Approches bioinformatiques de la cis-régulation

Dimension: px
Commencer à balayer dès la page:

Download "Approches bioinformatiques de la cis-régulation"

Transcription

1 2 Plan Approches bioinformatiques de la cis-régulation Stratégies de découvertes de motifs nucléiques Carl Herrmann TAGC & Univ. Méditerranée - Marseille Rappels sur les mécanismes de régulation transcriptionnelle Les grandes stratégies de recherche et découverte de motifs Combinaisons de motifs Empreintes phylogénétiques Master M1 BBSG année Régulation transcriptionnelle chez les eucaryotes pluricellulaires 4 Quelques éléments cis-régulateurs (CRM) chez la Drosophile ftz zebra element eve stripes 2 & 3+7 elements repression site cluster stripe 2 stripes rho lateral neurectoderm stripe element kni posterior element Ubx PBX element Source: Sandelin & Wasserman (2004) ps 6,8,10,12 stripes blastoderm + Mesoderm at GBE

2 5 Interactions Protéine-ADN - Motif HTH 6 Le motif Doigt de Zinc Cys His C2H2 domaine de liaison à l'adn Source: ftp.expasy.ch/databases/swiss-3dimage 7 Fixation d une protéine à plusieurs motifs doigts de zinc sur l ADN 8 Motifs d interaction protéine-adn: exemple des doigts à zinc enroulement de plusieurs motifs doigts à zinc sur le sillon majeur Source: Isalan et al., Biochemistry (1998) 37:

3 9 10 Identification expérimentale des sites régulateurs FootPrinting Caractéristiques des séquences cis-régulatrices Hautes résolution/fiabilité mais petite échelle! SELEX Mutagénèse dirigée Généralement courtes (de ± 5 à ± 25 bp) Généralement présentes en plusieurs exemplaires Généralement conservées évolutivement Simple hybride Souvent très variables Résolution/fiabilité plus faibles mais grande échelle! X-ChIP Protein Binding Arrays Alphabet limité (A,C,G,T) Localisées en 5', 3', introns, parfois très loin du gène cible Actuellement: < 500 signatures connues pour l'homme Banques de données: Transfac, JASPAR 12 Exemple de motif: Gcn4 2 situations possibles Je connais les facteurs de transcription qui m'intéressent Où se trouvent les sites de fixation potentiels? Quels sont les gènes cible potentiels? recherche de sites - chaines de caractères - matrices poids-position (activateur transcriptionnel des gènes de biosynthèse des acides aminés chez la levure) 5 TCTCTCTCCACGGCTAATTAGGTGATCATGAAAAAATGAAAAATTCATGAGAAAAGAGTCAGACATCGAAACATACAT J'ai des gènes dont je soupçonne qu'ils sont co-régulés ARO4 5 CACATCCAACGAATCACCTCACCGTTATCGTGACTCACTTTCTTTCGCATCGCCGAAGTGCCATAAAAAATATTTTTT ILV6 5 TGCGAACAAAAGAGTCATTACAACGAGGAAATAGAAGAAAATGAAAAATTTTCGACAAAATGTATAGTCATTTCTATC THR4 5 ACAAAGGTACCTTCCTGGCCAATCTCACAGATTTAATATAGTAAATTGTCATGCATATGACTCATCCCGAACATGAAA ARO1 5 ATTGATTGACTCATTTTCCTCTGACTACTACCAGTTCAAAATGTTAGAGAAAAATAGAAAAGCAGAAAAAATAAATAA HOM2 5 GGCGCCACAGTCCGCGTTTGGTTATCCGGCTGACTCATTCTGACTCTTTTTTGGAAAGTGTGGCATGTGCTTCACACA PRO3 Existe-t-il des motifs communs dans les séquences non-codantes proches? AAAAGAGTCA AAATGACTCA AAGTGAGTCA AAAAGAGTCA GGATGAGTCA AAATGAGTCA GAATGAGTCA AAAAGAGTCA découverte de motifs - énumération de motifs - maximisation de l'espérance (MEME, Gibbs Sampler) HIS7 5 ATGGCAGAATCACTTTAAAACGTGGCCCCACCCGCTGCACCCTGTGCATTTTGTACGTTACTGCGAAATGACTCAACG Alignement multiple (Orientation!) Adapté à partir de JvH

4 13 14 Recherche de motifs à l aide de chaînes de caractères Code ambigue IUPAC pour les nucléotides Deux approches Recherche d occurrence (exactes ou avec un nombre maximum de mésapariements, d insertion, ou de délétion) de chaînes de caractères représentants des variants de sites de fixation pour un facteur de transcription donné A C G T R Y W S M K H B V D N G A [GC] T C A Définition d une expression régulière ambiguë (code IUPAC) -> recherche d occurrences exactes ou approchées Evaluation statistique du nombre d occurrence trouvée (statistiques binomiales) Programme Dna-pattern de Jacques van Helden (ULB, Belgique); 15. Sites cis-régulateurs: expressions régulières. Site Name UASp2 Site D UAS Proximal UASp3 Site C Site A consensus Sequence ---actcacacacgtgggactagc---tttccagcacgtggggcgga-----ttatggcacgtgcgaataa-gtgatcgctgcacgtggcccga----taatttggcatgtgcgatctc------acgtccacgtggaactat------tttatcacgtgacacttttt gcacgtgggac----- Affinity high high high high low low low high-low PHO5 PHO84 PHO84 PHO8 group 2 UASp1 Site E Site B Distal consensus --TAAATTAGCACGTTTTCGC AATACGCACGTTTTTAATCTA -----TTACGCACGTTGGTGCTG----TTACCCGCACGCTTAATAT cgCACGTTt medium medium low low med-low Degenerate consensus Adenine Cytosine Guanine Thymine purine pyrimidine Weak hydrogen bonding Strong hydrogen bonding amino group at common position Keto group at common position not G not A not T not C any 16 Sites régulateurs: matrices de fréquences Sites de fixations pour le facteur de transcription Pho4p de la levure Gene PHO5 PHO84 PHO81 PHO8 PHO5 PHO84 PHO84 group 1 A C G T A or G C or T A or T G or C A or C G or T A, C or T G, C or T G, A, C G, A or T G, A, C or T Matrice donnant les fréquences des bases à chaque position pour un alignement de sites reconnus par le facteur de transcription Pho4 chez la levure (S. cerevisiae) GCACGTKKk (Source : Oshima et al.,1996) Source: TRANSFAC, Matrice F$PG04_01

5 17 Matrices pondérées 18 Contenu en information Site reconnu par le facteur Pho4p de la levure ni,j nombre de résidus i à la position j A taille de l'alphabet (= 4: A,T,G,C) pi probabilité à priori du résidu i fi,j fréquence relative du résidu i à la position j ni,j nombre de résidus i à la position j A taille de l'alphabet (= 4: A,T,G,C) pi probabilité à priori du résidu i k pseudo-poids (arbitraire, 1 ici) fi,j fréquence relative du résidu i à la position j f'i,j fréquence corrigée du résidu i à la position j k pseudo-poids (arbitraire, 1 ici) f'i,j fréquence corrigée du résidu i à la position j Source: Hertz & Stormo (1999) Recherche d'un motif avec une matrice pondérée La séquence est parcourue avec la matrice, et un score est calculé pour chaque position Le plus haut score reflète la plus grande probabilité d'avoir un site fonctionnel Problème de la définition du seuil et de l'évaluation statistique Source: Hertz & Stormo (1999) Recherche d'un motif avec une matrice pondérée

6 Interprétation du score Ws Interprétation du score Ws (matching weight) Ws Poids du segment de séquence s k position à l'intérieur de l'alignement rk résidu à la position k du segment de séquence prk Probabilité à priori du résidu rk frkk Probabilité à priori du résidu rk à la position k de la matrice (poids de l'alignement) L'alignement entre une matrice et un segment de séquence est la somme des poids des résidus alignés Ceci est équivalent au logarithme des ratios entre: - produit des matrices de fréquences (1) - produit des proba. à priori des résidus trouvés dans le segment de séquence (2) terme (1) = probabilité que le segment de séquence corresponde au motif décrit par la matrice terme (2) = probabilité que le segment de séquence correponde au modèle de fond P(S M) Probabilité du segment de séquence, étant donné la matrice le poids du segment = logarithme du rapport des vraisemblances (segment=motif) / (segment=fond) P(S B) Probabilité du segment de séquence, étant donné le fond (background) Recherche de sites à l'aide d'une matrice consensus 24 Evaluation des outils de recherche de sites (Patser de J. Hertz ; interface www par J. van Helden) Constitution de collections de séquences contrôles: + contenant des sites caractérisés - ne contenant assurément pas de sites - séquences "aléatoires" - séquences "brouillées" Différentes situations: Site correctement reconnu = "vrai positif" Prédiction abusive = "faux positif" Site manqué = "faux négatif" Absence de site correctement prédite = "vrai négatif"

7 25 Compromis lors de la recherche de sites entre: 26 Compromis lors de la recherche de sites Grande sélectivité, faible sensibilité: grande confiance dans les sites prédits nombre de sites reconnus mais beaucoup de sites réels sont manqués Faible sélectivité, grande sensibilité: les sites réels sont noyés dans une mer de faux positifs vrais négatifs Double évaluation: Sélectivité = Nombre vrais positifs/ Nombre total hits vrais positifs Sensibilité = Nombre vrais positifs/ Nombre total sites Total sites = vrais positifs + faux négatifs Total "hits" = vrais positifs + faux positifs faux négatifs 28 Pouvoir discriminant d'une matrice Fortement discriminant Fréquence Non sites Sites Total hits Score Score Raisonnablement discriminant Fréquence Non sites Sites Total hits Score seuil faux positifs score ATGC Faiblement discriminant Non sites Sites Total hits Fréquence Logo (Schneider, 1994) Matrice

8 29 Pertinence de la méthode découverte de motifs Recherche de sites de fixations du facteur de transcription type GARP (Arabidopsis thaliana) données transcriptomiques en amont du gènes TP53 chez homo sapiens... clusters de gènes co-exprimés W. Wassermann: "99% des prédictions de sites sont des faux-positifs..." sont-ils co-régulés? si oui, par quels facteurs de transcription? Importance du modèle de référence Découverte de motifs par énumération d oligonucléotides fréquence des oligo 6 dans toutes les séquences en amont des ORF de S.cerevisae Idée de base: les sites de fixations sont généralement répétés Principe algorithmique On recherche les occurrences de n-mères dans un ensemble de séquences fonctionnellement apparentées On compare le nombre d occurrence obtenue avec un modèlestatistique: soit basé sur la base des fréquences en (poly-)nucléotides dans l ensemble soit sur la base d un ensemble plus grand de séquences de même type (par exemple, toutes les régions amont des gènes) -> mise en évidence nucléotides équiprobables des surreprésentation dans un graphe bi-dimensionnel On évalue statistiquement les motifs trouvés Programmes Helden (ULB, Belgique) oligo-analysis et dyad-analysis de Jacques van

9 Découverte de motifs par maximisation de l'espérance Analogie roux borgne grand gaucher on cherche à maximiser la vraissemblance que les séquences partagent un motif commun plutôt qu'elles ne partagent rien... i.e. on cherche le motif qui maximise cette vraissemblance algorithme "expectation maximization" (EM) algorithme échantillonage de Gibbs roux borgne grand droitier brun borgne grand gaucher 2 approches possibles roux borgne grand droitier roux borgne grand droitier qu'est ce que ces individus ont en commun? qu'est ce qui les distingue LE PLUS d'autres individus? Situation de départ Maximum de vraissemblance on cherche à maximiser la vraissemblance on dispose d'un certain nombre de données X L=log des séquences partageant probablement un motif inconnu (séquences corégulées, séquences orthologues, fragments immunoprécipités,..) i.e. on cherche qui maximise L... cependant ces données sont incomplètes Z on ne sait pas où se situent ces motifs dans les séquences Pr X, Z / Pr X, Z / B... et on ignore un certain nombre de paramètres Pr(X,Z ) : probabilité que les séquences X contiennent un motif commun décrit par Pr(X,Z B) : proba. que les séquences X soient issues d'un modèle de fond (background, i.e. ne contiennent pas le motif ) on ne connait pas la matrice poids-position du motif, on se sait pas combien de fois le motif est présent dans chaque séquence (0, 1)

10 MEME Gibbs sampling matrice poids-position contenu en information fonction F à maximiser alignement Algo. "Espérance-maximisation" (EM) Algo. "Espérance-maximisation" (EM) on cherche à déterminer la matrice qui maximise la probabilité log Pr(X,Z ) on cherche à déterminer la matrice qui maximise la probabilité log Pr(X,Z ) si on connaissait Z (la position), on connaitrait... IGF1_PIG IGF1_CANFA IGF-1b IGF2_HORSE INS_AOTTR INS_PANTR INS_CHIBR ALQFVCGDRGFYFNKPTGYGSSSRRAPQTGIVDECCFRSCDLRRLEMYCAP----LKPAK ALQFVCGDRGFYFNKPTGYGSSSRRAPQTGIVDECCFRSCDLRRLEMYCAP----LKPAK ALQFVCGDRGFYFNKPTGYGSSSRRAPQTGIVDECCFRSCDLRRLEMYCAP----LKPAK TLQFVCGDRGFYFSRPASR--INRRS--RGIVEECCFRSCDLALLETYCATPAKSERDVS ALYLVCGERGFFYAPKTRREAEDLQVGQVELGGGSITGSLPP--LEGPMQK----RGVVD ALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQK----RGIVE ALYLVCGDRGFFYTPMAXXELEDPQVGQADPGVVPEAGRLQPLALEMTLQX----XGIVD :* :***:***:: :. : ** si on connaissait (la matrice), on connaitrait Z (la position) seq 1 seq 2 seq 3 ALQFVCGDRGFYF ALQFVCGDRGFYF ALQFVCGDRGFYF TLQFVCGDRGFYF ALYLVCGERGFFY ALYLVCGERGFFY ALYLVCGDRGFFY seq localisation du meilleur score avec la matrice

11 Algo. "Espérance-maximisation" (EM) Algo. "Espérance-maximisation" (EM) 2 étapes 2 étapes "Expectation step" Etape 1: on fait comme si on connaissait la matrice, et on calcule la meilleure position Etape 2: on fait comme si on connaissait la position, et on calcule la matrice? Z "Maximization step" Etape 1: on fait comme si on connaissait la matrice, et on estime la meilleure position Etape 2: on fait comme si on connaissait la position, et on estime la matrice chaque étape se nourrit des estimations de l'autre convergence vers un maximum local de Pr(X ) E-step: estimation de vraissemblance E-step: estimation de vraissemblance positions "non-motif" seq i k k+w-1 seq 1 positions "motif" quelle est la probabilité p(k) que le motif commence à la position k? seq 2 proba motif p m k =f 1 ak f 2 a k 1 f w ak w 1 seq 3 proba background seq 4 p b k =f b a1 f b a k 1 f b a k w f b al p b k p m k p i k = k pb k pm k courbes des pi(k)

12 M-step: maximisation seq 1 proba MLGHPQRTAR idem pour toutes les positions idem pour toutes les séquences on renormalise les colonnes on recommence le E-step avec la nouvelle matrice on arrête les itérations quand onrajoute 0,085àTenposition1 0,085àRenposition2... proba TRSQRVWLIM onrajoute 0,07àMenposition1 0,07àLenposition2... Maximisation de la vraissemblance A C D E F G H I K L M N P Q R S T V W Y le nombre max. d'itérations est atteint ou les paramètres de la matrice n'évoluent plus. maximum local de Pr(X,Z ) maxima locaux vs globaux? comment choisir la matrice de départ? comment déterminer la largeur W du motif? comment traiter les options oops,zoops,tcm? Maxima locaux/globaux Matrice de départ exemple: séquences contenant 2 motifs l'un très dégénéré l'autre très conservé ACGGCGATCCTAGCTAGGCTAGGCTAAAGATTAGTCGTTGCTTCGATC TTAGGTAGGCTATTTAATCCTTGGGCGCTAGGCTATAAATCCTTCGGCTA GGATCGGCTAGAAATTATCGCACACCATCGTTAGCTGCTTCCACCATAGATC TTAGACTCCGCATAGGATACGCTCGGTGCTTCGCTCTCGATCGATTCGCT 1 CGATCC CTTGGG CCATCG CTCCGC Z1=[5,20,25,6] Pr(X,Z1 1) Pr(X,Z2 2) 2 TGCTTCG TCCTTCG TGCTTCC TGCTTCG le choix de la matrice de départ détermine le type de maxima atteint MEME teste toutes les sous-séquences de longueur W il sélectionne celles qui améliorent le plus Pr(X,Z ) après une itération Z2=[42,43,33,31]

13 Options MEME Échantillonnage de Gibbs oops: chaque séquence contient une occurence du motif zoops: chaque séquence contient 0 ou 1 occurence paramètre supplémentaire: probabilité qu'une séquence contienne un motif on cherche à maximiser Pr(X,Z )/Pr(X,Z B) on utilise un algorithme stochastique (donc non déterministe) tcm: chaque séquence contient un nombre quelconque de motifs non-recouvrants paramètre supplémentaire: proba. que chaque position corresponde à un motif ces paramètres entrent dans la définition de la fonction à maximiser Pr(X,Z ) 2 étapes mise à jour de la matrice échantillonage aléatoire d'une séquence parmi les N Échantillonnage de Gibbs les résultats peuvent varier d'une fois à l'autre, il faut faire tourner l'algorithme plusieurs fois. Échantillonnage de Gibbs Etape 0: initialisation de la matrice + modèle de fond Etape 0: initialisation de la matrice + modèle de fond positions aléatoires N séquences matrice initiale f i, j= fréquence globale de chaque résidu j n i, j b j N B f 0, j = n 0, j b j j k =1 n0, k B

14 Échantillonnage de Gibbs Échantillonnage de Gibbs Etape 1: mise à jour Etape 2: échantillonage aléatoire sélection aléatoire proba que la position i corresponde à un site le site de la séquence sélectionnée est retiré de la matrice, qui est mise à jour à chaque position i, calcul du score Ai= pm i pb i proba que la position i corresponde à un "non-site" E-step: estimation de vraissemblance Échantillonnage de Gibbs positions "non-motif" seq i k k+w-1 Etape 2: échantillonnage aléatoire positions "motif" quelle est la probabilité p(k) que le motif commence à la position k? proba motif p m k =f 1 ak f 2 a k 1 f w ak w 1 proba background p b k =f b a1 f b a k 1 f b a k w f b al p k = p b k p m k k p b k p m k sélection d'un nouveau site avec probabilité proportionnelle à Ai mise à jour de la matrice et du modèle de fond

15 Échantillonnage de Gibbs Échantillonnage de Gibbs Etape 1: mise à jour (2ème itération) contenu en information (en bits) W sélection aléatoire le site de la séquence sélectionnée est retiré de la matrice, qui est mise à jour on itère un nombre fixe de fois J L= i =1 j =1 n i, j log f i,j f 0, j normalisation en fonction du nombre de paramètres de la matrice matrice nucléique, largeur W : 3W matrice protéique, largeur W : 19W LIPP = L N param implémentation pratique: MotifSampler [G Thijs et al., Bioinformatics(2001) vol.17 n.12,] particularité: le modèle de fond utilisation d'un modèle de Markov L P S /Bm =P b1,,b m l =m 1 P bl / b l 1,, bl m m=3 S=ACGGTAGGCTAGGCTAGCTAGGCT fonction F à maximiser P S/ B3 =P ACG P G/ ACG P T / CGG P ACG =P A P C P G

16 implémentation pratique: MotifSampler implémentation pratique: MotifSampler [G. Thijs et al., Bioinformatics(2001) vol.17 n.12,] [G. Thijs et al., Bioinformatics(2001) vol.17 n.12,] paramètres du modèles de Markov estimés sur les séquences de départ (parfois trop peu) estimés sur un jeu de données indépendant ordre du MM implémentation pratique: MotifSampler Résumé Plusieurs approches pour étudier les mécanismes de régulation transcriptionnelle (cis-régulation): [G. Thijs et al., Bioinformatics(2001) vol.17 n.12,] le modèle de Markov améliore les performances de l'algorithme: 33 séquences (500 pb) de plantes avec motif G-box (cons. CACGTG) comparaison entre MM d'ordre 0 et 3, influence des séquences bruitées vrais positifs faux négatifs Recherche de sites de fixation Découverte de motifs chaînes de caractères ou expressions régulières (code IUPAC) énumération d'oligo-mers, recherche d'un signal statistique matrices poids-position issues de banques de données (Transfac, JASPAR,...); outils: Patser, MotifLocator, MAST, etc... méthodes de maximisation de l'espérance (MEME, échantillonage de Gibbs)

17 Résumé des difficultés majeures Difficultés majeures Où chercher? Comment interpréter/valider les résultats? In silico In vitro In vivo "In phenotypo" CRM drosophile Pr opor tionofnon codingdna 120,00% 100,00% percent 80,00% 60,00% 40,00% 20,00% 0,00% S.cerevisae C.elegans D.m ela nogaster A.thalian a F.rubripes O.sativa G.Bush M.Musculus [link] - 65 [Li et al., Genome Biology, 2007] Recherche de groupes de sites (clusters) Stratégies de recherche et découverte de motifs Réduction de l'espace de recherche (l'histoire du gars qui cherche ses clés) 2 articles + commentaire dans PNAS 99(2), Janvier Berman BP, Nibu Y, Pfeiffer BD, Tomancak P, Celniker SE, Levine M, Rubin GM, Eisen MB (2002). Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome. Proc. Natl. Acad. Sci. USA 99: Markstein M, Markstein P, Markstein V, Levine MS (2002 ). Genome-wide analysis of clustered Dorsal binding sites identifies putative target genes in the Drosophila embryo. Proc Natl Acad Sci USA 99: Michelson AM (2002). Deciphering genetic regulatory codes: A challenge for functional genomics. Proc Natl Acad Sci USA 99: zones proches du promoteur - positions relatives spécifiques Filtrage des motifs trouvés par des conditions sur le nombre et le type d occurrences (règles logiques + fenêtres glissantes) Empreinte phylogénétique comparaison de régions non codantes proches de gènes orthologues chez des espèces à bonne distance évolutive (e.g. homme/souris) blocs conservés impliqués dans la régulation transcriptionnelle (?)

18 69 70 Bcd, Nanos Kr, Kni, Gt, Hb,Tll D. melanogaster: de l'embryon à l'adulte Eve En LIFE: The Science of Biology, Purves et al, Source:Wolpertetal.(1998) Idées principales Utilisation d'information biologique supplémentaire sur l'organisation des séquences cis-régulatrices: regroupements fréquents de sites de fixations au sein des promoteurs ou enhancers. 72 Méthodes bioinformatiques Markstein et al. consensus IUPAC de Dl (string search) et une fenêtre glissante. évaluation statistique du nombre d'occurences de Dl dans une fenêtre Markstein et al : Dorsal, impliqué dans la différenciation dorso-ventrale précoce au cours du développement de l'embryon de Drosophile: recherche de deux sites ou plus (haute affinité) dans une fenêtre de 400 ou 1000 pb. Berman et al. : facteurs impliqués dans la différenciation antéro-posterior précoce au cours du développement de l'embryon de Drosophile (modèle de référence) Berman et al. MEME pour générer 5 matrices pour des FT Patser pour rechercher d'autres occurrences des motifs correspondant dans le génome. recherche de groupes de sites (env. 12) pour cinq facteurs (Bcd, Hb, Cad, Kni, Kr) dans une fenêtre de 700 bp. MEME Dans les deux cas, les enhancers identifiés ont été évalués par des constructions transgèniques (enhancer + gène rapporteur) et/ou des hybridation in situ.

19 Markstein et al. - Results (1/4) 73 Fig. 1.. zen and sog expression patterns. Precellular embryos are oriented with anterior to the left and dorsal up. A and C were hybridized with a digoxigenin-labeled zen antisense RNA probe, and B and D were hybridized with a sog probe. The staining patterns were visualized with anti-digoxigenin antibodies and histochemical staining. (A and C) Parasagittal and surface views of the same embryo. (B and D) Different planes of focus through a single embryo. Note that sog RNAs are detected in nuclei (D). (E) Diagram of the zen 5' regulatory region showing distribution of the four Dl binding sites in the VRE. 75 Markstein et al. - Results (3/5) Wt sog expression 6 kb transgene Markstein et al. - Results (2/5) 74 Fig. 2. Distribution of Dl clusters. (A) Frequency of clusters in genome containing a minimum of two, three, or four Dl binding sites in intervals of 1,000 or 400 bp. The Dl sequences searched are represented by the degenerate sequences GGGWWWWCCM and GGGWDWWWCCM, which encode a total of 208 unique sequences. Of the three clusters found to contain four sites in 400 bp, one is associated with zen and another with sog. (B) Statistical analysis of the expected (exp) vs. observed (obs) numbers of clusters with two, three, and four Dl sites found in windows of 1,000 and 400 bp. The number of observed clusters of three and four sites are many standard deviations () from their expected frequencies, suggesting that their occurrence at the observed frequencies is not a random event. See Materials and Methods for details. (C) Distribution of Dl binding sites associated with sog, Ady, and Phm. Illustrated below the sog cluster are the three DNA fragments (sog A, B, and C) that were tested for regulatory activities in transgenic embryos. Berman et al. - Results (1/4) 76 Fig. 1. Distribution of predicted transcription factor binding sites and binding site clusters in the vicinity of eve. (A) Predicted high-affinity (P < ) binding sites for the transcription factors Bcd, Cad, Hb, Kr, and Kni in 1 Mb of genomic sequence surrounding the gene evenskipped (eve) are displayed as colored boxes. Blue boxes in the center of the panel represent positions of annotated exons, with eve highlighted in red. Binding sites and genes shown above the midline map to the forward DNA strand; those below the midline map to the reverse strand. (B) Sites from A that occur in 700-bp windows containing at least 13 predicted binding sites. (C) Expanded view of region containing all clusters in B, with positions of known eve enhancers marked with gray ellipses. 393 bp transgene Fig. 3. The sog lateral stripe enhancer. Wild-type and transgenic embryos are oriented with anterior to the left and dorsal up. A-C were hybridized with a sog antisense RNA probe, and D-I were hybridized with a lacz probe to monitor the activities of different sog-lacz transgenes. (A-C) Endogenous sog expression pattern in precellular (A), gastrulating (B), and elongating (C) embryos. Staining is detected initially in broad lateral stripes (A and B) but is restricted to the mesectoderm during germ band elongation (C). (D-F) sog-lacz transgene that contains a 6-kb region of sog intron 1. Staining is detected in broad lateral stripes before (D) and after (E) cellularization but is restricted to the mesectoderm in elongating embryos (F). The staining pattern is similar to the normal sog expression pattern except that there is progressive loss of staining in the mesectoderm (compare C with F; data not shown). (G-I) sog-lacz transgene that contains a 393-bp fragment from sog intron 1, which encompasses all four high-affinity Dl binding sites. The lacz expression pattern is similar to that obtained with the 6-kb sog DNA fragment except that staining may be somewhat weaker and mottled.

20 Berman et al. Results (2/4) 77 Berman et al. Results (3/4) 78 Fig. 3. Expression patterns of selected genes flanking novel binding site clusters. We examined the expression patterns of 49 genes adjacent to one of the 28 novel binding site clusters described in Table 2 in syncytial and cellular blastoderm embryos (whole mount RNA in situ images are available in Table 2 (which is published as supporting information on the PNAS web site) and on the Berkeley Drosophila Genome Project website (http://www.fruitfly.org/). Eleven of these genes representing 10 clusters had early embryonic expression patterns characteristic of genes regulated by maternal and gap transcription factors and are shown here., References for flanking genes are as follows: gt (25, 30, 37-40), otd (41-43), btd (44, 45), pdm1 (46), pdm2 (46), Dfd (47-49), Antp (49, 50), ftz (51-53), odd (54), and psq (55) test utilisant un jeu de contrôle de 19 CRM actifs dans le dévelop. embryonnaire de la drosophile Berman et al. - Results (4/4) Berman et al. - épilogue Genome Biology (2004): test systématique de 37 enhancers prédits: 15 3? 19 Fig. 4. Identification of a novel enhancer controlling posterior expression of giant. (A) Cluster of binding sites found between 2.9 Kb and 1.8 Kb upstream of giant. The DNA segment surrounding the cluster (labeled "posterior enhancer") was cloned into a lacz fusion construct and introduced into the genome via germline transformation as described in Materials and Methods. (B and C) Expression of giant in syncitial blastoderm stage embryos as determined by RNA in situ hybridization. B shows a wild-type embryo, and C shows a Kr1/Kr1 embryo lacking Krüppel (Kr) function. Without repression by Kr, the anterior border of the posterior expression domain shifts anteriorly. (D and E) Expression of lac Z in embryos containing construct from A. D shows a wild-type embryo, and E shows a Kr1/Kr1 embryo. Expression of the lacz construct in the mutant embryo shows similar expansion to that seen in gt. est-ce qu'on peut distinguer les "bons" des "mauvais"??

21 81 82 Critère le plus discriminant densité de sites alignés et préservés Conservation des sites de fixation des FT Conservation des sites de fixation des FT Les sites de fixations des facteurs de transcription sont généralement conservés. différents types de conservation des TFBS % identité % identité Seq A Seq A Seq B Seq B "Aligné" "Conservé"

22 85 86 homme/poulet homme Lenhard et al (2003) Point de départ: alignement de deux régions orthologues (promoter du gène de la beta-globin chez l'homme) homme/macaque homme/souris Calcul de la conservation dans une fenêtre glissante (taille fixée par l'utilisateur). Recherche de sites à l'aide de PWM, avec un seuil fixé par l'utilisateur; les matrices sont choisies au sein d'une base de donnée libre (Jaspar) ou peuvent être entrées par l'utilisateur. Seuls les sites retrouvés dans les régions fortement conservées (seuil fixé par l'utilisateur) sont retenus. 87 homme/macaque homme/souris 88 homme/poulet homme homme/vache homme/vache Jeu de contrôle pour tester la méthode

23 89 Figure 2. The impact of phylogenetic footprinting analysis. Both (a-c) a high-quality set (14 genes and 40 verified sites), and (d-f) a larger collection of promoters (57 genes and 110 sites, from the TRANSFAC database were analyzed. (a,d) Comparison of the selectivity (defined as the average number of predictions per 100 bp, using all models) between orthologous and single-sequence analysis modes. (b,e) Comparison of the sensitivity (the portion of 40 or 110 verified sites, respectively, that are detected with the given setting) between orthologous and singlesequence analysis modes. (c,f) Ratios of the number of sites detected in single-sequence mode to the number detected in orthologous-sequence mode; the pair: single-sequence ratios are displayed for both sensitivity (detected verified sites) and selectivity (all predicted sites) Choix de d'espèces à comparer Phylogenetic shadowing: comparaison de multiples espèces proches Phylogenetic shadowing Phylogenetic footprinting Trop proches: temps d'évolution trop court pour distinguer évolution neutre/contrainte Distance optimale: homme/souris (~ 60 Mannées) Outils d'alignement globaux: Slagan (tient compte des réarrangments chromosomiques) BLASTz browser de genome UCSC, Vista Proba de mutation = pt Proba de mutation = pn p = probabilité de mutation par unité de temps Likelihood of mutation (log) [ Bofelli et al. Science, 2003] Comment chercher un élément fonctionnel spécifique aux primates? N espèces T

24 93 Empreintes phylogénétiques (phylogenetic footprinting) Séquences ultra-conservées humaines ~ 3% du génome humain est codant ~ 5% du génome humain est sous pression de sélection conservé? ARX: homeobox gene, development of CNS mrna introns intergenic exonic? 100 Conservation plus forte que les séquences codantes close to/in genes involved in - developmental processes - regulation of transcription Conservation > Function POLA: DNA polymerase alpha subunit Probabilité d'observé un uc dans une séquence sous évolution neutre: P< 1e [Bejerano et al., Science:304(2004)] fonctionnel Exemple d'éléments uc 481 segments > 200 bp ayant 100% d'identité dans des régions orthologues homme/souris/rat : éléments ultra conservés (uc) test de 167 uc chez homme/souris 67 (=45%) ont une activité enhancer positive Conservation extrême vs. ultraconservation? [Penacchio et al., Nature (2006)] [Visel et al., Nature Genetics (2008)]

Les bases de données transcriptionnelles en ligne

Les bases de données transcriptionnelles en ligne Les bases de données transcriptionnelles en ligne Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

MAT 2377 Solutions to the Mi-term

MAT 2377 Solutions to the Mi-term MAT 2377 Solutions to the Mi-term Tuesday June 16 15 Time: 70 minutes Student Number: Name: Professor M. Alvo This is an open book exam. Standard calculators are permitted. Answer all questions. Place

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Lhouari Nourine 1 1 Université Blaise Pascal, CNRS, LIMOS, France SeqBio 2012 Marne la vallée, France 2.

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Recherche d information textuelle

Recherche d information textuelle Recherche d information textuelle Pré-traitements & indexation B. Piwowarski CNRS / LIP6 Université Paris 6 benjamin@bpiwowar.net http://www.bpiwowar.net Master IP - 2014-15 Cours et travaux pratiques

Plus en détail

Promotion of bio-methane and its market development through local and regional partnerships. A project under the Intelligent Energy Europe programme

Promotion of bio-methane and its market development through local and regional partnerships. A project under the Intelligent Energy Europe programme Promotion of bio-methane and its market development through local and regional partnerships A project under the Intelligent Energy Europe programme Contract Number: IEE/10/130 Deliverable Reference: W.P.2.1.3

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

EXEMPLE : FAILLITE D ENTREPRISES

EXEMPLE : FAILLITE D ENTREPRISES EXEMPLE : FAILLITE D ENTREPRISES Cet exemple a pour objectif d étudier la faillite d entreprises. Les données proviennent de l ouvrage de R.A.Johnson et D.W Wichern : «Applied Multivariate Statistical

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Logitech Tablet Keyboard for Windows 8, Windows RT and Android 3.0+ Setup Guide Guide d installation

Logitech Tablet Keyboard for Windows 8, Windows RT and Android 3.0+ Setup Guide Guide d installation Logitech Tablet Keyboard for Windows 8, Windows RT and Android 3.0+ Setup Guide Guide d installation English.......................................... 3 Français.........................................

Plus en détail

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique Objectifs Clustering On ne sait pas ce qu on veut trouver : on laisse l algorithme nous proposer un modèle. On pense qu il existe des similarités entre les exemples. Qui se ressemble s assemble p. /55

Plus en détail

APPENDIX 6 BONUS RING FORMAT

APPENDIX 6 BONUS RING FORMAT #4 EN FRANÇAIS CI-DESSOUS Preamble and Justification This motion is being presented to the membership as an alternative format for clubs to use to encourage increased entries, both in areas where the exhibitor

Plus en détail

MELTING POTES, LA SECTION INTERNATIONALE DU BELLASSO (Association étudiante de lʼensaparis-belleville) PRESENTE :

MELTING POTES, LA SECTION INTERNATIONALE DU BELLASSO (Association étudiante de lʼensaparis-belleville) PRESENTE : MELTING POTES, LA SECTION INTERNATIONALE DU BELLASSO (Association étudiante de lʼensaparis-belleville) PRESENTE : Housing system est un service gratuit, qui vous propose de vous mettre en relation avec

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Exemple PLS avec SAS

Exemple PLS avec SAS Exemple PLS avec SAS This example, from Umetrics (1995), demonstrates different ways to examine a PLS model. The data come from the field of drug discovery. New drugs are developed from chemicals that

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

National Director, Engineering and Maintenance East (Montreal, QC)

National Director, Engineering and Maintenance East (Montreal, QC) National Director, Engineering and Maintenance East (Montreal, QC) Reporting to the General Manager, Engineering and Maintenance, you will provide strategic direction on the support and maintenance of

Plus en détail

Instructions Mozilla Thunderbird Page 1

Instructions Mozilla Thunderbird Page 1 Instructions Mozilla Thunderbird Page 1 Instructions Mozilla Thunderbird Ce manuel est écrit pour les utilisateurs qui font déjà configurer un compte de courrier électronique dans Mozilla Thunderbird et

Plus en détail

M1 BE, BV, BBSG 17 Décembre 2007

M1 BE, BV, BBSG 17 Décembre 2007 M1 BE, BV, BBSG 17 Décembre 2007 BIOLOGIE MOLECULAIRE EUCARYOTE (Sans document ni calculette ; durée 2h) Librement inspiré de Wang et al. CELL, 105, 851 862, 2001 et Cao et al. MOL CEL BIOL, 25, 364 376,

Plus en détail

IDENTITÉ DE L ÉTUDIANT / APPLICANT INFORMATION

IDENTITÉ DE L ÉTUDIANT / APPLICANT INFORMATION vice Direction des Partenariats Internationaux Pôle Mobilités Prrogrramme de bourrses Intterrnattiionalles en Mastterr (MIEM) Intterrnattiionall Mastterr Schollarrshiip Prrogrramme Sorrbonne Parriis Ciitté

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Différences entre Homme et singes?

Différences entre Homme et singes? Différences entre Homme et singes? Différences entre Homme et singes? Apparition de l œil? Apparition du vol? Apparition des hémoglobines? Molécule d hémoglobine HEME Chaîne polypeptidique de type 2 Chaîne

Plus en détail

Support Orders and Support Provisions (Banks and Authorized Foreign Banks) Regulations

Support Orders and Support Provisions (Banks and Authorized Foreign Banks) Regulations CANADA CONSOLIDATION CODIFICATION Support Orders and Support Provisions (Banks and Authorized Foreign Banks) Regulations Règlement sur les ordonnances alimentaires et les dispositions alimentaires (banques

Plus en détail

Delphine MENORET. Décodage des réseaux géniques impliqués dans le remodelage cellulaire chez l'embryon de Drosophila melanogaster

Delphine MENORET. Décodage des réseaux géniques impliqués dans le remodelage cellulaire chez l'embryon de Drosophila melanogaster Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) Delphine MENORET le mardi 3 décembre 2013 Décodage des réseaux géniques impliqués dans le remodelage cellulaire chez l'embryon de Drosophila melanogaster

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

INF6304 Interfaces Intelligentes

INF6304 Interfaces Intelligentes INF6304 Interfaces Intelligentes filtres collaboratifs 1/42 INF6304 Interfaces Intelligentes Systèmes de recommandations, Approches filtres collaboratifs Michel C. Desmarais Génie informatique et génie

Plus en détail

that the child(ren) was/were in need of protection under Part III of the Child and Family Services Act, and the court made an order on

that the child(ren) was/were in need of protection under Part III of the Child and Family Services Act, and the court made an order on ONTARIO Court File Number at (Name of court) Court office address Applicant(s) (In most cases, the applicant will be a children s aid society.) Full legal name & address for service street & number, municipality,

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr)

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) Doc.No. : EUM/OPS/TEN/13/706466 Issue : v3 Date : 7 May 2014 WBS : EUMETSAT Eumetsat-Allee 1, D-64295 Darmstadt, Germany Tel: +49 6151 807-7 Fax: +49

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Interest Rate for Customs Purposes Regulations. Règlement sur le taux d intérêt aux fins des douanes CONSOLIDATION CODIFICATION

Interest Rate for Customs Purposes Regulations. Règlement sur le taux d intérêt aux fins des douanes CONSOLIDATION CODIFICATION CANADA CONSOLIDATION CODIFICATION Interest Rate for Customs Purposes Regulations Règlement sur le taux d intérêt aux fins des douanes SOR/86-1121 DORS/86-1121 Current to August 4, 2015 À jour au 4 août

Plus en détail

COPYRIGHT Danish Standards. NOT FOR COMMERCIAL USE OR REPRODUCTION. DS/EN 61303:1997

COPYRIGHT Danish Standards. NOT FOR COMMERCIAL USE OR REPRODUCTION. DS/EN 61303:1997 COPYRIGHT Danish Standards. NOT FOR COMMERCIAL USE OR REPRODUCTION. DS/EN 61303:1997 COPYRIGHT Danish Standards. NOT FOR COMMERCIAL USE OR REPRODUCTION. DS/EN 61303:1997 COPYRIGHT Danish Standards. NOT

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

VI. Tests non paramétriques sur un échantillon

VI. Tests non paramétriques sur un échantillon VI. Tests non paramétriques sur un échantillon Le modèle n est pas un modèle paramétrique «TESTS du CHI-DEUX» : VI.1. Test d ajustement à une loi donnée VI.. Test d indépendance de deux facteurs 96 Différentes

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail

The UNITECH Advantage. Copyright UNITECH International Society 2011. All rights reserved. Page 1

The UNITECH Advantage. Copyright UNITECH International Society 2011. All rights reserved. Page 1 The UNITECH Advantage Copyright UNITECH International Society 2011. All rights reserved. Page 1 Two key aspects of UNITECH Distinctive by being selective Standing out while fitting in The Wide and Varied

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Package Contents. System Requirements. Before You Begin

Package Contents. System Requirements. Before You Begin Package Contents DWA-125 Wireless 150 USB Adapter CD-ROM (contains software, drivers, and manual) Cradle If any of the above items are missing, please contact your reseller. System Requirements A computer

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Structure secondaire d une molécule d ARNt Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Plan Généralités sur l ARN Moyens de prédiction des structures

Plus en détail

Cytoscape pour la visualisation et le traitement de grands graphes

Cytoscape pour la visualisation et le traitement de grands graphes Cytoscape pour la visualisation et le traitement de grands graphes Laurent Risser CNRS, Institut de Mathématiques de Toulouse 01/16 1) Principaux logiciels Outils libres pour la visualisation et traitement

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien)

Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien) Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien) Alain Bretto & Joël Priolon - 25 mars 2013 Question Dans un équilibre

Plus en détail

MCMC et approximations en champ moyen pour les modèles de Markov

MCMC et approximations en champ moyen pour les modèles de Markov MCMC et approximations en champ moyen pour les modèles de Markov Gersende FORT LTCI CNRS - TELECOM ParisTech En collaboration avec Florence FORBES (Projet MISTIS, INRIA Rhône-Alpes). Basé sur l article:

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite.

Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite. Rational ClearCase or ClearCase MultiSite Version 7.0.1 Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite. Product Overview IBM Rational

Plus en détail

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Next Generation Sequencing Bioinformatics - Biology ! Initié en 2008, le programme international ICGC a pour objectif de

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

Photoactivatable Probes for Protein Labeling

Photoactivatable Probes for Protein Labeling Photoactivatable Probes for Protein Labeling THÈSE N O 4660 (2010) PRÉSENTÉE LE 26 MARS 2010 À LA FACULTÉ SCIENCES DE BASE LABORATOIRE D'INGÉNIERIE DES PROTÉINES PROGRAMME DOCTORAL EN CHIMIE ET GÉNIE CHIMIQUE

Plus en détail

First Nations Assessment Inspection Regulations. Règlement sur l inspection aux fins d évaluation foncière des premières nations CONSOLIDATION

First Nations Assessment Inspection Regulations. Règlement sur l inspection aux fins d évaluation foncière des premières nations CONSOLIDATION CANADA CONSOLIDATION CODIFICATION First Nations Assessment Inspection Regulations Règlement sur l inspection aux fins d évaluation foncière des premières nations SOR/2007-242 DORS/2007-242 Current to September

Plus en détail

REALISATION D UN FLIP BOOK

REALISATION D UN FLIP BOOK REALISATION D UN FLIP BOOK I. Préambule Vous disposez de fichiers sources de qualité pour la réalisation de votre flip book. Il est utile de connaître quelques éléments techniques pour la réalisation de

Plus en détail

Corrigé 4 : Édition de fichiers texte - Vi. Pré-requis. Édition de fichiers texte - Vi. / Faux.

Corrigé 4 : Édition de fichiers texte - Vi. Pré-requis. Édition de fichiers texte - Vi. / Faux. Édition de fichiers texte - Vi CORRIGÉS DU CHAPITRE 4 129 Corrigé 4 : Édition de fichiers texte - Vi Pré-requis, Faux. - Faux.. Faux. / Faux. 0 Vrai. Il existe des implémentations libres de Vi pour tous

Plus en détail

TP B43 Bio-Informatique 1. TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE

TP B43 Bio-Informatique 1. TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE TP B43 Bio-Informatique 1 TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE 1) Quelques commandes LINUX - Ouvrir un terminal (menu Applications Accessoires Terminal) - Afficher la

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

INTRODUCTION TO NEXT GENERATION SEQUENCING

INTRODUCTION TO NEXT GENERATION SEQUENCING ECOLE DE BIOINFORMATIQUE INITIATION AU TRAITEMENT DES DONNÉES DE GÉNOMIQUE OBTENUES PAR SÉQUENÇAGE À HAUT DÉBIT 05-10 OCTOBRE 2014 - STATION BIOLOGIQUE - ROSCOFF INTRODUCTION TO NEXT GENERATION SEQUENCING

Plus en détail

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000 FEDERATION INTERNATIONALE DE L AUTOMOBILE Norme 8861-2000 NORME FIA CONCERNANT LA PERFORMANCE DES DISPOSITIFS D'ABSORPTION D'ÉNERGIE À L'INTÉRIEUR DES BARRIÈRES DE PNEUS DE FORMULE UN Ce cahier des charges

Plus en détail

La classification automatique de données quantitatives

La classification automatique de données quantitatives La classification automatique de données quantitatives 1 Introduction Parmi les méthodes de statistique exploratoire multidimensionnelle, dont l objectif est d extraire d une masse de données des informations

Plus en détail

Zelio S2020 va SR2COM01

Zelio S2020 va SR2COM01 A. Introduction : A. Introduction : Zelio S2020 va SR2COM01 Communication modem via l interface de communication SR2COM01 Modem communication through the modem communication interface SR2COM01 L objectif

Plus en détail

Notices of Uninsured Deposits Regulations (Trust and Loan Companies)

Notices of Uninsured Deposits Regulations (Trust and Loan Companies) CANADA CONSOLIDATION CODIFICATION Notices of Uninsured Deposits Regulations (Trust and Loan Companies) Règlement sur les avis relatifs aux dépôts non assurés (sociétés de fiducie et de prêt) SOR/2008-64

Plus en détail

fonction processus biologiques criblage

fonction processus biologiques criblage Transcriptome 1 Transcriptome : ensemble des ARNm ou transcrits présents dans une population de cellules dans des conditions données. Plan Introduction Acquisition des données Description des données Transformation,

Plus en détail

Natixis Asset Management Response to the European Commission Green Paper on shadow banking

Natixis Asset Management Response to the European Commission Green Paper on shadow banking European Commission DG MARKT Unit 02 Rue de Spa, 2 1049 Brussels Belgium markt-consultation-shadow-banking@ec.europa.eu 14 th June 2012 Natixis Asset Management Response to the European Commission Green

Plus en détail

Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00

Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00 Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00 HFFv2 1. OBJET L accroissement de la taille de code sur la version 2.0.00 a nécessité une évolution du mapping de la flash. La conséquence de ce

Plus en détail

WEKA, un logiciel libre d apprentissage et de data mining

WEKA, un logiciel libre d apprentissage et de data mining Approche Data Mining par WEKA WEKA, un logiciel libre d apprentissage et de data mining Yves Lechevallier INRIA-Rocquencourt E_mail : Yves.Lechevallier@inria.fr Yves Lechevallier Dauphine 1 1 WEKA 3.4

Plus en détail

Quick start. Pulsar ellipse 300/500/650/800/1200. Pulsar ellipse premium 500/650/800/1200

Quick start. Pulsar ellipse 300/500/650/800/1200. Pulsar ellipse premium 500/650/800/1200 Quick start Pulsar ellipse 300/500/650/800/1200 Pulsar ellipse premium 500/650/800/1200 Using the additional functions available on your Pulsar ellipse Utilisation des fonctions additionnelles de votre

Plus en détail

Cheque Holding Policy Disclosure (Banks) Regulations. Règlement sur la communication de la politique de retenue de chèques (banques) CONSOLIDATION

Cheque Holding Policy Disclosure (Banks) Regulations. Règlement sur la communication de la politique de retenue de chèques (banques) CONSOLIDATION CANADA CONSOLIDATION CODIFICATION Cheque Holding Policy Disclosure (Banks) Regulations Règlement sur la communication de la politique de retenue de chèques (banques) SOR/2002-39 DORS/2002-39 Current to

Plus en détail

No. 48900 * Argentina and Uruguay

No. 48900 * Argentina and Uruguay No. 48900 * Argentina and Uruguay Agreement signed by the Presidents of the Argentine Republic and of the Eastern Republic of Uruguay for the joint monitoring of the BOTNIA UPM PULL plant and all the industrial

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

Introduction aux outils BI de SQL Server 2014. Fouille de données avec SQL Server Analysis Services (SSAS)

Introduction aux outils BI de SQL Server 2014. Fouille de données avec SQL Server Analysis Services (SSAS) MIT820: Entrepôts de données et intelligence artificielle Introduction aux outils BI de SQL Server 2014 Fouille de données avec SQL Server Analysis Services (SSAS) Description générale Ce tutoriel a pour

Plus en détail

Contents Windows 8.1... 2

Contents Windows 8.1... 2 Workaround: Installation of IRIS Devices on Windows 8 Contents Windows 8.1... 2 English Français Windows 8... 13 English Français Windows 8.1 1. English Before installing an I.R.I.S. Device, we need to

Plus en détail

Editing and managing Systems engineering processes at Snecma

Editing and managing Systems engineering processes at Snecma Editing and managing Systems engineering processes at Snecma Atego workshop 2014-04-03 Ce document et les informations qu il contient sont la propriété de Ils ne doivent pas être copiés ni communiqués

Plus en détail

The Exploration of HIV Fitness Landscapes

The Exploration of HIV Fitness Landscapes Diss. ETH No. 20486 The Exploration of HIV Fitness Landscapes A dissertation submitted to ETH Zurich for the degree of Doctor of Sciences presented by João Zambujo Ramos Martins Dipl.-Ing. INSA Lyon, France

Plus en détail

Evaluation de la prime de risques de la vente d une bande d énergie nucléaire

Evaluation de la prime de risques de la vente d une bande d énergie nucléaire 28/3/2011 ANNEXE 6 (Source: Electrabel) Evaluation de la prime de risques de la vente d une bande d énergie nucléaire Si nous vendons une bande d énergie nucléaire à certains clients, que nous garantissons

Plus en détail

Approche bayésienne des modèles à équations structurelles

Approche bayésienne des modèles à équations structurelles Manuscrit auteur, publié dans "42èmes Journées de Statistique (2010)" Approche bayésienne des modèles à équations structurelles Séverine Demeyer 1,2 & Nicolas Fischer 1 & Gilbert Saporta 2 1 LNE, Laboratoire

Plus en détail

CEST POUR MIEUX PLACER MES PDF

CEST POUR MIEUX PLACER MES PDF CEST POUR MIEUX PLACER MES PDF ==> Download: CEST POUR MIEUX PLACER MES PDF CEST POUR MIEUX PLACER MES PDF - Are you searching for Cest Pour Mieux Placer Mes Books? Now, you will be happy that at this

Plus en détail

General Export Permit No. Ex. 18 Portable Personal Computers and Associated Software

General Export Permit No. Ex. 18 Portable Personal Computers and Associated Software CANADA CONSOLIDATION CODIFICATION General Export Permit No. Ex. 18 Portable Personal Computers and Associated Software Licence générale d exportation n o Ex. 18 Ordinateurs personnels portatifs et logiciels

Plus en détail

Instructions for Completing Allergan s Natrelle Silicone-Filled Breast Implant Device Registration Form

Instructions for Completing Allergan s Natrelle Silicone-Filled Breast Implant Device Registration Form Instructions for Completing s Natrelle Silicone-Filled Breast Implant Device Registration Form Please read the instructions below and complete ONE of the attached forms in either English or French. IMPORTANT:

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

DMX CONTROLEUR. Indicateurs LED : Ils indiquent les fonctionnalités correspondantes.

DMX CONTROLEUR. Indicateurs LED : Ils indiquent les fonctionnalités correspondantes. DMX CONTROLEUR CA-24D CA-2405 Le CA-24D est un contrôleur DMX 24 canaux spécialement conçu pour une utilisation avec le CA-2405. Il est muni d un panneau de commande convivial, de 24 scènes programmables,

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

I. Programmation I. 1 Ecrire un programme en Scilab traduisant l organigramme montré ci-après (on pourra utiliser les annexes):

I. Programmation I. 1 Ecrire un programme en Scilab traduisant l organigramme montré ci-après (on pourra utiliser les annexes): Master Chimie Fondamentale et Appliquée : spécialité «Ingénierie Chimique» Examen «Programmation, Simulation des procédés» avril 2008a Nom : Prénom : groupe TD : I. Programmation I. 1 Ecrire un programme

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Differential Synchronization

Differential Synchronization Differential Synchronization Neil Fraser Google 2009 BENA Pierrick CLEMENT Lucien DIARRA Thiemoko 2 Plan Introduction Stratégies de synchronisation Synchronisation différentielle Vue d ensemble Dual Shadow

Plus en détail

Laboratory accredited by the French Home Office (official gazette date February 5 th, 1959, modified) Valid five years from August 27 th, 2013

Laboratory accredited by the French Home Office (official gazette date February 5 th, 1959, modified) Valid five years from August 27 th, 2013 CLASSIFICATION REPORT OF REACTION TO FIRE PERFORMANCE IN ACCORDANCE WITH THE EUROPEAN STANDARD EN 350-+A: 203 and in compliance with the French Home Office Regulation dated November 2 st, 2002 concerning

Plus en détail

PARIS ROISSY CHARLES DE GAULLE

PARIS ROISSY CHARLES DE GAULLE GPS 2 34 1 E 49 0 46 N GPS* 2 56 56 E 49 0 12 N Votre contact / Your contact: et / and: Accueil : Cabines téléphoniques publiques Reception: Public telephone kiosks Navette Shuttle AÉROPORT DE TT CAR TRANSIT

Plus en détail

La relation Structure Dynamique Fonctions

La relation Structure Dynamique Fonctions La relation Structure Dynamique Fonctions Ex 1 : Mouvement de chaînes latérales pour la fonction de la Myoglobine Ex 2 : Dynamique et équilibres allostériques (NtrC) Ex 3 : La fonction enzymatique de Purine

Plus en détail