Le contrôle qualité sur les données fastq

Dimension: px
Commencer à balayer dès la page:

Download "Le contrôle qualité sur les données fastq"


1 Le contrôle qualité sur les données fastq

2 TP detection exome

3 Plan Théorie 1: le format FastQ et l'encodage des qualités Session pratique 1: conversion des qualités (fichier illumina.fastq) Théorie 2: le contrôle qualité et l'outil FastQC Session pratique 2: le nettoyage des données (dataset pickrel exon chr12.fastq)

4 FastQ 1 séquence = 4 lignes dans le fichier 1 ère ligne = identifiant de la séquence

5 Qualité 4ème ligne = Qualité Qualité = score calculé 2 calculs de scores existent Pe: estimated probability of error


7 Encoder la qualité Les scores sont encodés en ASCII (ex: '%' => 37 ) Il existe différents encodages: S,X,I,J,L

8 Chaque encodage correspond à un score calculé selon la formule PHRED ou SOLEXA A ce score est ajouté 33 ou 64 La valeur obtenue est convertie en ASCII et inscrite dans le fichier Ex pour un encodage Sanger: de la proba au caractère ASCII: 90% (proba) 10 (score phred) = 43 43: '+' ASCII

9 Différents encodages mais les outils en acceptent qu'un seul format FASTQ Groomer: pour convertir les qualités

10 Session pratique 1 Cliquez sur shared data puis publish histories Cliquez sur TP-QC Olivier Cliquez sur Import history Visualisez (avec l'oeil) le contenu du fichier illumina.fastq Quel est l'encodage pour ces données?



13 Verification de l'encodage Dans la boîte de recherche d'outils tapez FastQC Selectionnez l'outil FastQC: Read QC Selectionnez le fichier illumina.fastq



16 Dans la boîte de recherche d'outils tapez FastQ Groomer Selectionnez FASTQ Groomer convert between various FASTQ quality formats Pour le fichier File to groom selectionnez le fichier illumina.fastq Quel est maintenant l'encodage pour ces données?



19 FastQC A quality control tool for high throughput sequence data Contrôle qualité sur les données sequencées Différentes analyses sur les données, pour chaque analyse:

20 Per base sequence quality X = Position in read Y = Quality score Box Whisker Green, orange, red Quality of calls will degrade as the run process...

21 Per base sequence quality lower quartile for any base < 10, or if the median for any base < 25 the lower quartile for any base < 5, or if the median for any base < 20

22 Per Sequence Quality Scores X = Quality scores Y = Nb sequences See if a proportion of sequences in a run have low quality => indicate a systematic pb (one end of a flowcell,...)

23 Per Sequence Quality Scores most frequently observed < 27 (O.2% error rate) most frequently observed < 20 (1% error rate)

24 Per Base Sequence Content X = position in read Y = Sequence content (%T, %C, %A, %G) In a random library: little to no difference between the different bases of a sequence run Detect overexpressed sequence (contamination)

25 Per Base Sequence Content Differences between A and T or G and C > 10% Differences between A and T or G and C > 20%

26 Per Base GC Content X = position in read Y = Sequence content (%GC) In a random library: little to no difference between the different bases of a sequence run Detect overexpressed sequence (contamination)

27 Per Base GC Content GC content of any base > 5% from the mean GC content GC content of any base > 10% from the mean GC content

28 Per Sequence GC Content X = mean GC content Y = nb sequence Compute a normal distribution (blue) Plot raw data (red) An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset

29 Per Sequence GC Content the sum of the deviations from the normal distribution > 15% of the reads the sum of the deviations from the normal distribution > 30% of the reads

30 Per Base N Content X = position in read Y = N content It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

31 Per Base N Content any position shows an N content of >5% any position shows an N content of >20%

32 Sequence Length Distribution X = sequence length Y = nb sequence Detect sequences trimmed by the pipelines (to remove poor quality)

33 all sequences are not the same length any of the sequences have zero length

34 Sequence duplication level X = sequence duplication level Y = proportion of non-unique v.s. unique low level of duplication may indicate a very high level of coverage high level of duplication indicate some kind of enrichment bias

35 Sequence duplication level non-unique sequences make up more than 20% of the total non-unique sequences make up more than 50% of the total

36 Overrepresented Sequences lists all of the sequence which make up more than 0.1% of the total look for matches in a database of common contaminants

37 Overrepresented Sequences any sequence is found to represent more than 0.1% of the total any sequence is found to represent more than 1% of the total

38 Overrepresented Kmers Kmers? (5 mers) long sequences and poor quality: reduce the counts for exactly duplicated sequences. a partial sequence which is appearing at a variety of places (won't be seen by per base content plot or the duplicate sequence analysis).

39 a graph for the top 6 hits: enrichment of that Kmer across the length of your reads. This will show if you have a general enrichment, or if there is a pattern of bias at different points over your read length.

40 based on the base content of the library: calculates an expected level at which this k-mer should have been seen uses the actual count to calculate an observed/expected ratio for that k-mer

41 any k-mer is enriched more than 3 fold overall, or more than 5 fold at any individual position k-mer is enriched more than 10 fold at any individual base position

42 Session pratique 2 Attention! chr12 exon: tps de traiement conséquents Les résultats sont disponibles dans l'historique groomer + fastqc on chr12 Cliquez sur shared data puis publish histories Cliquez sur groomer + fastqc on chr12 Cliquez sur Import history A partir de quel outil le dataset n 2 a t-il été obtenu? Visualisez les résultats

43 Dataset Public data: exome sequenced by the International HapMap Project Single-end reads of 100bp, Illumina Genome Analyzer IIx RNA-seq data of this exome available (Pickrell et al., Nature, 2010)



46 A partir du dataset 9, visualisez l'outil qui a été utilisé Que signifie une taille de fenêtre à 1? Pourquoi la valeur de qualité 28 a t elle été choisie? Identifiez des reads trimmés Quelles sont le valeurs de qualité qui ont été enlevées?

47 FastQ Quality Trimmer

48 Simple Trimming of the ends ATCCTTTATAAATAATTAATA Min qual <= 28? ATCCTTTATAAATAATTAAT Min qual <= 28? ATCCTTTATAAATAATTAA Min qual <= 28?... Min qual <= 28?



51 Quality scores after trimming

Analysing chip- seq data using Galaxy

Analysing chip- seq data using Galaxy Analysing chip- seq data using Galaxy PhD programme 2013 Stéphanie Le Gras Overview Top menu Analyze your data Log in/out HISTORY PANEL keep track of each jobs that have been run Grey: job is waikng to

Plus en détail

Monday, December 2 nd 2013. Formation Galaxy

Monday, December 2 nd 2013. Formation Galaxy Formation Galaxy Lundi, 10 Février 2014 This training has not for objectives to introduce every Galaxy tool individually or to build a workflow to process your own data. Objectives: To provide a first

Plus en détail

Exemple PLS avec SAS

Exemple PLS avec SAS Exemple PLS avec SAS This example, from Umetrics (1995), demonstrates different ways to examine a PLS model. The data come from the field of drug discovery. New drugs are developed from chemicals that

Plus en détail

Une version à jour de java DOIT être téléchargée, car MAC OS ne prend pas en charge la version de Java fournie par défaut.

Une version à jour de java DOIT être téléchargée, car MAC OS ne prend pas en charge la version de Java fournie par défaut. ENGLISH VERSION NEAR BOTTOM OF PAGE Aperçu de MFT Mac OS Les exigences applicables à un utilisateur de MAC avec le système MFT sont décrites ci-dessous. Par défaut, MFT sélectionne un téléchargeur standard

Plus en détail

2011 Simplified Federal Child Support Tables

2011 Simplified Federal Child Support Tables 2011 Simplified Federal Child Support Tables These Simplified Tables are based on the updated Federal Child Support Tables that came into force on December 31, 2011. There are two Simplified Tables for

Plus en détail

2002 Maritime Mathematics Competition Concours de Mathématiques des Maritimes 2002

2002 Maritime Mathematics Competition Concours de Mathématiques des Maritimes 2002 2002 Maritime Mathematics Competition Concours de Mathématiques des Maritimes 2002 Instructions: Directives : 1 Provide the information requested below Veuillez fournir les renseignements demandés ci-dessous

Plus en détail

MAT 2377 Solutions to the Mi-term

MAT 2377 Solutions to the Mi-term MAT 2377 Solutions to the Mi-term Tuesday June 16 15 Time: 70 minutes Student Number: Name: Professor M. Alvo This is an open book exam. Standard calculators are permitted. Answer all questions. Place

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

Exercices LINUX TP2 INTRODUCTION. Les précédents exercices ont permis :

Exercices LINUX TP2 INTRODUCTION. Les précédents exercices ont permis : Exercices LINUX TP2 INTRODUCTION Les précédents exercices ont permis : - d introduire les commandes de base pour se déplacer dans l arborescence et la modifier - - de manipuler les fichiers de données,

Plus en détail

Mesure Measurement Réf 322 033 Etiquettes Terre, Jupiter, Mars, Français p 1 Lune pour dynamomètre 10 N English p 4 Earth, Jupiter, Mars, Moon,

Mesure Measurement Réf 322 033 Etiquettes Terre, Jupiter, Mars, Français p 1 Lune pour dynamomètre 10 N English p 4 Earth, Jupiter, Mars, Moon, Mesure Measurement Français p 1 English p 4 Version : 8006 Etiquettes Terre, Jupiter, Mars, Lune pour dynamomètre 10 N Earth, Jupiter, Mars, Moon, labels for 10 N dynamometer Mesure Etiquettes Terre, Jupiter,

Plus en détail



Plus en détail

Audio and Web Conferencing services. Orange Business Services. Web Conferencing

Audio and Web Conferencing services. Orange Business Services. Web Conferencing Audio and Web Conferencing services Orange Business Services Web Conferencing web conferencing completely integrated audio and web services conference availability 24hrs/7days up to 100 participants complete

Plus en détail

Solution d hébergement de "SWIFTAlliance ENTRY R7" Politique de Sauvegarde et de Restauration

Solution d hébergement de SWIFTAlliance ENTRY R7 Politique de Sauvegarde et de Restauration Solution d hébergement de "SWIFTAlliance ENTRY R7" Politique de Sauvegarde et de Restauration Avril 2012 I- Introduction Le présent document présente la politique de sauvegarde et de restauration à adopter

Plus en détail

Ensemble de distribution par gravité VA4-300-06

Ensemble de distribution par gravité VA4-300-06 Ensemble de distribution par gravité VA4-300-06 Attention Le système de chauffage par gravité doit obligatoirement être installé lorsque l une des options de façade de fonte est installée. Ce système ne

Plus en détail

6. Les désastres environnementaux sont plus fréquents. 7. On ne recycle pas ses déchets ménagers. 8. Il faut prendre une douche au lieu d un bain.

6. Les désastres environnementaux sont plus fréquents. 7. On ne recycle pas ses déchets ménagers. 8. Il faut prendre une douche au lieu d un bain. 1. Notre planète est menacée! 2. Il faut faire quelque chose! 3. On devrait faire quelque chose. 4. Il y a trop de circulation en ville. 5. L air est pollué. 6. Les désastres environnementaux sont plus

Plus en détail

Présentation des états financiers 2014 Presentation of the 2014 Financial Statements

Présentation des états financiers 2014 Presentation of the 2014 Financial Statements Présentation des états financiers 2014 Presentation of the 2014 Financial Statements Les faits saillants Highlights L état financier du MAMROT est très complexe et fournit de nombreuses informations. Cette

Plus en détail

DK6000. Quick Start Guide for Suppliers. March 2015 V1.1 0 /

DK6000. Quick Start Guide for Suppliers. March 2015 V1.1 0 / DK6000 Quick Start Guide for Suppliers March 2015 V1.1 0 / LOGIN Change the language Contact Us Your Username is Case Sensitive If you ve forgotten your password, do not try several time, just enter your

Plus en détail

The Skill of Reading French

The Skill of Reading French The Skill of Reading French By the end of this session... ALL of you will be able to recognise words A LOT of you will be able to recognise simple phrases SOME of you will be able to translate a longer

Plus en détail

DynDNS. Qu est-ce que le DynDNS?

DynDNS. Qu est-ce que le DynDNS? DynDNS. Qu est-ce que le DynDNS? Le DynDNS (Dynamic Domain Name Server) sert à attribuer un nom de domaine à une adresse ip dynamique. Chaque ordinateur utilise une adresse ip pour communiquer sur le réseau.

Plus en détail

(Programme de formation pour les parents ~ Training program for parents)

(Programme de formation pour les parents ~ Training program for parents) PODUM-INFO-ACTION (PIA) La «carte routière» pour les parents, sur l éducation en langue française en Ontario A «road map» for parents, on French-language education in Ontario (Programme de formation pour

Plus en détail

Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg

Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg Le présent document contient des informations qui sont la propriété de France Télécom. L'acceptation de ce document par son destinataire

Plus en détail

Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01

Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01 Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01 Electromagnetic compatibility (EMC) Part 4-3: Testing and measurement techniques Radiated, radio-frequency, electromagnetic field immunity test INTERPRETATION

Plus en détail

David Marsden Labour market segmentation in Britain: the decline of occupational labour markets and the spread of entry tournaments

David Marsden Labour market segmentation in Britain: the decline of occupational labour markets and the spread of entry tournaments David Marsden Labour market segmentation in Britain: the decline of occupational labour markets and the spread of entry tournaments Article (Accepted version) (Refereed) Original citation: Marsden, David

Plus en détail



Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail


MANUEL MARKETING ET SURVIE PDF MANUEL MARKETING ET SURVIE PDF ==> Download: MANUEL MARKETING ET SURVIE PDF MANUEL MARKETING ET SURVIE PDF - Are you searching for Manuel Marketing Et Survie Books? Now, you will be happy that at this

Plus en détail

ASSEMBLÉE LÉGISLATIVE DU YUKON LEGISLATIVE ASSEMBLY OF YUKON. First Session of the Thirty-third Legislative Assembly

ASSEMBLÉE LÉGISLATIVE DU YUKON LEGISLATIVE ASSEMBLY OF YUKON. First Session of the Thirty-third Legislative Assembly LEGISLATIVE ASSEMBLY OF YUKON First Session of the Thirty-third Legislative Assembly ASSEMBLÉE LÉGISLATIVE DU YUKON Première session de la trente-troisième Assemblée législative BILL NO. 46 ACT TO AMEND

Plus en détail



Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

MAXI SPEED-ROLL Course à boules

MAXI SPEED-ROLL Course à boules Course à boules Notice de montage 1. Posez le jeu à plat sur une table. 2. A l aide de la clé de service, dévissez les vis qui maintiennent la plaque de plexiglas et déposez la. 3. Dévissez les 4 vis fixant

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI ICC International Court of Arbitration Bulletin Cour internationale d arbitrage de la CCI Extract for restricted use Extrait à tirage limité International Court of Arbitration 38, Cours Albert 1er, 75008

Plus en détail

EIGHTH SESSION. "Project Management"

EIGHTH SESSION. Project Management EIGHTH SESSION "Project Management" Objectifs : L objectif de cette scéance est d apprendre à analyser et à planifier un projet. A cette fin nous étudierons : 1) la méthode des chemins critiques (CPM)

Plus en détail

Les licences Creative Commons expliquées aux élèves

Les licences Creative Commons expliquées aux élèves Les licences Creative Commons expliquées aux élèves Source du document : http://framablog.org/index.php/post/2008/03/11/education-b2i-creative-commons Diapo 1 Creative Commons presents : Sharing Creative

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail


LA PERSONNE SPÉCIALE LA PERSONNE SPÉCIALE These first questions give us some basic information about you. They set the stage and help us to begin to get to know you. 1. Comment tu t appelles? What is your name? Je m appelle

Plus en détail


Sujet de TPE PROPOSITION Single photon source made of single nanodiamonds This project will consist in studying nanodiamonds as single photon sources. The student will study the emission properties of such systems and will show

Plus en détail

How To connect to TonVPN Max / Comment se connecter à TonVPN Max

How To connect to TonVPN Max / Comment se connecter à TonVPN Max How To connect to TonVPN Max / Comment se connecter à TonVPN Max Note : you need to run all those steps as an administrator or somebody having admin rights on the system. (most of the time root, or using

Plus en détail

CHAPTER2. Le Problème Economique

CHAPTER2. Le Problème Economique CHAPTER2 Le Problème Economique Les Possibilités de Production et Coût d Opportunité La courbe des possibilités de production représente (CPP) représente la limite entre les différentes combinaisons en

Plus en détail

Photo: Sgt Serge Gouin, Rideau Hall Her Majesty The Queen in Right of Canada represented by the Office of the Secretary to the Governor General

Photo: Sgt Serge Gouin, Rideau Hall Her Majesty The Queen in Right of Canada represented by the Office of the Secretary to the Governor General As the father of five children and the grandfather of ten grandchildren, family is especially important to me. I am therefore very pleased to mark National Foster Family Week. Families, whatever their

Plus en détail

AINoE. Rapport sur l audition d AINoE Paris, 18 juin 2003

AINoE. Rapport sur l audition d AINoE Paris, 18 juin 2003 AINoE Abstract Interpretation Network of Excellence Patrick COUSOT (ENS, Coordinator) Rapport sur l audition d AINoE Paris, 18 juin 2003 Thématique Rapport sur l audition d AINoE Paris, 18 juin 2003 1

Plus en détail

LibQUAL Canada 2010: Participants Survey / Sondage auprès des participants

LibQUAL Canada 2010: Participants Survey / Sondage auprès des participants LibQUAL Canada 2010: Participants Survey / Sondage auprès des participants The goal of this survey is to assess your library's experience with LibQUAL+ in 2010: (1) whether 2010 participants would be interested

Plus en détail

ExAO-NG Capteur. ExAO-NG Sensor. Capteur fréquence cardiaque Heart rate sensor. Réf : 482 105. Français p 1. English p 3.

ExAO-NG Capteur. ExAO-NG Sensor. Capteur fréquence cardiaque Heart rate sensor. Réf : 482 105. Français p 1. English p 3. ExAO-NG Capteur ExAO-NG Sensor Français p 1 English p 3 Version : 3106 1 Généralités Le capteur fréquence cardiaque permet la détection et l enregistrement des phénomènes électriques cardiaques. Il permet

Plus en détail

Guide d'installation rapide TFM-560X YO.13

Guide d'installation rapide TFM-560X YO.13 Guide d'installation rapide TFM-560X YO.13 Table of Contents Français 1 1. Avant de commencer 1 2. Procéder à l'installation 2 Troubleshooting 6 Version 06.08.2011 16. Select Install the software automatically

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

Please find attached a revised amendment letter, extending the contract until 31 st December 2011.

Please find attached a revised amendment letter, extending the contract until 31 st December 2011. Sent: 11 May 2011 10:53 Subject: Please find attached a revised amendment letter, extending the contract until 31 st December 2011. I look forward to receiving two signed copies of this letter. Sent: 10

Plus en détail

Comment Insérer un Filigrane

Comment Insérer un Filigrane Comment Insérer un Filigrane Diffusé par Le Projet Documentation OpenOffice.org Table des Matières 1. Créer un filigrane sur une page...3 2. Sur plusieurs pages...5 3. Sur un paragraphe...6 4. Crédits...7

Plus en détail

Utilisation de la brique LEGO EV3 avec Automgen. Using EV3 brick with Automgen (C)2014 IRAI. Lego EV3, Automgen

Utilisation de la brique LEGO EV3 avec Automgen. Using EV3 brick with Automgen (C)2014 IRAI. Lego EV3, Automgen Utilisation de la brique LEGO EV3 avec Automgen Using EV3 brick with Automgen (C)2014 IRAI 1 Ce manuel décrit l'utilisation de la brique LEGO Ev3 avec Automgen. This manual describes the use of EV3 LEGO

Plus en détail

Le format P.D.F. (Portable Document Format) Mode d emploi et quelques exemples

Le format P.D.F. (Portable Document Format) Mode d emploi et quelques exemples Le format P.D.F. (Portable Document Format) Mode d emploi et quelques exemples 1 Le P.D.F., un format de visualisation Un format de lecture gratuit et universel Lire un document PDF A l aide de différents

Plus en détail

Date: 09/11/15 www.crmconsult.com Version: 2.0

Date: 09/11/15 www.crmconsult.com Version: 2.0 Date: 9/11/2015 contact@crmconsult.fr Page 1 / 10 Table des matières 1 SUGARPSHOP : SCHEMA... 3 2 PRESENTATION... 4 3 SHOPFORCE WITH SCREENSHOTS... 5 3.1 CLIENTS... 5 3.2 ORDERS... 6 4 INSTALLATION...

Plus en détail

SC 27/WG 5 Normes Privacy

SC 27/WG 5 Normes Privacy SC 27/WG 5 Normes Privacy Club 27001 Toulousain 12/12/2014 Lionel VODZISLAWSKY Chief Information Officer l.vodzislawsky@celtipharm.com PRE-CTPM 141212-Club27001 Toulouse normes WG5_LV L organisation de

Plus en détail

Once the installation is complete, you can delete the temporary Zip files..

Once the installation is complete, you can delete the temporary Zip files.. Sommaire Installation... 2 After the download... 2 From a CD... 2 Access codes... 2 DirectX Compatibility... 2 Using the program... 2 Structure... 4 Lier une structure à une autre... 4 Personnaliser une

Plus en détail


NOTICE D UTILISATION Option USB 2-Ports USB FRANCAIS NOTICE D UTILISATION Option USB 2-Ports USB FRANCAIS Introduction Ce supplément vous informe de l utilisation de la fonction USB qui a été installée sur votre table de mixage. Disponible avec 2 ports USB

Plus en détail

Manuel Version 2013 SOFiSTiK AG 2012

Manuel Version 2013 SOFiSTiK AG 2012 SOFiSTiK AG 2012 Manuel Version 2013 Copyright SOFiSTiK AG, D-85764 Oberschleißheim, 1990-2012 This manual is protected by copyright. No part may be reproduced, translated or rewritten in any way without

Plus en détail

Création de typologie sous SPSS

Création de typologie sous SPSS Création de typologie sous SPSS À Propos de ce document... 1 Introduction... 1 La démarche à suivre sous SPSS... 2 1. «Iterate»... 2 2. «Save»... 2 3. «Options»... 3 Analyse des résultats... 3 1. Historique

Plus en détail

Hydro-Québec Distribution

Hydro-Québec Distribution Hydro-Québec Distribution 2004 Distribution Tariff Application Demande R-3541-2004 Request No. 1 Reference: HQD-5, Document 3, Page 6 Information Requests HQD says that it will be required to buy energy

Plus en détail

French 2208A. French for Healthcare Le français de la santé

French 2208A. French for Healthcare Le français de la santé French 2208A French for Healthcare Le français de la santé Professeur : Heures de bureau : Olga Kharytonava disponible tous les jours par courriel, sauf le week-end. Préalable - Fr 1900 E ou Fr 1910, ou

Plus en détail



Plus en détail

Résumé. Création d un fichier d aide pour Système de supervision automatisé

Résumé. Création d un fichier d aide pour Système de supervision automatisé Résumé Création d un fichier d aide pour Système de supervision automatisé Tuteur entreprise Rosaire LAVOIE Tuteur École Bertrand BOYER Nicolas FYOT Spécialité Génie électrique Résumé Summary Soprema est

Plus en détail

IT & E - Integrated Training & emploi des personnes handicapées en dessin assisté par ordinateur, les détails et graphiques

IT & E - Integrated Training & emploi des personnes handicapées en dessin assisté par ordinateur, les détails et graphiques IT & E - Integrated Training & emploi des personnes handicapées en dessin assisté par ordinateur, les détails et graphiques TR/06/B/P/PP/178009 1 Information sur le projet Titre: Code Projet: Année: 2006

Plus en détail

GCSE Bitesize Controlled Assessment

GCSE Bitesize Controlled Assessment GCSE Bitesize Controlled Assessment Model 2 (for A/A* grade) Question 3 Subject: Topic: French Writing In this document you will find practical help on how to improve your grade. Before you start working

Plus en détail


CEST POUR MIEUX PLACER MES PDF CEST POUR MIEUX PLACER MES PDF ==> Download: CEST POUR MIEUX PLACER MES PDF CEST POUR MIEUX PLACER MES PDF - Are you searching for Cest Pour Mieux Placer Mes Books? Now, you will be happy that at this

Plus en détail

Level 1 French, 2003

Level 1 French, 2003 90084LP 1 Level 1 French, 2003 90084 Listen to and understand spoken language in French in familiar contexts INSTRUCTIONS FOR THE SUPERVISOR AND THE TEACHER Credits: Six 2.00 pm Friday 28 November 2003

Plus en détail

Comment Définir les Différents Paramètre d Impression

Comment Définir les Différents Paramètre d Impression Comment Définir les Différents Paramètre d Impression Diffusé par Le Projet Documentation OpenOffice.org OpenOffice.org Documentation Project How-To Table des matières 1. Impression d'une zone...3 2. Les

Plus en détail

The potential of the building sector in sustainable and lowcarbon

The potential of the building sector in sustainable and lowcarbon The potential of the building sector in sustainable and lowcarbon strategies Arab Hoballah, UNEP SUSTAINABLE AND COMPETITIVE HOTELS THROUGH ENERGY INNOVATION - NEZEH 2015 L'INNOVATION ÉNERGÉTIQUE AU SERVICE

Plus en détail

Academic Project. B3 - Architecture. Resit Project. Version 1.0 Last update: 24/05/2013 Use: Students Author: Samuel CUELLA

Academic Project. B3 - Architecture. Resit Project. Version 1.0 Last update: 24/05/2013 Use: Students Author: Samuel CUELLA SUPINFO Academic Dept. Resit Project Academic Project 2012-2013 Version 1.0 Last update: 24/05/2013 Use: Students Author: Samuel CUELLA Conditions d utilisations : SUPINFO International University vous

Plus en détail

TP3 LINUX. Analyse de données NGS sous LINUX

TP3 LINUX. Analyse de données NGS sous LINUX TP3 LINUX Bruno Granouillac, Christine Tranchant 4-8 Novembre 2013 Analyse de données NGS sous LINUX Les précédents TPs ont permis : d introduire les commandes de base pour se déplacer dans l arborescence

Plus en détail

Atradius Buyer Ratings Un guide des écrans Serv@Net pour Atradius Buyer Ratings

Atradius Buyer Ratings Un guide des écrans Serv@Net pour Atradius Buyer Ratings Atradius Buyer Ratings Un guide des écrans Serv@Net pour Atradius Buyer Ratings Novembre 2009 Serv@Net Login Scherm Loggez Loggez vous vous sur sur Serv@Net Serv@Net comme comme d habitude, d habitude,

Plus en détail

Assessing the performance of different methods for detecting Differential Item Functioning (DIF) Eric Frenette Pierre Valois Marie-Hélène Hébert

Assessing the performance of different methods for detecting Differential Item Functioning (DIF) Eric Frenette Pierre Valois Marie-Hélène Hébert Assessing the performance of different methods for detecting Differential Item Functioning (DIF) Eric Frenette Pierre Valois Marie-Hélène Hébert Atelier sur la Presented question at des the workshop langues

Plus en détail

Comportement par défaut de PVSS

Comportement par défaut de PVSS 1.1 Ecriture Comportement par défaut de PVSS 1.1.1 Messages d écriture envoyes par défaut? Write (device cache, sync ou async) Pvss : écriture sync ou async, sur le device useasynchwrite Default: 0 (no

Plus en détail



Plus en détail

Types of Dementia. Common Causes of Dementia

Types of Dementia. Common Causes of Dementia Types of Dementia Dementia is a loss of skills to think, remember and reason that is severe enough to affect daily activities. It is normal to need more time to remember things as we get older. Other thinking

Plus en détail


GRAPHIC STANDARDS MANUAL GRAPHIC STANDARDS MANUAL CHARTE GRAPHIQUE This Graphic Standards Manual is aimed at the relays of the Europe Direct information network. They are members of a single family dedicated to the same aim: the

Plus en détail

EADS TELECOM property Release of this document requires express permission of EADS TELECOM

EADS TELECOM property Release of this document requires express permission of EADS TELECOM Titre: M>Tunnel 2.5 Contraintes d emploi Version : 1.1 Date d émission: 07 Janvier 2003 Résumé: Ce document présente les recommandations de mise en œuvre du VPN M>Tunnel 2.5 afin de respecter les contraintes

Plus en détail

236. 2. 7 mai. 9 mai. Final paper. Final paper dû le 12 Mai

236. 2. 7 mai. 9 mai. Final paper. Final paper dû le 12 Mai 236. 2 17ème 5 mai 7 mai 9 mai dû le 12 Mai objectifs pp.76 78 pp.78 7Turn in p. 83. I L Europe pp. 80 81 8ème 3 mars 5 mars 7 mars Révision Examen 2 La famille pp. 134 137 9ème 10 mars 12 mars 14 mars

Plus en détail

Released 2014 Assessment: Mathematics FRENCH IMMERSION

Released 2014 Assessment: Mathematics FRENCH IMMERSION Assessment of Reading, Writing and Mathematics: Primary Division Released 2014 Assessment: Mathematics FRENCH IMMERSION Item-Specific Rubrics and Sample Student Responses with Annotations EQAO, 2 Carlton

Plus en détail


MANUEL D UTILISATION LED PANEL MANUEL D UTILISATION LED PANEL INTRODUCTION : Vous venez d'acquérir un LED Panel. Nous vous conseillons de lire attentivement ce manuel avant toute utilisation. Il s'agit d'un projecteur flood à LED composé

Plus en détail

The evolution and consequences of the EU Emissions Trading System (EU ETS)

The evolution and consequences of the EU Emissions Trading System (EU ETS) The evolution and consequences of the EU Emissions Trading System (EU ETS) Jon Birger Skjærseth Montreal 27.10.08 reproduction doivent être acheminées à Copibec (reproduction papier) Introduction What

Plus en détail

Instructions Mozilla Thunderbird Page 1

Instructions Mozilla Thunderbird Page 1 Instructions Mozilla Thunderbird Page 1 Instructions Mozilla Thunderbird Ce manuel est écrit pour les utilisateurs qui font déjà configurer un compte de courrier électronique dans Mozilla Thunderbird et

Plus en détail

Comment faire des étiquettes

Comment faire des étiquettes Comment faire des étiquettes Révision 0.1 31/03/2004 Réalisé avec : OOo 1.1.0 Plate-forme / Os : Toutes n révision, mode d'emploi n révision : x.yz x : n de version majeure, par exemple 0 pour une phase

Plus en détail

La philosophie et l expérience de la statistique bayésienne

La philosophie et l expérience de la statistique bayésienne La philosophie et l expérience de la statistique bayésienne Département de Statistique et Département des Sciences Politiques, Columbia University En visite à Sciences Po, Paris En collaboration avec Cosma

Plus en détail

Annonce de voyage Concerne les voyages en Suisse par les transports publics Utilisation d un véhicule privé La demande d utilisation d un véhicule

Annonce de voyage Concerne les voyages en Suisse par les transports publics Utilisation d un véhicule privé La demande d utilisation d un véhicule Annonce de voyage Concerne les voyages en Suisse par les transports publics Utilisation d un véhicule privé La demande d utilisation d un véhicule privée ne doit plus être utilisée. Elle est remplacée

Plus en détail

Nos bons plans / Our good deals (22/12/13-18/04/14)

Nos bons plans / Our good deals (22/12/13-18/04/14) Nos bons plans / Our good deals (22/12/13-18/04/14) Conditions page 15 Tarifs Individuels /Individuals Rates 21/12/2013 18/04/2014 Conditions page 15 Tarifs Famille-Tribu-Duo / Family-Tribu-Duo Rates 07/12

Plus en détail


TARIFS PUBLICS 2015 / 2016 PUBLIC RATES TARIFS PUBLICS 2015 / 2016 PUBLIC RATES DU / FROM 05/12/2015 AU / TO 11/12/2015 SKIEZ TOUS AU TARIF ENFANT! Kids price for everyone 2 adultes + 2 enfants 2 adults + 2 children 6 jours/days 187,20 127,60

Plus en détail

Mode dʼemploi User guide

Mode dʼemploi User guide Mode dʼemploi User guide Urban Connexion Kit for Microsoft Surface Référence Urban Factory ICR32UF Introduction: Vous venez d acheter un kit de connexion Urban Factory pour Microsoft Surface, et nous vous

Plus en détail


NOUVEAU MANIFESTE DES économistes ATTERRéS : 15 CHANTIERS POUR UNE AUTRE économie Read Online and Download Ebook NOUVEAU MANIFESTE DES économistes ATTERRéS : 15 CHANTIERS POUR UNE AUTRE économie DOWNLOAD EBOOK : NOUVEAU MANIFESTE DES économistes ATTERRéS : 15 Click link bellow and free

Plus en détail

La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen.

La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen. (AFMPS) La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen. Dr. André LHOIR AFMPS - COMP 22 février 2011 1 141/2000: Rare conditions Orphan drugs

Plus en détail



Plus en détail

Section B: Receiving and Reviewing the Technician Inspection Report & Claims Decision Process

Section B: Receiving and Reviewing the Technician Inspection Report & Claims Decision Process Phoenix A.M.D. International Inc. - Claim Procedures, Timelines & Expectations Timelines & Expectations 1. All telephone messages and e-mail correspondence is to be handled and responded back to you within

Plus en détail

Des villes, des pays et des continents.

Des villes, des pays et des continents. > Des villes, des pays et des continents. Towns, countries and continents. les pays et les provinces les villes la provenance vocabulaire Vous habitez où? En Europe. Où ça, en Europe? Au Portugal. Où ça

Plus en détail

... sous Mac OS X 10.4 (Tiger ) et 10.5 (Leopard )

... sous Mac OS X 10.4 (Tiger ) et 10.5 (Leopard ) Ce document a été rédigé dans le but de vous aider à utiliser Webdav avec OpenOffice.org Aqua sous Mac OS X. Merci de signaler toute erreur ou problème rencontré, nous corrigerons avec plaisir. Utiliser

Plus en détail

VISO. Installation - Spécifications - Entretien - Garantie Installation - Specifications - Maintenance - Warranty RJC21CC - RJC21NN RJC22CC - RJC22NN

VISO. Installation - Spécifications - Entretien - Garantie Installation - Specifications - Maintenance - Warranty RJC21CC - RJC21NN RJC22CC - RJC22NN Jet de corps externe External body jet VISO RJC21CC - RJC21NN RJC22CC - RJC22NN RJC23CC - RJC23NN Installation - Spécifications - Entretien - Garantie Installation - Specifications - Maintenance - Warranty

Plus en détail

Configuration de l'usurpation IP sur le Cache Engine dans une installation transparente avec commutateur de services de contenu

Configuration de l'usurpation IP sur le Cache Engine dans une installation transparente avec commutateur de services de contenu Configuration de l'usurpation IP sur le Cache Engine dans une installation transparente avec commutateur de services de contenu Contenu Introduction Avant de commencer Conventions Conditions préalables

Plus en détail

CHAPITRE 3 Nom Date 1 PENDANT ET APRES LES COURS. 1 Légendes Complete the captions for each of the following illustrations.

CHAPITRE 3 Nom Date 1 PENDANT ET APRES LES COURS. 1 Légendes Complete the captions for each of the following illustrations. CHAPITRE 3 Nom Date 1 Vocabulaire Mots 1 PENDANT ET APRES LES COURS 1 Légendes Complete the captions for each of the following illustrations. 1 Patrick arrive à l école à huit heures. 2 Il passe la journée

Plus en détail

Canal Latéral à La Loire Région Centre, Département du Cher

Canal Latéral à La Loire Région Centre, Département du Cher Figure 1 : arbre tombé au niveau de la passerelle de Cuffy, PK112 PK113 Fallen tree by the Cuffy footbridge, Km marker 113 Crédit Photo : Michèle et Gérard B. D B A / E n t e n t e d e s C a n a u x d

Plus en détail

SGR Services de gestion des risques

SGR Services de gestion des risques Title: Safety Achievement Financial Incentive System (SAFIS) Titre : Système d incitation financière à la sécurité DIRECTIVE Effective / En vigueur: 01/05/2008 Release / Diffusion No. 003 Page 1 of / de

Plus en détail

Promotion of bio-methane and its market development through local and regional partnerships. A project under the Intelligent Energy Europe programme

Promotion of bio-methane and its market development through local and regional partnerships. A project under the Intelligent Energy Europe programme Promotion of bio-methane and its market development through local and regional partnerships A project under the Intelligent Energy Europe programme Contract Number: IEE/10/130 Deliverable Reference: W.P.2.1.3

Plus en détail

Guide d'installation et Présentation de l'application Collecteur de données du «ColloidGen II» http://www.colloidgen.com

Guide d'installation et Présentation de l'application Collecteur de données du «ColloidGen II» http://www.colloidgen.com Guide d'installation et Présentation de l'application Collecteur de données du «ColloidGen II» http://www.colloidgen.com Installation and Overview Guide of Collector data Application for the "ColloidGen

Plus en détail

3615 SELFIE. http://graffitiresearchlab.fr HOW-TO / GUIDE D'UTILISATION

3615 SELFIE. http://graffitiresearchlab.fr HOW-TO / GUIDE D'UTILISATION 3615 SELFIE http://graffitiresearchlab.fr HOW-TO / GUIDE D'UTILISATION Hardware : Minitel Computer DIN FM545 45 connector (http://www.gotronic.fr/art-fiche-din-fm545-4747.htm) Cable Arduino compatible

Plus en détail



Plus en détail