Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Dimension: px
Commencer à balayer dès la page:

Download "Plateforme. DArT (Diversity Array Technology) Pierre Mournet"

Transcription

1 Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203

2 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis pour commencer le développement. Utilisation des marqueurs DArT aussi bien sur des populations de cartographie que pour des populations de diversité. Possibilité de mener des études sur des plantes orphelines. Possibilité de developper des marqueurs de la méthylation. Capacité d analyses en parallèle de centaines ou de milliers de marqueurs. Coût réduit, quelques centimes d euros par point de données. Automatisation de la lecture des données Evaluation de la qualité des marqueurs et score individuel de confiance

3 DArT: Comment ça marche Developpement des puces (Création de Banques Dart, Design de puces) Analyses de routine Genepool Individu ADN génomique individu2 Représentation génomique Clone Hybridation DArT chip Profil Profil 2

4 DArT: Diversity Array Technology. Marqueurs dominants révélant un polymorphisme de restriction par hybridation sur microarray. Principe:. Création d une banque de clones représentant la diversité de l espèce, digestion par une enzyme de restriction à coupure «rare» (5-6 pb) et une enzyme à coupure «fréquente» (4 pb) et amplification par réaction PCR: Méthode de Réduction de la complexité du génome. Site PstI CTGCAG GACGTC Site PstI CTGCAG GACGTC Site BstnI TCGA AGCT Site PstI CTGCAG GACGTC ADN génomique Double restriction PstI/BstnI Amorces PstI Site PstI ATGCA G T ACGTC Site PstI C TGCAG T G ACGTC A Amorces PstI Amplification PCR avec des amorces PstI + Ligation d adaptateur PstI Site BstnI CGA T ATGCA G T ACGTC Site PstI C TGCAG T G ACGTC A T AGC Aucune amplification PCR ATGCA G T ACGTC ATGCA G T ACGTC ATGCA G T ACGTC C TGCAG T G ACGTC A C TGCAG T G ACGTC A C TGCAG T G ACGTC A Réduction de la complexité du génome X

5 DArT: Diversity Array Technology. Marqueurs dominants révélant un polymorphisme de restriction par hybridation sur microarray. Principe: 2. Préparation des puces: Dépôts des clones (produits PCR) sur lames de verre (environ 6000 clones par lames) 3. Génotypages de 96 individus : - Traitement des ADNs par le même système de réduction de la complexité que pour la banque (Restriction/Ligation/PCR ). - Hybridations de 96 lames / Lavages des lames/ Scan des lames. ADN génomique Etape : Préparation de le représentation génomique Morceau de vecteur marqué avec un fluororchrome FAM (signal de référence pour la normalisation) Etape 2: Marquage des cibles avec un fluorochrome Cy3/Cy5 Etape 3: hybridation des génotypes sur puce (puce=génotype) Etape 4: Lavage et scan des puces Analyse des hybridations: ratio bleu/vert pour chaque spots

6 DArT: Diversity Array Technology. Marqueurs dominants révélant un polymorphisme de restriction par hybridation sur microarray. Principe: 4. Analyse des images, détection automatique des spots hybridés, lecture présence/absence. Trie des marqueurs sur des seuils de qualité P et Q. (en moyenne 7 à 0% de marqueurs polymorphes) Analyse des images et Positionnement des grilles de lecture

7 DArT: Diversity Array Technology. Marqueurs dominants révélant un polymorphisme de restriction par hybridation sur microarray. Détection du polymorphisme Individu Individu n seuils de qualité P et Q 2 P= 8.2 Q= P= Q=

8 Etude de la contribution de la voie asexuée dans la création de variabilité au sein des systèmes de cultures du Vanouatou Sélection clonale importante au sein de la grande igname Dioscorea alata!!!! Figure. NJTree de la structure de la diversité de la grande igname D.alata calculé à l aide de l indice de dissimilarité de Dice à partir de 38 marqueurs DArT. Les valeurs de bootstrap (00 répétitions) sont représentées à partir de 50 %. Doctorant: Henri Vandenbroucke

9 Ressources sur le plateau Espèces Projets Banques Utilisation Bananier Musa L. GCP 6 plaques PstI/BstnI Diversité Bananier Musa L. GCP 6 plaques PstI/TaqI Diversité Sorgho Sorghum bicolor GCP 6 plaques PstI/BanII Diversité Sorgho Sorghum bicolor GCP 6 plaques PstI/taqI Diversité Citrus genre Citrus GEPETOS 6 plaques PstI/HpaII méthylation et diversité Citrus genre Citrus GEPETOS 6 plaques BstY/HpaII méthylation et diversité Sorgho Sorghum bicolor GEPETOS 6 plaques PstI/BanII Diversité Blé Triticum aestivum L. AIP INRA/Cirad 40 plaques PstI/TaqI carto génétique/ diversité Palmier à huile Elais oleifera SAMPC Palmelit/Cirad 6 plaques PstI/BstnI diversité Palmier à huile Eleais guinensis /Elais oleifera SAMPC Palmelit/Cirad 6 plaques PstI/BstnI Carto Cacaoyer Theobroma cacao Cirad séquençage Cacaoyer 6 plaques HindIII/TaqI Carto Riz Oryza sativa Projet européen Eurigen/ GCP 6 plaques PstI/TaqI Diversité Arachide Arachis duranensis GCP 6 plaques PstI/TaqI carto Arachide Arachis ipaensis GCP 6 plaques PstI/BanII carto Igname Dioscorea alata/esculenta ANR végéculture 6 plaques Diversité Taro Colaucasia esculenta ANR végéculture/fstp taro 6 plaques Diversité/Carto Kava Piper methysticum G.Forst ANR végéculture 6 plaques Diversité Dactyle Dactylis glomerata glomerata L. AIP INRA/Cirad 40 plaques PstI/TaqI Diversité Luzerne Medicago sativa L AIP INRA/Cirad 40 plaques PstI/TaqI Diversité Fétuque Genre Festuca AIP INRA/Cirad 40 plaques PstI/TaqI Diversité Ray-grass d'italie Lolium multiflorum Lam Privé /JD 20 plaques PstI/TaqI Diversité Ray-grass anglais Lolium perenne L. AIP INRA/Cirad 40 plaques PstI/TaqI Diversité Hévéa Hevea brasiliensis Cirad 20 plaques PstI/TaqI Diversité/carto

10 Merci

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Yves Clément, Jacques David & Sylvain Glémin Journées ARCAD 28/10/2014 Outline Sélection sur l usage

Plus en détail

Domaine de Melgueil, 34130 Mauguio, France (3)

Domaine de Melgueil, 34130 Mauguio, France (3) Les Actes du BRG, 6 (2006) 57-74 BRG, 2006 Article original Analyse et prédiction des patrons de déséquilibre de liaison dans les collections de ressources génétiques de plantes pérennes ou annuelles,

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

BASE. Vous avez alors accès à un ensemble de fonctionnalités explicitées ci-dessous :

BASE. Vous avez alors accès à un ensemble de fonctionnalités explicitées ci-dessous : BASE BioArray Software Environment (BASE) est une base de données permettant de gérer l importante quantité de données générées par des analyses de bio-puces. BASE gère les informations biologiques, les

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

It was generally thought that genes were almost always present in two copies in a genome.

It was generally thought that genes were almost always present in two copies in a genome. COPY NUMBER VARIATION (CNV) It was generally thought that genes were almost always present in two copies in a genome. However, recent discoveries have revealed that large segments of DNA, ranging in size

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

Par Akoété Ega AGBODJI FASEG/Université de Lomé

Par Akoété Ega AGBODJI FASEG/Université de Lomé CSI- Afrique Renforcement des interventions dans le domaine de la politique économique et sociale Atelier de développement des compétences des chercheurs des syndicaux Session 6 Les méthodes et procédures

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Séquençage de RAD tags : mise en oeuvre et applications

Séquençage de RAD tags : mise en oeuvre et applications Séquençage de RAD tags : mise en oeuvre et applications Eric Pante laboratoire LIENSs UMR 7266 CNRS-Université de La Rochelle http://epante.wordpress.com/ Plan concept applications en biologie évolutive

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Réunion du réseau de génétique du Département EFPA

Réunion du réseau de génétique du Département EFPA 17 19 novembre 2014 Centre INRA de Nancy Lorraine Programme Lundi 17 novembre Salle Tilleul 13:00 Bus pour l'inra depuis la gare de Nancy 14:00 14:30 Introduction de la réunion tour de table 14:30 14:45

Plus en détail

Quelles perspectives pour l innovation variétale à l INRA? 1

Quelles perspectives pour l innovation variétale à l INRA? 1 Dossier de l environnement de l INRA n 30 57 Quelles perspectives pour l innovation variétale à l INRA? 1 Marianne Lefort 1 et Guy Riba 2 1 INRA Département GAP, route de St-Cyr, 78026 Versailles cedex

Plus en détail

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France)

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France) L utilisation de la SPIR au service de l entretien l des parcours de golf : intérêts et limites L. Thuriès,, D. Bastianelli CIRAD, Montpellier (France) SPIR gazon : pour quoi faire? Suivi des sols : Teneur

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol Lionel RANJARD, Samuel Dequiedt, Pierre-Alain Maron, Anne-Laure Blieux. UMR Agroécologie-plateforme

Plus en détail

Manuel Qualité du plateau de génotypage

Manuel Qualité du plateau de génotypage Manuel Qualité du plateau de génotypage Selon la Norme ISO 9001 : Version 2008 Référence : Manuel Qualité Gestionnaire : Responsable qualité Version Date de version Historique des modifications Version

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Lettre d information N 3 Juin 2015

Lettre d information N 3 Juin 2015 Lettre d information N 3 Juin 2015 Au sommaire Tour d horizon d AMAIZING en 2014 p. 2 Zoom sur quelques résultats et faits marquants : Effet de la sélection moderne sur la diversité génétique chez le maïs

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Dr Donatien MOUKASSA

Dr Donatien MOUKASSA LES TECHNIQUES DE BIOLOGIE MOLECULAIRE APPLIQUEES EN CANCEROLOGIE HUMAINE Dr Donatien MOUKASSA Département d histo-embryologie et d anatomie pathologique, FSS, UMNG EPU, Fondation Congolaise en Recherche

Plus en détail

Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées.

Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées. Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées. David GRAND Ingénieur Laboratoire d'anatomo-cytopathologie Institut Universitaire

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Facile. Efficace. Fiable. Système entièrement automatisé, le kit Leica HER2 FISH System pour BOND TM

Facile. Efficace. Fiable. Système entièrement automatisé, le kit Leica HER2 FISH System pour BOND TM Facile. Efficace. Fiable. Système entièrement automatisé, le kit Leica HER2 FISH System pour BOND TM Contient les sondes PathVysion * FISH fournies par Abbott Molecular Inc. Facile Éliminez la complexité

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Introduction à la Génomique Fonctionnelle

Introduction à la Génomique Fonctionnelle Introduction à la Génomique Fonctionnelle Cours aux étudiants de BSc Biologie 3ème année Philippe Reymond, MER PLAN DU COURS - Séquençage des génomes - Fabrication de DNA microarrays - Autres méthodes

Plus en détail

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Rapport final Marc OREMUS, Claire GARRIGUE & Christophe CLEGUER Opération Cétacés B.P. 12 827, 98802 Nouméa, Nouvelle-Calédonie Tél. /

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

UNITE ET DIVERSITE DES ËTRES HUMAINS

UNITE ET DIVERSITE DES ËTRES HUMAINS UNITE ET DIVERSITE DES ËTRES HUMAINS Rappels : - organisation du corps humain - La fécondation L HEREDITE ET SON SUPPORT Chaque individu possède des ressemblances et des différences même au sein d une

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE MARCH 16, 2014 SERVICES DE SEQUENÇAGE Centre d innovation Génome Québec et Université McGill Services de Validation et détection de SNP Technologie de Séquençage de Nouvelle Génération Guide de l utilisateur

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht Actualités sur la sélection des pondeuses Prospections futures Dr. Matthias Schmutz, Lohmann Tierzucht Alimentation et démographie mondiale Augmentation annuelle de 80 millions Croissance surtout dans

Plus en détail

Techniques émergentes en microbiologie clinique: conséquences sur l organisation des laboratoires

Techniques émergentes en microbiologie clinique: conséquences sur l organisation des laboratoires Techniques émergentes en microbiologie clinique: conséquences sur l organisation des laboratoires Alain Bonnin, Frédéric Dalle, Coralie L Ollivier - Laboratoire de Parasitologie-Mycologie, CHU de Dijon

Plus en détail

REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES :

REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES : REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES : «Processus de maîtrise des risques d'émission des poussières issues de semences traitées avec des produits phytopharmaceutiques : Opérations industrielles»

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Introduction : l ère de la génomique

Introduction : l ère de la génomique Introduction : l ère de la génomique En 1995, pour la première fois, la séquence complète du génome d une cellule vivante a été déterminée. Il s agissait d Haemophilus influenzae, une bactérie responsable

Plus en détail

FISH Fluorescence In Situ Hybridization

FISH Fluorescence In Situ Hybridization FISH Fluorescence In Situ Hybridization Dossier technique année 2010/2011. FISCHER Maude PETIT Marie-Eléonore SCHLAEFLIN Delphine Introduction FISH : Méthode d hybridation «in situ» entre de l ADN et une

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

AGROPOLIS. La plate-forme de recherches avancées Agropolis

AGROPOLIS. La plate-forme de recherches avancées Agropolis les dossiers d INTERNATIONAL AGROPOLIS Compétences de la communauté scientifique La plate-forme de recherches avancées Agropolis Génomique & biotechnologie Numéro 5 AGROPOLIS INTERNATIONAL agriculture

Plus en détail

FLUX DES ELEMENTS NPK DANS DES SYSTEMES PLURISPECIFIQUES A BASE DE CULTURES PERENNES DANS LES FORETS HUMIDES DU SUD OUEST CAMEROUN

FLUX DES ELEMENTS NPK DANS DES SYSTEMES PLURISPECIFIQUES A BASE DE CULTURES PERENNES DANS LES FORETS HUMIDES DU SUD OUEST CAMEROUN FLUX DES ELEMENTS NPK DANS DES SYSTEMES PLURISPECIFIQUES A BASE DE CULTURES PERENNES DANS LES FORETS HUMIDES DU SUD OUEST CAMEROUN 1 E. E. EHABE 1, P. SAMALANG 1, A. BIKOI 1, I. de BARROS 2, F. ENJALRIC

Plus en détail

Fiches de synthèse AGRICULTURE. Cas de : 1. Sénégal 2. Cote d Ivoire 3. Gabon 4. Mali

Fiches de synthèse AGRICULTURE. Cas de : 1. Sénégal 2. Cote d Ivoire 3. Gabon 4. Mali CERCAM Fiches de synthèse AGRICULTURE Cas de : 1. Sénégal 2. Cote d Ivoire 3. Gabon 4. Mali Mars 2014 3- Secteur agricole Présentation générale Le couvert forestier du Gabon couvre 22 millions de ha (FAO

Plus en détail

fonction processus biologiques criblage

fonction processus biologiques criblage Transcriptome 1 Transcriptome : ensemble des ARNm ou transcrits présents dans une population de cellules dans des conditions données. Plan Introduction Acquisition des données Description des données Transformation,

Plus en détail

Introduction à la génomique fonctionnelle

Introduction à la génomique fonctionnelle Introduction à la génomique fonctionnelle Cours aux étudiants de BSc Biologie 3ème année Philippe Reymond, MER PLAN DU COURS - Séquençage des génomes - Méthodes globales d'analyse du génome - Analyse des

Plus en détail

leucémie lymphoïde chronique

leucémie lymphoïde chronique la leucémie lymphoïde chronique S.Taoussi, M.T. Abad Service hématologie, EHS ELCC Blida Ce travail a été réalisé au laboratoire hématologie du CAC Blida avec le soutien du CMNG et du laboratoire de recherche

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

I/ L information génétique se trouve dans les chromosomes du noyau.

I/ L information génétique se trouve dans les chromosomes du noyau. Chapitre 2 : localisation et organisation de l information génétique Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/

Introduction, présentation de la plateforme South Green. hp://southgreen.cirad.fr/ Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/ SupAgro, Montpellier, 10 février 2014 Le déluge de données NGS Next-generation sequencing Rappel: synthèse de l ADN 5

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 ETABLISSEMENT : UM2 COMPOSANTE : Faculté des Sciences SITE : Campus Triolet IDENTIFICATION DU POSTE : N : Corps : Section CNU : 67 Nature demandée : Maître de Conférence

Plus en détail

La cytométrie de flux

La cytométrie de flux TD5 La cytométrie de flux Air sous-pression Signal de formation des gouttes Signal de charge des gouttes Cellules en suspension Liquide de Gaine Vibrateur Ultrason Dˇtecteur de Lumi re Arrt du Faisceau

Plus en détail

D. Locker Professeur émérite Université d Orléans

D. Locker Professeur émérite Université d Orléans Le séquençage du génome Humain : Comment a-t-il été séquencé? Que nous apprend la séquence? Et après? D. Locker Professeur émérite Université d Orléans Résumé L ADN contenu dans nos 23 paires de chromosomes

Plus en détail

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 JM Costa 5èmes Journées de Biologie Praticienne Mazagan, 4-5 Avril 2014 LABORATOIRE CERBA, Laboratoire du réseau DIAGNOSTIC PRÉNATAL

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail