CATALOGUE DES PRESTATIONS DE LA

Dimension: px
Commencer à balayer dès la page:

Download "CATALOGUE DES PRESTATIONS DE LA"

Transcription

1 1/23

2 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE... 3 ANALYSE TRANSCRIPTIONNELLE SUR PUCE 3 EUCARYOTE AFFYMETRIX... 4 ANALYSE TRANSCRIPTIONNELLE SUR PUCE EXON 1.0 ST AFFYMETRIX... 7 ANALYSE TRANSCRIPTIONNELLE SUR PUCE GENE 1.0 ST AFFYMETRIX ANALYSE DES VARIATIONS DE L ADN GENOMIQUE GENOTYPAGE DE SNP SUR PUCE AFFYMETRIX HYBRIDATION GENOMIQUE COMPARATIVE (CGH) SUR PUCE AGILENT ANALYSE DES SITES DE LIAISON DE PROTEINES REGULATRICES SUR L ADN ANALYSE DES PRODUITS D'IMMUNOPRECIPITATION CHROMATINIENNE SUR PUCE AGILENT (ChIP-on-Chip) CONTACT Plate-forme Biopuces et Séquençage de Strasbourg IGBMC 1 rue Laurent Fries ILLKIRCH Cedex Dr Philippe Kastner Tél: www-microarrays.u-strasbg.fr 2/23

3 ANALYSE TRANSCRIPTIONNELLE PRESTATIONS STANDARD Pour l étude de l expression génique, notre plate-forme propose un service pour l ensemble des solutions clé en main de la Société Affymetrix. Trois lignes de produits sont actuellement disponibles : Les puces «3» eucaryotes Affymetrix : Ces puces pan-génomiques constituent la première génération des puces d expression Affymetrix et sont disponibles pour une trentaine d espèces différentes. Elles contiennent des oligonucléotides de 25-mer qui interrogent la région 3 des transcrits, proche de la queue poly A (~600 bases). Les puces «Exon» Affymetrix : Ces puces, commercialisées depuis fin 2005 ont une densité 5 fois supérieure aux puces «3». Elles permettent d explorer simultanément l expression génique et les patterns d épissage alternatif à l échelle du génome sur une seule puce. Elles interrogent plus d un million d exons dans les régions transcrites connues, mais aussi prédites. Affymetrix propose des puces «Exon» pour l homme, le rat et la souris uniquement. Les puces «Gene» Affymetrix: Dernières nées des puces d expression Affymetrix, ces puces sont destinées à mesurer l activité transcriptionnelle totale des gènes les mieux annotés chez l homme, la souris ou le rat en utilisant des oligonucléotides distribués sur toute la longueur des transcrits. De part leur prix attractif, elles représentent un outil avantageux pour les nouveaux utilisateurs de puces à ADN ou pour ceux souhaitant augmenter le nombre de réplicats biologiques dans leurs expériences. PRESTATIONS A LA CARTE En complément de ces prestations standard et pour répondre à des besoins spécifiques, nous pouvons adapter les protocoles existants ou réaliser des projets en utilisant d autres technologies. Ainsi par le passé, nous avons conduit des analyses transcriptionnelles sur des puces procaryotes à façon Affymetrix, sur des puces d expression de la Société Agilent ou sur des puces à oligonucléotides spottées sur lames de verre. Nous collaborons également fréquemment avec des équipes de recherche pour développer de nouvelles applications. Les produits en cours d évaluation actuellement sur notre plate-forme concernent l analyse des mirna sur puces Agilent. 3/23

4 ANALYSE TRANSCRIPTIONNELLE SUR PUCE 3 EUCARYOTE AFFYMETRIX Les puces «3» eucaryotes Affymetrix utilisent des ARNc biotinylés comme sonde dans une hybridation à une couleur où chaque échantillon à comparer est hybridé sur une puce distincte. Notre plate-forme prend en charge l ensemble des étapes depuis la validation des ARN totaux jusqu à l extraction des données d expression des images de puces. 1. GENECHIP 3 EXPRESSION ARRAYS Sur ces puces à haute densité, chaque transcrit est interrogé par un set de 11 à 16 paires d oligonucléotides distinctes. Les oligonucléotides d une longueur de 25-mer sont dirigés préférentiellement contre la région 3 des messagers, proche de la queue polya. Chaque paire d oligonucléotides est constituée d un oligonucléotide «perfect match» complémentaire à la séquence d intérêt et d un oligonucléotide «mismatch» identique au «perfect match» correspondant, à l exception de la base centrale qui a été mutée. L oligonucléotide «mismatch» sert à détecter et éliminer le signal non spécifique. Le tableau ci-dessous résume les caractéristiques générales de quelques unes des puces Affymetrix utilisées par la plate-forme à ce jour. Pour une liste exhaustive des puces ou pour de plus amples informations, veuillez consulter le site web GeneChip Arrays Human Genome U133 Plus 2.0 Array Mouse Genome Array Rat Genome Array Arabidopsis ATH1 Genome Array Drosophila Genome 2.0 Array Conditionnement 2, 6, 30 2, 6, 30 2, 6, 30 5, 30 2, 6, 30 Nombre de transcrits interrogés ~47400 ~39000 ~30000 ~24000 ~18500 Nombre de gènes interrogés ~38500 ~34000 ~28000 n/a n/a Nombre de sets d oligonucléotides >54000 >45000 >31000 > Source principale des séquences Paires d oligonucléotide/ transcrit interrogé GenBank, dbest, RefSeq, UniGene Database Build133, 04/2001 GenBank, dbest, RefSeq, UniGene Database Build107, 06/2002 GenBank, dbest, RefSeq, UniGene Database Build99, 06/2002 TIGR-ATH1 Data base, 12/2001 D. melanogaster genome Release 3.1 de FlyBase et BDGP /23

5 2. SERVICES PROPOSES Quantification et validation des ARN totaux par spectrophotométrie et électrophorèse capillaire Synthèse d ARNc biotinylés Hybridation, lavage et scanning des puces Extraction des données, normalisation et calcul du signal avec les algorithmes statistiques d Affymetrix (version MAS 5.0) et/ou les algorithmes Robust Multiarray Average (RMA) à l aide du logiciel «Expression Console» d Affymetrix L analyse des transcrits différentiellement exprimés entre groupes expérimentaux qui requiert l utilisation d outils additionnels n est pas prise en charge dans la prestation standard. Elle peut néanmoins être réalisée sous la forme de collaboration avec des membres des plate-formes ou des équipes de recherche de l IGBMC. 3. ECHANTILLONS DE DEPART Le succès final de l expérience est étroitement lié à la qualité des échantillons d ARN totaux de départ. Un soin tout particulier doit être pris pour éviter toute trace de contamination (phénol, DEPC, ADN génomique ) ou de dégradation. Quantité Concentration Caractéristiques des ARN totaux à fournir Quantité optimale : 600 à 1000 ng Quantité minimale : 20 à 50 ng ng/ul DO260/DO280 1,8 Qualité Réplicats biologiques Conditions d envoi Absence de signe de dégradation sur un gel d agarose ou Ratio 28S/18S 1,6 et/ou RIN 6 sur un profil du Bioanalyzer d Agilent Nombre recommandé : 5 Nombre minimal : 3 En solution dans de l eau sur de la carboglace Les tubes doivent être bien identifiés et accompagnés d une fiche descriptive avec la concentration et le volume total de chaque ARN 5/23

6 4. CONTROLES QUALITE Qualité des ARNc synthétisés Rendement Taille moyenne Ratio des intensités 3 /5 des gènes contrôles (actine, GAPDH ) 30 µg à partir de 250 ng d ARN total nt 3-4 Qualité des hybridations ARNc procaryote BioB (0.75 pm) ARNc procaryotes BioC (2.5 pm), BioD (12.5 pm), Cre (50 pm) «Présent» dans 50% des échantillons «Présent» dans 100% des échantillons Bruit de fond moyen 150 bruit (variation de pixel à pixel) 4 Pourcentage de gènes détectés Intensité globale des puces 20-30% et ne variant pas plus de 10 à 15% entre des échantillons biologiques équivalents ne variant pas plus de 2 à 3 fois entre des échantillons biologiques équivalents 5. LIVRAISON DES RESULTATS A la fin de son projet, le client reçoit sous forme électronique (sur DVD) : Une copie de l ensemble des données brutes Affymetrix (fichiers.xml,.dat,.cel,.chp) Une copie des données d expression (fichier.chp) au format Excel Un document résumant l ensemble des contrôles qualité effectués lors du projet 6/23

7 ANALYSE TRANSCRIPTIONNELLE SUR PUCE EXON 1.0 ST AFFYMETRIX Les puces «Exon» Affymetrix utilisent des ADNc simple brin biotinylés comme sonde dans une hybridation à une couleur où chaque échantillon à comparer est hybridé sur une puce distincte. Notre plate-forme prend en charge l ensemble des étapes depuis la validation des ARN totaux jusqu à l extraction des données d expression avec les outils Affymetrix. 1. GENECHIP EXON 1.0 ST ARRAYS Ces puces qui contiennent de 4 à 5.5 millions d oligonucléotides, permettent de mesurer le niveau d expression non seulement des transcrits mais aussi des exons individuellement. La plupart des exons d une taille > 25 pb sont représentés sur la puce par au moins une probe set. Les probe sets sont constituées de 4 oligonucléotides «perfect match» de 25- mer en moyenne, pour un total de >30 oligonucléotides pour la majorité des transcrits. Les sondes ont été conçues à partir de séquences génomiques. Elles sont annotées avec leurs coordonnées génomiques et leur appartenance aux transcrits et exons connus ou prédits. Les probe sets ont été classifiées en fonction du niveau de confiance de leur annotation (Core set : sondes basées sur les séquences d ADNc, Extended set : Core set + sondes basées sur les séquences d EST, Full set : Extended set + sondes basées sur les séquences prédites). Les utilisateurs peuvent aisément choisir d analyser leurs données à l un ou l autre des 3 degrés d annotation des probe sets, au niveau des transcrits et/ou des exons. Le tableau ci-dessous résume les caractéristiques générales des puces «Exon» Affymetrix. Pour de plus amples informations, veuillez consulter le site web GeneChip Arrays Human Exon 1.0 ST array Mouse Exon 1.0 ST array Rat Exon 1.0 ST array Conditionnement 2, 6, 30 2, 6, 30 2, 6, 30 Nombre total de probe sets 1.4 million 1.2 million 1.0 million Nombre total d exon clusters Nombre total de transcrit clusters Source principale des séquences >1 million ~1 million ~ 850,000 > > > Juillet 2003 (GenBank, dbest, RefSeq, UCSC genome synteny maps, Ensembl, GENSCAN ) Mai 2004 (GenBank, dbest, RefSeq, UCSC genome synteny maps, Ensembl, GENSCAN ) Juin 2003 (GenBank, dbest, RefSeq, UCSC genome synteny maps, Ensembl, GENSCAN ) 7/23

8 2. SERVICES PROPOSES Quantification et validation des ARN totaux par spectrophotométrie et électrophorèse capillaire Synthèse d ADNc biotinylés Hybridation, lavage et scanning des puces Extraction des données, normalisation et calcul du signal avec les algorithmes Robust Multiarray Average (RMA) pour les sondes du Core set au niveau des transcrits et des exons, à l aide du logiciel «Expression Console» d Affymetrix L analyse des transcrits ou des exons différentiellement exprimés entre groupes expérimentaux qui requiert l utilisation d outils commerciaux additionnels tels que Array Assist de Stratagene, Xray de Biotics System ou Genomic suite de Partek, n est pas prise en charge dans la prestation standard. Elle peut néanmoins être réalisée sous la forme de collaboration avec des membres des plate-formes ou des équipes de recherche de l IGBMC. 3. ECHANTILLONS DE DEPART Le succès final de l expérience est étroitement lié à la qualité des échantillons d ARN totaux de départ. Un soin tout particulier doit être pris pour éviter toute trace de contamination (phénol, DEPC, ADN génomique ) ou de dégradation. Quantité Concentration Caractéristiques des ARN totaux à fournir Quantité optimale : 5 à 7 μg Quantité minimale : 1 à 2 μg 600 ng/μl DO260/DO280 1,8 Qualité Réplicats biologiques Conditions d envoi Absence de signe de dégradation sur un gel d agarose ou Ratio 28S/18S 1,6 et/ou RIN 6 sur un profil du Bioanalyzer d Agilent Nombre recommandé : 5 Nombre minimal : 3 En solution dans de l eau sur de la carboglace Les tubes doivent être bien identifiés et accompagnés d une fiche descriptive avec la concentration et le volume total de chaque ARN 8/23

9 4. CONTROLES QUALITE Qualité des sondes synthétisées Rendement de la synthèse d ARNc Taille moyenne des ARNc Rendement de la synthèse d ADNc simple brin 20 μg à partir de 2 μg d ARN total nt 5.5 μg à partir de 8 à 10 μg d ARNc Qualité des hybridations Intensités des sondes bactériennes contrôles poly-adénylées ajoutées aux Ilys<Iphe<Ithr<Idap échantillons avant synthèse Intensités des sondes procaryotes contrôles ajoutées aux échantillons IBioB< IBioC<IBioD<ICre avant hybridation Pos vs Neg auc 0.80 Pourcentage de gènes détectés 20-30% et ne variant pas plus de 10 à 15% entre des échantillons biologiques équivalents 5. LIVRAISON DES RESULTATS A la fin de son projet, le client reçoit sous forme électronique (sur DVD) : une copie des données brutes Affymetrix à l exception des fichiers DAT (fichiers.xml,.cel,.chp) Une copie des résultats d expression au format.txt Un document résumant l ensemble des contrôles qualités effectués lors du projet. 9/23

10 ANALYSE TRANSCRIPTIONNELLE SUR PUCE GENE 1.0 ST AFFYMETRIX Les puces «Gene» Affymetrix utilisent des ADNc simple brin biotinylés comme sonde dans une hybridation à une couleur où chaque échantillon à comparer est hybridé sur une puce distincte. Notre plate-forme prend en charge l ensemble des étapes depuis la validation des ARN totaux jusqu à l extraction des données d expression. 1. GENECHIP GENE 1.0 ST ARRAYS Les puces «Gene» bénéficient d un design simplifié utilisant les informations de séquences génomiques les plus récentes. Chaque gène est interrogé par un seul set de 26 oligonucléotides «perfect-match» en moyenne. Ces oligonucléotides de 25-mer sont distribués sur toute la longueur du locus génomique. Lors de l analyse, leurs signaux sont compilés en une seule valeur représentant tous les transcrits d un même gène. Le tableau ci-dessous résume les caractéristiques générales des puces «Gene» Affymetrix. Pour de plus amples informations, veuillez consulter le site web GeneChip Arrays Human Gene 1.0 ST array Mouse Gene 1.0 ST array Rat Gene 1.0 ST array Conditionnement 2, 6, 30 2, 6, 30 2, 6, 30 Nombre total d oligonucléotides Nombre de gènes interrogés ~28869 ~28853 ~27342 Assemblage du génome Mars 2006 (UCSC Hg18 ; NCBI build 36 Fev (UCSC mm8 ; NCBI build 36 Nov (UCSC rn4 ; Baylor HGSC build SERVICES PROPOSES Quantification et validation des ARN totaux par spectrophotométrie et électrophorèse capillaire Synthèse d ADNc biotinylés Hybridation, lavage et scanning des puces Extraction des données, normalisation et calcul du signal avec les algorithmes Robust Multiarray Average (RMA) à l aide du logiciel «Expression Console» d Affymetrix L analyse des transcrits différentiellement exprimés entre groupes expérimentaux qui requiert l utilisation d outils additionnels n est pas prise en charge dans la prestation standard. Elle peut néanmoins être réalisée sous la forme de collaboration avec des membres des plate-formes ou des équipes de recherche de l IGBMC. 10/23

11 3. ECHANTILLONS DE DEPART Le succès final de l expérience est étroitement lié à la qualité des échantillons d ARN totaux de départ. Un soin tout particulier doit être pris pour éviter toute trace de contamination (phénol, DEPC, ADN génomique ) ou de dégradation. Quantité Concentration Caractéristiques des ARN totaux à fournir Quantité optimale : 600 à 1000 ng Quantité minimale : 100 à 250 ng 50 ng/μl DO260/DO280 1,8 Qualité Réplicats biologiques Conditions d envoi Absence de signe de dégradation sur un gel d agarose ou Ratio 28S/18S 1,6 et/ou RIN 6 sur un profil du Bioanalyzer d Agilent Nombre recommandé : 5 Nombre minimal : 3 En solution dans de l eau sur de la carboglace Les tubes doivent être bien identifiés et accompagnés d une fiche descriptive avec la concentration et le volume total de chaque ARN 4. CONTROLES QUALITE Qualité des sondes synthétisées Rendement de la synthèse d ARNc Taille moyenne des ARNc Rendement de la synthèse d ADNc simple brin 20 μg à partir de ng d ARN total nt 5.5 μg à partir de 8 à 10 μg d ARNc 11/23

12 Intensités des sondes bactériennes contrôles polyadénylées ajoutées aux échantillons avant synthèse Intensités des sondes procaryotes contrôles ajoutées aux échantillons avant hybridation Qualité des hybridations Pos vs Neg auc 0.80 [all probe set rle mean]max [all probe set rle mean]min All probeset mad-residual mean 0.65 Ilys<Iphe<Ithr<Idap IBioB< IBioC<IBioD<ICre 0.3 entre des échantillons biologiques équivalents 5. LIVRAISON DES RESULTATS A la fin de son projet, le client reçoit sous forme électronique (sur DVD) : une copie de l ensemble des données brutes Affymetrix (fichiers.xml,.dat,.cel,.chp) Une copie des résultats d expression au format Excel Un document résumant l ensemble des contrôles qualités effectués lors du projet. 12/23

13 ANALYSE DES VARIATIONS DE L ADN GENOMIQUE PRESTATIONS STANDARD Notre plate-forme propose deux types de technologies distinctes pour l analyse des variations de l ADN génomique : les puces de cartographie (ou puce SNP) de la Société Affymetrix et les puces à hybridation génomique comparative (CGH) de la Société Agilent. Les puces de Cartographie Affymetrix: Leur application première est le génotypage des polymorphismes à simple nucléotide (SNP). Cependant, à haute densité, elles peuvent être simultanément mises à profit pour cartographier les gains et les pertes de régions chromosomiques. Les GeneChip Mapping 10K 2.0 et 100K Array sets ont été abondamment mis à profit pour des études de liaison et d association, néanmoins, Affymetrix recommande l utilisation du plus récent «GeneChip Mapping 500K Array Set pour ces applications. De même, si les GeneChip Mapping 100K et 500K Array sets ont été utilisés avec succès pour les analyses de variation du nombre de copies, Affymetrix préconise l utilisation de leur nouvelle puce «Genome-Wide Human SNP Array 6.0» (ci-dessous) pour cette application. Les puces CGH Agilent: Elles sont destinées à mesurer les pertes et les gains de chromosomes ou de régions sub-chromosomiques. Elles contiennent des oligonucléotides de 50- à 60-mer localisés à des positions connues du génome dans les régions codantes et non codantes. Les puces sont disponibles en 3 formats qui se distinguent respectivement, par le nombre d oligonucléotides synthétisés par array (44 000, ou ) et le nombre d arrays par lame (4, 2 ou 1). PRESTATIONS A LA CARTE En complément de ces prestations standard, nous pouvons effectuer des prestations à la carte afin de fournir les outils les mieux adaptés à vos recherches. A titre d exemple, par le passé, nous avons réalisé des analyses de variation du nombre de copie des gènes chez la levure, sur des puces d expression Affymetrix et sur des puces CGH à façon Agilent. Depuis mi-2008, Affymetrix commercialise une nouvelle puce contenant plus de 1,8 million de marqueurs dont 906,600 SNPs et 946,000 sondes non polymorphiques («Genome- Wide Human SNP Array 6.0»). le personnel de notre plate-forme a été formé par Affymetrix pour l utilisation de ces puces et peut d ores et déjà réaliser des projets de génotypage et d analyse de variation du nombre de copies sur ces microarrays. 13/23

14 GENOTYPAGE DE SNP SUR PUCE MAPPING AFFYMETRIX La préparation des sondes à hybrider sur puce de cartographie fait intervenir une réduction de la complexité du génome via une digestion de l ADN génomique par une ou plusieurs enzymes de restriction, suivie d une amplification des fragments obtenus par PCR. Chaque échantillon d ADN à analyser est ensuite hybridé sur une puce distincte après fragmentation et marquage terminal à la biotine. Notre plate-forme prend en charge l ensemble des étapes depuis la validation des ADN génomiques de départ jusqu'à l extraction des données d hybridation. 1. GENECHIP MAPPING ARRAYS Sur les puces de cartographie, chaque SNP est interrogé par un set de 12 à 20 paires d oligonucléotides de 25-mer distinctes. Une paire est constituée d un oligonucléotide «perfect match» (PM) complémentaire à la séquence d intérêt et d un oligonucléotide «mismatch» (MM) identique au PM correspondant, à l exception de la base centrale qui a été mutée. L oligonucléotide MM est utilisé pour détecter et éliminer le signal non spécifique. Les 24 ou 40 oligonucléotides sont organisés en quartets interrogeant les deux allèles possibles sur l un des deux brins d ADN ou sur les deux. Le tableau ci-dessous résume les caractéristiques générales des puces de génotypage utilisées par notre plate-forme à ce jour. Pour de plus amples informations, veuillez consulter le site web Human Mapping Arrays Nb de puces Nb de SNPs interrogés Distance intermarqueur moyenne Hétérozygosité moyenne Mapping 10K 2.0 array kb 0.38 Mapping 100K set 2 x 50K* kb 0.30 Mapping 500K set 2 x 250K* kb 0.30 *Chaque puce du set peut être utilisée individuellement 2. SERVICES PROPOSES Quantification et validation des ADN génomiques par spectrophotométrie et électrophorèse sur gel d agarose Préparation des sondes d ADN biotinylées à partir d ADN génomique Hybridation, lavage et scanning des puces Extraction des données d hybridation avec les outils Affymetrix, «GeneChip Genotyping Analysis Software» (GTYPE) pour les puces 10K et «Genotyping Console» (GTC) pour les puces 50 et 250K. 14/23

15 3. ECHANTILLONS DE DEPART Caractéristiques des ADN génomiques à fournir Sang Sources validées par Affymetrix Méthodes d extraction validées par Affymetrix Quantité Concentration Qualité Conditions d envoi Lignées cellulaires Cellules dérivées de la muqueuse buccale Digestion SDS/Protéinase K, extraction phénol/chloroforme, ultra-purification et concentration sur microcon ou centricon (Millipore) QIAamp DNA Blood Maxi kit de Qiagen Quantité optimale : 1 µg Quantité minimale : 300 ng (par puce) ng/μl DO260/DO280 1,8 Absence de signe de dégradation sur un gel d agarose Affymetrix recommande une étape de nettoyage de tout ADN suspecté de contenir des contaminants par précipitation à l éthanol En solution dans du tampon TE réduit (0.1 mm EDTA ph 8.0, 10 mm Tris-HCl ph 8.0) ou en solution dans l eau Les tubes doivent être bien identifiés et accompagnés d une fiche descriptive avec la concentration et le volume total de chaque ADN 4. CONTROLES QUALITE Qualité des sondes d ADN marquées Rendement de la PCR 20 μg pour les puces 10K et 50K Taille des amplicons 90 μg pour les puces 250K nt pour les puces 10K nt pour les puces 50K Contrôles négatifs (sans ADN) effectués lors des étapes de digestion/ligation (T DL ) et de PCR (T PCR ) nt pour les puces 250K Absence de contaminant sur gel d agarose 15/23

16 Qualité des hybridations 4 oligonucléotides contrôles Affymetrix (2.5 à 7.5 pm) ajoutés avant hybridation Pourcentage de SNP génotypés «SNP calls rate» détectés dans tous les échantillons 92 pour la puce 10K 95 pour les puces 50K 93 pour les puces 250K 5. LIVRAISON DES RESULTATS : A la fin de son projet, le client reçoit sous forme électronique (sur DVD) : Une copie des données brutes Affymetrix (fichiers.xml,.cel,.chp et.cn) Une copie des résultats de génotypage et/ou de variation du nombre de copie au format.txt (fichier.chp,.cn) Un document résumant l ensemble des contrôles qualité effectués lors du projet 16/23

17 HYBRIDATION GENOMIQUE COMPARATIVE (CGH) SUR PUCE AGILENT Cette application mesure les variations du nombre de copies d ADN entre deux échantillons en utilisant un processus d hybridation à 2 couleurs. Pour chaque couple d ADN à analyser sur une même puce, l échantillon de référence et l échantillon expérimental sont marqués avec deux fluorochromes distincts. Le choix de la polarité du marquage est à définir lors du design de l expérience. La préparation des sondes fait intervenir une digestion des ADN génomiques par deux enzymes de restriction suivie d un marquage des fragments obtenus par amorçage aléatoire (random priming). Notre plateforme se propose de prendre en charge l ensemble des étapes depuis la validation des ADN génomiques de départ jusqu à l obtention des données normalisées. Une concertation préalable avec le personnel de la plate-forme concernant le design expérimental est hautement conseillée pour chaque projet traité. 1. OLIGO acgh MICRORRAYS La Société Agilent distribue des puces CGH de densité variable pour l homme, la souris et le rat. Elles contiennent des oligonucléotides de 50- à 60-mer synthétisés in situ par la technologie Inkjet SurePrint TM. Contrairement aux puces d expression génique, les oligonucléotides pour la CGH ne sont pas confinés à la région 3 des séquences exprimées mais peuvent aussi être localisés dans les régions introniques et intergéniques. Néanmoins, la sélection des sondes a été biaisée vers les gènes. Une attention particulière a été mise sur les gènes les mieux caractérisés, les promoteurs, les mirnas et les régions télomériques. Le tableau ci-dessous résume les caractéristiques générales des puces CGH humaines Agilent. Pour une liste exhaustive des puces ou pour de plus amples informations, veuillez consulter le site web CGH Arrays Human Genome CGH 244A Human Genome CGH 105A Human Genome CGH 44K Nb d arrays par lame Nb de séquences représentées Distance inter-oligo médiane 1 x 244K kb 2 x 105K kb 4 x 44K kb Assemblage du génome Mars 2006 (UCSC Hg18 ; NCBI build 36) Mars 2006 (UCSC Hg18 ; NCBI build 36) Mars 2006 (UCSC Hg18 ; NCBI build 36) 17/23

18 2. SERVICES PROPOSES Quantification et validation des ADN génomiques par spectrophotométrie et électrophorèse sur gel d agarose Marquage fluorescent des ADN génomiques Hybridation, lavage et scanning des puces Extraction et normalisation des données avec le logiciel «Feature Extraction» d Agilent Normalisation additionnelle avec un outil développé par notre plate-forme. L analyse des variations du nombre de copies d ADN par le logiciel «CGH Analytics» d Agilent ou par un outil équivalent n est pas prise en charge dans la prestation standard. Elle peut néanmoins être réalisée sous la forme de collaboration avec des membres des plate-formes ou des équipes de recherche de l IGBMC. 3. ECHANTILLONS DE DEPART Caractéristiques des ADN génomiques à fournir Lignées cellulaires Source validées par Agilent Tissus congelés Méthodes d extraction validées par Agilent Quantité Concentration DNeasy Blood and Tissue kit de Qiagen Quantité optimale : 3 µg Quantité minimale : 1.5 µg 200 ng/μl DO260/DO280 1,8 Qualité Conditions d envoi Absence de signe de dégradation sur un gel d agarose En solution dans de l eau Les tubes doivent être bien identifiés et accompagnés d une fiche descriptive avec la concentration et le volume total de chaque ADN 18/23

19 4. CONTROLES QUALITE Qualité des sondes d ADN marquées Taille des fragments de restriction 200 à 500 pb Rendement du marquage 5 μg >25 pmol/μg pour le marquage Cy3 Activité spécifique des sondes >20 pmol/μg pour le marquage Cy5 Qualité des hybridations Valeur du «derivative of log ratio» (DLR) 0.2 spread 5. LIVRAISON DES RESULTATS A la fin de son projet, le client reçoit un expliquant la démarche à suivre pour récupérer les données, téléchargeables sur le site FTP de notre plate-forme, et contenant des informations sur l analyse effectuée. Les données disponibles comprennent : Une copie de l ensemble des données brutes et normalisées issues de «Feature Extraction» au format.txt Une copie du fichier «Grid template» au format.xml décrivant l organisation des sondes sur la puce (nécessaire pour l analyse des données sur CGH analytics) Une copie du QC report généré par «Feature Extraction» au format.pdf 19/23

20 ANALYSE DES SITES DE LIAISON DE PROTEINES REGULATRICES SUR L ADN PRESTATIONS STANDARD La technologie que nous avons mise en œuvre pour l étude des sites de liaison de protéines telles que les facteurs de transcription, les histones ou les polymérases sur un génome cible est la technologie ChIP-on-Chip d Agilent. Cette Société propose des microarrays couvrant soit les génomes dans leur ensemble, soit uniquement les régions promotrices des gènes. Elle offre également un service en ligne (e-array) pour le design de puces à façon permettant de cibler les régions d intérêt à interroger. PRESTATIONS A LA CARTE Le récent développement du séquençage haut débit offre une nouvelle alternative pour l étude des sites de liaison de protéines régulatrices sur l ADN via la technique de ChIP- Seq. La plate-forme a récemment acquis le Système Genome Analyzer II de la Société Illumina et peut prendre en charge dès à présent vos projets de séquençage sur simple demande. 20/23

21 ANALYSE DES PRODUITS D'IMMUNOPRECIPITATION CHROMATINIENNE SUR PUCE AGILENT (ChIP-on-Chip) Le principe de cette application est de comparer via un processus d hybridation à 2 couleurs un couple d échantillons constitué d ADN génomique issu de chromatine immunoprécipitée avec un anticorps dirigé contre une protéine d intérêt et d ADN génomique contrôle, par exemple issu de chromatine totale (input). Pour chaque couple d échantillon à analyser sur une même puce, l IP (chromatine immuno-précipitée avec l anticorps) est marqué à la Cyanine 5 (Cy5) tandis que le contrôle est marqué avec la Cyanine 3 (Cy3). La préparation des échantillons à hybrider comprend de multiples étapes dont plusieurs sont à la charge du porteur du projet. En effet, la plate-forme ne prend en charge les échantillons qu après immunoprécipitation et amplification des fragments d ADN. Le porteur du projet doit donc effectuer la fixation des complexes protéine-adn in vivo, la lyse des cellules et la fragmentation de l ADN, l immunoprécipitation des complexes protéine- ADN avec l anticorps de son choix et l amplification de l ADN immunoprécipité. Un protocole de référence est disponible sur le site web 1. CHIP-ON-CHIP MICROARRAYS Les puces ChIP-on-chip de la Société Agilent sont composées d oligonucléotides de 60- mer, espacés de ~ pb dans les régions d intérêt couvrant des séquences codantes et non-codantes. Les formats disponibles incluent des puces pan-génomiques ou des puces dédiées interrogeant les régions promotrices des gènes. Le tableau ci-dessous résume les caractéristiques générales des puces promoteurs humaines et murines Agilent utilisées par la plate-forme. Pour une liste exhaustive des puces ou pour de plus amples informations, veuillez consulter le site web ChIP- on-chip Arrays Nb de lames par array Nb de transcrits représentés Région interrogée autour du site d initiation de la transcription Human Promoter set 2 x 244K ~ kb à kb Mouse Promoter set 2 x 244K ~ kb à kb Assemblage du génome Mars 2006 (UCSC Hg18 ; NCBI build 36.1) Février 2006 (UCSC mm8 ; NCBI build 36) 21/23

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION 2015-09-29 SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION Centre d innovation Génome Québec et Université McGill Guide de l utilisateur: Technologies de séquençage Illumina Version 5.6 Copyright 2015 Centre

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

It was generally thought that genes were almost always present in two copies in a genome.

It was generally thought that genes were almost always present in two copies in a genome. COPY NUMBER VARIATION (CNV) It was generally thought that genes were almost always present in two copies in a genome. However, recent discoveries have revealed that large segments of DNA, ranging in size

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Introduction à la Génomique Fonctionnelle

Introduction à la Génomique Fonctionnelle Introduction à la Génomique Fonctionnelle Cours aux étudiants de BSc Biologie 3ème année Philippe Reymond, MER PLAN DU COURS - Séquençage des génomes - Fabrication de DNA microarrays - Autres méthodes

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Introduction à la génomique fonctionnelle

Introduction à la génomique fonctionnelle Introduction à la génomique fonctionnelle Cours aux étudiants de BSc Biologie 3ème année Philippe Reymond, MER PLAN DU COURS - Séquençage des génomes - DNA microarrays - Autres méthodes globales d'analyse

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Introduction à la génomique fonctionnelle

Introduction à la génomique fonctionnelle Introduction à la génomique fonctionnelle Cours aux étudiants de BSc Biologie 3ème année Philippe Reymond, MER PLAN DU COURS - Séquençage des génomes - Méthodes globales d'analyse du génome - Analyse des

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

Introduction : l ère de la génomique

Introduction : l ère de la génomique Introduction : l ère de la génomique En 1995, pour la première fois, la séquence complète du génome d une cellule vivante a été déterminée. Il s agissait d Haemophilus influenzae, une bactérie responsable

Plus en détail

Techniques et matériels pour la production des données brutes de séquençage métagénomique

Techniques et matériels pour la production des données brutes de séquençage métagénomique 1 Techniques et matériels pour la production des données brutes de séquençage métagénomique Benoît Remenant, Stéphane Chaillou Introduction Au cours des dix dernières années, la métagénomique a permis

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

BASE. Vous avez alors accès à un ensemble de fonctionnalités explicitées ci-dessous :

BASE. Vous avez alors accès à un ensemble de fonctionnalités explicitées ci-dessous : BASE BioArray Software Environment (BASE) est une base de données permettant de gérer l importante quantité de données générées par des analyses de bio-puces. BASE gère les informations biologiques, les

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique Rapport de stage de deuxième année de DUT Génie Biologique option Bioinformatique Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes

Plus en détail

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris Contexte Rôle des estrogènes dans l expression sexe-dépendante

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

D. Locker Professeur émérite Université d Orléans

D. Locker Professeur émérite Université d Orléans Le séquençage du génome Humain : Comment a-t-il été séquencé? Que nous apprend la séquence? Et après? D. Locker Professeur émérite Université d Orléans Résumé L ADN contenu dans nos 23 paires de chromosomes

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

INTRODUCTION TO NEXT GENERATION SEQUENCING

INTRODUCTION TO NEXT GENERATION SEQUENCING ECOLE DE BIOINFORMATIQUE INITIATION AU TRAITEMENT DES DONNÉES DE GÉNOMIQUE OBTENUES PAR SÉQUENÇAGE À HAUT DÉBIT 05-10 OCTOBRE 2014 - STATION BIOLOGIQUE - ROSCOFF INTRODUCTION TO NEXT GENERATION SEQUENCING

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Catalogue des prestations et services

Catalogue des prestations et services PLATEFORME GÉNOME-TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Responsables des sites : Cestas

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 Analyse de Séquences M1 BIBS 2 e partie http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 1 Les programmes Génome 2 Les programmes Génome Préhistoire Séquençage de Sanger Avant le séquençage d organismes:

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS E. Desmarais J.C. Avarre, C. Breton, K. Belkhir et B. Guinand Institut des Sciences de l Evolution - Montpellier

Plus en détail

La cytométrie de flux

La cytométrie de flux TD5 La cytométrie de flux Air sous-pression Signal de formation des gouttes Signal de charge des gouttes Cellules en suspension Liquide de Gaine Vibrateur Ultrason Dˇtecteur de Lumi re Arrt du Faisceau

Plus en détail

Statistique en grande dimension pour les données génomiques

Statistique en grande dimension pour les données génomiques Statistique en grande dimension pour les données génomiques Franck Picard UMR CNRS-5558, Laboratoire de Biométrie et Biologie Evolutive franck.picard@univ-lyon1.fr January 10, 2014 F. Picard, 1/90 Outline

Plus en détail

TEPZZ 874Z85A_T EP 2 874 085 A1 (19) (11) EP 2 874 085 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G06F 19/18 (2011.01) G06F 19/22 (2011.

TEPZZ 874Z85A_T EP 2 874 085 A1 (19) (11) EP 2 874 085 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G06F 19/18 (2011.01) G06F 19/22 (2011. (19) TEPZZ 874Z8A_T (11) EP 2 874 08 A1 (12) DEMANDE DE BREVET EUROPEEN (43) Date de publication:.0.1 Bulletin 1/21 (1) Int Cl.: G06F 19/18 (11.01) G06F 19/22 (11.01) (21) Numéro de dépôt: 14193738.3 (22)

Plus en détail

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Rapport Scientifique Seine-Aval 3

Rapport Scientifique Seine-Aval 3 Rapport Scientifique Seine-Aval 3 Séminaire Seine-Aval 2008 Fiches de synthèse des propositions SA4 THEME 3 : TABLEAU DE BORD ET INDICATEURS OPERATIONNELS PUCES A ADN CHEZ MYTILUS EDULIS - 2005 - Danger

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation PROTOCOLE AUTOMATISÉ Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation Mode d emploi des produits A1751 et A2751 Réservé

Plus en détail

Spécifique, sensible, dosable, reproductible

Spécifique, sensible, dosable, reproductible Biopathologie et Cancer: identification de marqueurs et cibles thérapeutiques moléculaires - Puces à ADN et Analyse du Transcriptome Pr François Bertucci Définitions Biopathologie = Étude des altérations

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES L OUTIL IDEAL POUR TOUTES LES DETECTIONS IMMUNOCHIMIQUES pour toutes les techniques immunodosages (EIA/ELISA) dot/ westernblot immunohistochimie immunocytochimie cytométrie en flux quel que soit le système

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar EBV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Université d Evry-Val d Essonne Ecole Doctorale des Génomes Aux Organismes. Thèse

Université d Evry-Val d Essonne Ecole Doctorale des Génomes Aux Organismes. Thèse Université d Evry-Val d Essonne Ecole Doctorale des Génomes Aux Organismes Thèse Présentée pour obtenir le grade de Docteur en sciences de l université d Evry-Val d Essonne Spécialité Bioinformatique par

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

fonction processus biologiques criblage

fonction processus biologiques criblage Transcriptome 1 Transcriptome : ensemble des ARNm ou transcrits présents dans une population de cellules dans des conditions données. Plan Introduction Acquisition des données Description des données Transformation,

Plus en détail

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine POLASZEK André juin 2012 Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine Sommaire RAPPORT DE STAGE 1 Sommaire 2 Introduction 3 Méthode 6 Migration sur gel d

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Spectrophotomètre double faisceau modèle 6800

Spectrophotomètre double faisceau modèle 6800 Spectrophotomètre double faisceau modèle 6800 Spectrophotomètre double faisceau modèle 6800 Double faisceau avec optiques parfaitement stables. Bande passante 1,5 nm. Logiciel de navigation Jenway Flight

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail