G) +40 to +43 4 pb deletion
Silent β-thalassemia 3 untranslated region: termination Cd +6 C G This mutation is common in Greece and leads to a 20-34% reduction in mrna levels IVS II nt 844 C T
Diagnosis of α-thalassemia (I) Microcytosis with normal Hb A2 values and normal iron status Thalassemia belt origin and positive familial history Inclusion bodies Hb electrophoresis GAP-PCR for common mutations Southern blotting
Molecular pathology of alpha thalassemia I. α-thalassemia resulting from deletions II. non-deletional types of α-thalassemia III. α-thalassemia with mental retardation or myelodysplasia the ATR-16 syndrome the ATR-X syndrome (non-deletional) the ATMDS
CLARK BE, THEIN SL Molecular diagnosis of haemoglobin disorders Multiplex gap-pcr for detection of the common α-thalassaemia deletions. Note an internal PCR control is included which amplifies another region of the genome to monitor false negatives (Clin Lab Haem 2004, 26: 159-176)
Diagnosis of α-thalassemia (II) Direct sequence analysis Thalassemia array (screening for known mutations) Restriction enzyme analysis (mutations that alter a restriction site). α/β ratio in reticulocytes It is good practice for any DNA diagnostic laboratory to have at least two alternative methods for detecting each mutation
Biosynthèse de l hémoglobine
II Hémoglobines anormales Hb S, C, D Punjab. Le diagnostic repose sur l IEF et la HPLC.
Hb anormales : clinique La majorité des Hb anormales sont asymptomatiques (actuellement 335 variantes bêta et 199 variantes alpha sont décrites). Certaines Hb anormales provoquent : 1. Hémolyse 2. Polyglobulie (Hb hyperaffines) 3. Cyanose 4. Crises vaso-occlusives
III Hb anormales avec phénotype thalassémique Hb E et similaires Hb hybrides (Lepore) Hb avec chaine alpha allongée (Hb CS)
Conclusions Les syndromes thalassémiques et les Hbs anormales sont les pathologies héréditaires les plus fréquentes. Leur apparition et sélection a été favorisée par la malaria ( zone des hémoglobinopathies = zone de la malaria). En règle générale, un état homozygote ou hétérozygote composite conduit à une anémie sévère transfuso-dépendante. Ceci justifie un dépistage systématique des hétérozygotes afin d offrir un conseil génétique ou un diagnostique prénatal.