Rapport Scientifique Seine-Aval 3

Dimension: px
Commencer à balayer dès la page:

Download "Rapport Scientifique Seine-Aval 3"

Transcription

1 Rapport Scientifique Seine-Aval 3 Séminaire Seine-Aval 2008 Fiches de synthèse des propositions SA4 THEME 3 : TABLEAU DE BORD ET INDICATEURS OPERATIONNELS PUCES A ADN CHEZ MYTILUS EDULIS Danger J-M. C. Lévêque C. Dégremont GIP Seine-Aval 12 Avenue Aristide Briand Rouen tel : fax :

2 1 Résumé L objectif de la proposition de recherche était d isoler des produits de gènes différentiellement régulés par un mélange de xénobiotiques regroupant 4 classes principales de contaminants. Cette partie du projet constitue une des étapes nécessaire à la construction de puces à ADN les plus exhaustives possibles permettant un suivi environnemental des populations de moules bleues qui sont largement utilisées comme espèce sentinelle dans les programmes de biosurveillance. Ces clones complètent le panel de gènes qui avait précédemment été isolé et «imprimé» sur des puces à ADN après exposition à l atrazine. Les banques construites au cours de cette phase 2004 du programme Seine-Aval sont au nombre de 8. Elles visent à dégager des gènes régulés positivement ou négativement par les xénobiotiques tout en prenant en compte les paramètres de tidalité. En effet, les moules sont soumises à une alternance d immersion/émersion qui constitue un stress supplémentaire à celui engendré par la contamination anthropique. Les banques comprennent près de 1300 gènes qui vont enrichir les 1175 clones qui avaient été déjà obtenus chez la moule bleue (voir rapports antérieurs). L ensemble de ces clones peut donc être déposé sur des puces à ADN. L utilisation des puces à ADN qui est fondée sur la comparaison deux à deux de signaux d hybridation d acides nucléiques marqués, requiert une normalisation stricte de ces signaux. Cette normalisation est généralement calculée à partir de gènes qui ne présentent pas de régulation différentielle. Des banques non soustraites sont également construites afin de répondre à cet aspect technique de normalisation. Un total de 800 clones aléatoirement sélectionnés est suffisant pour permettre une normalisation statistiquement satisfaisante. L étape de test des puces à ADN et d établissement d empreintes spécifiques de classes de contaminants fait l objet de la suite de ce travail proposé et accepté pour l année par le programme Seine-Aval. 2 Rappel des objectifs Le travail proposé visait à mettre en œuvre la méthodologie de comparaison des transcriptomes par construction de banques soustractives afin d isoler et d identifier chez la moule bleue des acteurs moléculaires impliqués dans les processus de détoxication et de lutte contre le stress spécifique à l exposition aux contaminants chimiques. L établissement d une collection de clones constitue l étape préalable à la fabrication de puces à ADN dédiées au diagnostic environnemental présentant un nombre suffisant de gènes analysés. 3 Résultats 3.1 Animaux Les moules, Mytilus edulis, sont prélevées à Yport. Leur taille est d environ 4 cm. Les animaux sont ensuite transférés dans des bacs pour une période de dépuration d une semaine. L eau de mer, fournie en flux continu, est prélevée au niveau de la côte près de Saint-Adrien au nord du Havre. Elle est filtrée à 50 µm et épurée sur des filtres à charbon actif. La température de l eau de mer est de 10 C en moyenne. Pendant cette période et lors de l exposition au mélange de contaminants, les animaux sont nourris par un flux continu pendant 2 heures par jour d algues mises en culture (grâce à l aimable collaboration de l association Aquacaux). Deux grandes classes d animaux sont soumises ou non à un régime de marées (6 heures basse mer, 6 heures haute mer). Chaque classe comprend 3 groupes de moules ; les individus témoins, les moules exposées à un mélange de contaminants et les individus exposés à du DMSO (qui est utilisé comme diluant des contaminants). Le mélange

3 de contaminant est composé de benzo-[a]-pyrène (0,5 µg.ml -1 ), phénanthrène (5 µg.ml -1 ), PCB-153 (0,5 µg.ml -1 ), nonylphénol (5 µg.ml -1 ) et carbamazépine (30 µg.ml -1 ) dilués dans du DMSO. Il est distribué dans les différents bacs par l intermédiaire d une pompe péristaltique afin d obtenir les concentrations finales précisées. Chaque groupe d animaux (témoin, témoin DMSO, exposés) comporte cent individus. Les mesures chimiques précises des concentrations en contaminants et en DMSO seront effectuées ultérieurement par le LPTC de l Université de Bordeaux. La période d exposition est de 14 jours, à l issue de laquelle les animaux sont rapidement disséqués (branchies et manteaux). Les tissus, pris individuellement pour chaque animal, sont aussitôt congelés dans de l azote liquide. Une coquille des bivalves est systématiquement conservée afin de déterminer la taille moyenne des individus qui est de 3,9 ± 0,3 cm, ce qui correspond à des animaux de 4 ans environ). La mortalité durant le maintien des animaux en conditions de laboratoire s est élevée au total de 6 individus répartis de façon aléatoire dans l ensemble des groupes. 3.2 Détermination du sexe Le mélange de contaminant contenant des composés susceptibles d avoir un effet perturbateur endocrinien et/ou oestrogéno-mimétique, les sexes des individus doivent être déterminés. Pour cela, il est fait appel à une stratégie par PCR fondée sur l analyse du polymorphisme lié au sexe du gène mitochondrial codant pour la sous-unité 3 de la cytochrome c oxydase. En effet, chez Mytilus edulis, les individus mâles possèdent dans leurs gonades des mitochondries d origine paternelle tandis que chez les femelles, ces organites ont une origine exclusivement maternelle. Les ARN totaux sont extraits du manteau à l aide de TRI Reagent (Sigma). Ces ARN comprennent les ARN ribosomaux, messagers ainsi que les ARN de transfert et l ensemble des ARN mitochondriaux. Ces derniers sont sélectivement rétrotranscrits à l aide du KIT RobusT-II (Finnzyme) à partir du mélange des 4 amorces de PCR dont les séquences sont données ci-après. La PCR est conduite dans le même tube. Deux couples d amorces sont utilisés pour amplifier des fragments de gènes «mâles» (MmtDNAfor : TGGAGTCGCTTTATTTATTTTATCTGA, MmtDNArev: ATACTACA- AACCACAGCCTCACTCATA) et «femelles» (FmtDNAfor : TATGTACCAG- GTCCAAGTCCGTG, FmtDNArev : CACATACACTAAGCACCACAATG). Cette réaction PCR permet de générer des fragments d amplification de 530 et de 753 pb respectivement pour les individus mâles et femelles. Les amplifications PCR sont effectuées dans des plaques 96 puits à l aide de thermocycleurs Biorad et/ou Hybaid. Aucune anomalie des rapports de sexe n est notée dans les différentes échantillons de moules. 3.3 Construction de banques soustractives Extraction et purification des ARNm Les tissus branchiaux provenant de 50 individus mâles sont rassemblés. Les ARN totaux sont extraits à l aide de TRI Reagent (Sigma) suivant le protocole décrit par le fabricant du réactif. Les ARN totaux sont contrôlés par électrophorèse sur gel d agarose à 1,5% dans du tampon TAE en présence de SDS à 0,1%. La quantité d ARN totaux et le spectre UV sont déterminés à l aide d un spectrophotomètre à barrettes (Nanodrop) sur un aliquot de 1 µl. Les rapports de DO260nm/280nm obtenus sont supérieurs à 1,9. Les ARN messagers sont ensuite purifiés sur des particules paramagnétiques à l aide du Kit PolyATtract mrna Isolation Systems Promega. Brièvement, les ARN sont mis en présence d oligod(t) biotinylés dans un tampon d hybridation composé de 5 x SCC. Seuls les ARNm s hybrident et sont piégés à l aide de particules paramagnétiques liées à l avidine. La qualité des messagers et leur pureté est

4 estimée par spectrophotométrie UV (Nanodrop) avant de procéder à la construction de banques soustractives Rétranscription Les ARNm (2,0 µg au total) sont soumis à une digestion à la DNase I afin d éliminer toute contamination d ADN génomique. Ils sont ensuite de nouveau purifiés par extraction au phénol-chloroforme-alcool isoamylique avant d être rétrotranscrits. La rétrotranscription est réalisée à l aide de la SuperscriptIII (Life Sciences Technologies) en utilisant une amorce dégénérée de séquence TTTTGTACAAGCTT 30 N 1 N. La réaction est conduite pendant 1h30 à 42 C Synthèse du second brin d ADN La synthèse du second brin d ADNc est assurée par un cocktail enzymatique composé ADN polymérase I (fragment de Klenow), RNase H d ADN ligase d E. coli. La réaction est ensuite complétée par l ajout d ADN polymérase de T4. La réaction est ensuite arrêtée et une extraction au phénol chloroforme est effectuée Digestion par RsaI Les ADNc sont soumis à une digestion complète par RsaI. Cette digestion est contrôlée par électrophorèse sur gel d agarose. Cette digestion constitue l étape finale pour la fabrication des échantillons qualifiés de «driver» qui seront ensuite utilisés comme soustracteurs lors des hybridations Ligation des adaptateurs Les fragments de digestion RsaI subissent parallèlement deux ligations avec deux adaptateurs différents partiellement bicaténaires (adaptateurs 1 et 2R) en présence de T4 ADN ligase. Les ADNc munis d adaptateurs constituent les «testers» c'est-à-dire les espèces nucléiques qui subissent la soustraction Hybridations Une première série d hybridations est réalisée entre, d une part, les «testers» munis d adaptateurs 1 et les «drivers» et, d autre part, les «testers» munis d adaptateurs 2R et les «drivers». Ces hybridations sont effectuées pendant 8 heures à 68 C. Une seconde hybridation est ensuite réalisée en mélangeant les deux échantillons avec un excès de «driver». Les espèces différentiellement exprimées issues de la soustraction «tester» «driver» sont ensuite amplifiées par PCR suppressive PCR suppressive Les ADNc munis d adaptateurs subissent ensuite un «fill in» afin de remplir les extrémités dépassantes. Une première PCR de 27 cycles est effectuée à l aide d une amorce unique (CTAATACGACTCACTATAGGGC) complémentaire d une portion des adaptateurs 1 et 2R. Ensuite une seconde amplification de 12 cycles est ensuite conduite en utilisant comme matrice une dilution au 1/10 de la première PCR et comme amorces les oligonucléotides (TCGAGCGGCCGCCCG-GGCAGGT et AGCGTGGTCGCGGCCGAGGT). Les produits de chaque PCR sont déposés sur gel d agarose à 2% pour analyse par électrophorèse.

5 3.3.8 Ligation dans le vecteur pgem-t Les produits issus de la seconde PCR sont introduits par TA-cloning dans le vecteur pgem-t à l aide de T4 DNA ligase Transformation dans les bactéries de la souche Xl1-Blue Les cellules XL1-Blue électro-compétentes sont préparées selon la méthode usuelle. La transformation bactérienne des produits de ligation est effectuée par électroporation (GenePulser, Biorad). Les clones bactériens sont cultivés sur Petri LB additionnés d ampicilline, d Xgal et d IPTG Mise en culture des clones bactériens Chaque colonie est prélevée et cultivée individuellement dans LB ampicilline. Des stocks glycérol des clones bactériens sont systématiquement réalisés Amplification par PCR des inserts Pour chaque clone, une amplification par PCR de l insert est effectuée à l aide des amorces T7 et Sp6 qui s hybrident de part et d autre du «polylinker» de pgem-t. La taille moyenne des inserts obtenus est de 550 bp. 3.4 Analyse des banques Un total de 8 banques soustractives a été construit suivant le schéma suivant : Ces banques comprennent un nombre total de 1293 clones qui doivent maintenant être analysés sur des puces à ADN. La suite du projet est prévue dans le cadre du programme Seine-Aval III pour l année

6 3.5 Construction de banques d ADN Afin de disposer d un panel de clones dits contrôles sur les puces à ADN (projet , Seine-Aval III), des banques d ADNc non soustraites sont construites Extraction et purification des ARNm Les ARN totaux sont extraits à partir de 3 moules non exposées provenant d Yport suivant le protocole décrit plus haut. La méthode utilisée permet de sélectionner des messagers complets notamment à leur extrémité Traitement à la phosphotase alcaline Les ARN isolés sont soumis à une déphosphorylation par la phosphatase alcaline qui laisse les seuls ARN non munis d une coiffe (7MeGppp) avec des extrémités 5 non-phosphorylées. Les messagers complets étant protégés par cette coiffe de l action de la CIP Traitement à la pyrophosphatase Les ARN sont ensuite soumis à l action de la pyrophosphatase acide de tabac qui attaque les messagers munis d une coiffe et génère au niveau ceux-ci une extrémité 5 -phosphate Ligation d un oligo-ribonucléotide Un ARN oligonucléotide de séquence (CGACUGGAGCACGAGGACACUGACAUGGAC- UGAAGGAGUAGAAA) est ligasé aux extrémités 5 phosphate des ARN qui en sont encore pourvus (les ARNm complets) Transcription inverse La transcription inverse est conduite avec de la Superscript III en utilisant comme amorce l oligonucléotide de séquence GCTGTCAACGATACGCTACGTAACGGCATGACA- GTGT Amplification par PCR Les ADNc monocaténaires construits sont ensuite amplifiés par PCR en utilisant comme amorces des oligonucléotides complémentaires de l oligorna (CGACTGGAGCACGA) et l amorce de rétro-transcription (GCTGTCAACGATA). Les produits PCR sont contrôlés par électrophorèse sur gel d agarose Digestion par RsaI Une partie des produits PCR est digérée à l aide de l enzyme RsaI afin de générer des fragments de tailles comparables à celles des inserts obtenus lors de la construction de banques soustractives.

7 3.5.8 Ligation d adaptateurs L adaptateur 1 utilisé lors de la construction de banques soustractive est ligasé à l aide de la T4 DNA ligase sur les fragments RsaI PCR et clonage dans pgem-t Les produits de ligation obtenus à l étape précédente sont amplifiés par PCR à l aide de l amorce utilisée lors de la PCR suppressive. Les produits sont ensuite clonés dans le vecteur plasmidique pgem-t, puis la transformation est effectuée dans des bactéries Xl1-Blue électrocompétentes. L utilisation de cette procédure permet de générer une banque comprenant près de 800 clones qui sont prélèvés de façon aléatoire. Cela doit permettre de construire un segment «contrôle» sur les puces à ADN qui seront construite afin d aider à la normalisation des puces. 4 Conclusion Les banques soustractives construites doivent permettre de faire la distinction entre les effets des contaminants dans le contexte d une alternance des marées. Par ailleurs, les banques nonsoustraites fournissent un ensemble de clones contrôles nécessaires à la normalisation des puces à ADN. Il est désormais possible de passer à la seconde étape de la construction des puces à ADN qui est décrite dans le projet déposé et accepté pour l année du programme Seine-Aval. De façon parallèle et hors programme Seine-Aval, une démarche similaire est développée chez la moule zébrée Dreissena polymorpha. Les résultats obtenus chez les deux espèces de bivalves l une marine, l autre dulcicole, sont confrontés. 5 Publications sur le thème en Article : Masson R., Loup B., Bultelle F., Siah A., Leboulenger F et Danger J.M.. Identification of gene encoding DnaK-type molecular chaperone as potentially down regulated in blue mussels (Mytilus edulis) exposed to acute exposure to atrazine. Hydrobiologia. (Soumis). 5.2 Communications orales ou affichées Masson R., Bultelle F., Siah A., Loup B., Panchout M., Leboulenger F. et Danger J.M. Analyse différentielle des transcriptomes de bivalves bioindicateurs exposés à des contaminants organiques. 18ème Congrès de l ACFAS. Montréal, Canada, Mai Loup B., Marin M., Masson R., Manduzio H., Maillet G., Poret A., Siah A., Bultelle F., Le Foll F., Rocher B. et Danger J.M. Ecotoxicologie moléculaire chez les bivalves : transcriptomique, protéomique et signalisation ionique. 12 Journée de l IFRMP. Dieppe, France. Juin 2004.

8 Masson R., Bultelle F., Loup B., Panchout M., Siah A. and Danger J.M. (2004). Transcriptome analysis in bivalve species (Mytilus edulis and Dreissena polymorpha) as a tool to identify new biomarkers of exposure to xenobiotics. 38 ème Symposium de l Estuarine and Coastal Sciences Association (ECSA). Rouen, Septembre Danger J.M. Development of a genetically modified yeast and of DNA arrays as tools for environmental risk assessment. Symposium on Biotechnologies. Incheon, Corée. Décembre 2004.

9 Crédits photos : C. Dégremont, R. Hocdé, C. Lévêque, S. Moussard Pour tout renseignement, veuillez contacter la coordination scientifique : Le GIP Seine-Aval ne saurait être tenu responsable d'évènements pouvant résulter de l'utilisation et de l'interprétation des informations mises à disposition. Travaux co-financés par :

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine POLASZEK André juin 2012 Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine Sommaire RAPPORT DE STAGE 1 Sommaire 2 Introduction 3 Méthode 6 Migration sur gel d

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY)

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) Lise Vézina, technicienne de laboratoire Michel Lacroix, agronome-phytopathologiste Direction de l innovation scientifique et technologique Au Laboratoire

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE MARCH 16, 2014 SERVICES DE SEQUENÇAGE Centre d innovation Génome Québec et Université McGill Services de Validation et détection de SNP Technologie de Séquençage de Nouvelle Génération Guide de l utilisateur

Plus en détail

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation PROTOCOLE AUTOMATISÉ Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation Mode d emploi des produits A1751 et A2751 Réservé

Plus en détail

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION 2015-09-29 SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION Centre d innovation Génome Québec et Université McGill Guide de l utilisateur: Technologies de séquençage Illumina Version 5.6 Copyright 2015 Centre

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

Génie Génétique. Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris L3 IMS ISSBA

Génie Génétique. Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris L3 IMS ISSBA L3 IMS ISSBA Génie Génétique Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris COLONIER Thomas, DOMEN Robin, GUERIN Nathan Filière Biotechnologie L3 IMS ISSBA La

Plus en détail

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen)

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) Introduction Le vecteur d'expression procaryote pqe31-dsred3

Plus en détail

Catalogue des prestations et services

Catalogue des prestations et services PLATEFORME GÉNOME-TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Responsables des sites : Cestas

Plus en détail

Techniques et matériels pour la production des données brutes de séquençage métagénomique

Techniques et matériels pour la production des données brutes de séquençage métagénomique 1 Techniques et matériels pour la production des données brutes de séquençage métagénomique Benoît Remenant, Stéphane Chaillou Introduction Au cours des dix dernières années, la métagénomique a permis

Plus en détail

Les outils de génétique moléculaire Les techniques liées aux acides nucléiques

Les outils de génétique moléculaire Les techniques liées aux acides nucléiques Les outils de génétique moléculaire Les techniques liées aux acides nucléiques Sommaire Preparation des acides nucléiques Extraction / purification Les enzymes agissant sur les acides nucléiques Les enzymes

Plus en détail

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Manuel Technique Maxwell 16 Blood DNA Purification System Attention, cartouches à manipuler avec précaution, les bords scellés peuvent être tranchants. 2800 Woods Hollow Rd. Madison, WI USA Dispositif

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

génomique - protéomique acides nucléiques protéines microbiologie instrumentation

génomique - protéomique acides nucléiques protéines microbiologie instrumentation génomique - protéomique acides nucléiques protéines microbiologie instrumentation Génomique, protéomique - Acides nucléiques Extraction d acides nucléiques ADN... Kit de filtration par colonnes... ADN

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Bachelier - Technologue de laboratoire médical Option chimie clinique

Bachelier - Technologue de laboratoire médical Option chimie clinique Haute École Louvain en Hainaut www.helha.be Année académique 2015-2016 Catégorie Paramédicale Bachelier - Technologue de laboratoire médical Option chimie clinique HELHa Fleurus Rue de Bruxelles 101 6220

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Outils de gestion des ressources biologiques

Outils de gestion des ressources biologiques Le Cahier des Techniques de l INRA 2015 (84) N 1 Outils de gestion des ressources biologiques Frédéric Sanchez 1 *, Tou Cheu Xiong 1 Résumé. Les recherches en biologie génèrent un grand nombre d échantillons

Plus en détail

Étude de l expression de gènes chez le blé (Triticum aestivum) en réponse à la maladie du piétin échaudage.

Étude de l expression de gènes chez le blé (Triticum aestivum) en réponse à la maladie du piétin échaudage. Lycée Pierre-Gilles de Gennes / E.N.C.P.B 75013 Paris Olivier SAULNIER BTS Biotechnologies Année 2011 2012 Étude de l expression de gènes chez le blé (Triticum aestivum) en réponse à la maladie du piétin

Plus en détail

Manuel du PAXgene Blood RNA Kit

Manuel du PAXgene Blood RNA Kit Manuel du PAXgene Blood RNA Kit Version 2 Le système PAXgene Blood RNA est composé d un tube à prélèvement sanguin (PAXgene Blood RNA tube) et d une trousse de purification d acides nucléiques (PAXgene

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar EBV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

SEQUENÇAGE LI-COR DNA 4200

SEQUENÇAGE LI-COR DNA 4200 SEQUENÇAGE LI-COR DNA 4200 Le gel de séquence contient 64 puits au maximum soit 16 clones traités en parallèle. Les oligos utilisés (modifiés en 5 ) fluorescent à 700/800 nm. Une amorce permet de séquencer

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Conférence technique internationale de la FAO

Conférence technique internationale de la FAO Décembre 2009 ABDC-10/7.2 F Conférence technique internationale de la FAO Biotechnologies agricoles dans les pays en développement: choix et perspectives pour les cultures, les forêts, l élevage, les pêches

Plus en détail

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE CONCOURS EXTERNE Session 2005 TRAVAUX PRATIQUES DE BIOCHIMIE PHYSIOLOGIE ALCOOL ET FOIE L éthanol, psychotrope puissant, est absorbé passivement dans l intestin

Plus en détail

Cônes PureSpeed. Pureté et concentration optimisées Cônes pour purification de Protéines

Cônes PureSpeed. Pureté et concentration optimisées Cônes pour purification de Protéines Cônes PureSpeed Cônes pour protéine PureSpeed Pureté et concentration optimales Rapide moins de 15 minutes Traitement simultané de plusieurs échantillons Pureté et concentration optimisées Cônes pour purification

Plus en détail

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES L OUTIL IDEAL POUR TOUTES LES DETECTIONS IMMUNOCHIMIQUES pour toutes les techniques immunodosages (EIA/ELISA) dot/ westernblot immunohistochimie immunocytochimie cytométrie en flux quel que soit le système

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Module 4 Extraction et purification de l ADN M. Somma WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

Table des matières. Renseignements importants sur la sécurité 2. Nettoyage et élimination 4. Spécifications 4

Table des matières. Renseignements importants sur la sécurité 2. Nettoyage et élimination 4. Spécifications 4 Système FlashGel TM Lonza Rockland, Inc. www.lonza.com scientific.support@lonza.com Assistance scientifique : 800-521-0390 Service à la clientèle : 800-638-8174 Rockland, ME 04841 Table des matières Renseignements

Plus en détail

Introduction : l ère de la génomique

Introduction : l ère de la génomique Introduction : l ère de la génomique En 1995, pour la première fois, la séquence complète du génome d une cellule vivante a été déterminée. Il s agissait d Haemophilus influenzae, une bactérie responsable

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

UE : GENE 2208. Responsable : Enseignant : ECUE 1. Enseignant : ECUE 2. Dr COULIBALY Foungotin Hamidou

UE : GENE 2208. Responsable : Enseignant : ECUE 1. Enseignant : ECUE 2. Dr COULIBALY Foungotin Hamidou UE : GENE 2208 Responsable : Enseignant : ECUE 1 Enseignant : ECUE 2 Dr COULIBALY Foungotin Hamidou Spécialités : Génétique Humaine Biologie de la Procréation Cytogénétique Spermiologie Essais Cliniques

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

3. METHODES ALTERNATIVES

3. METHODES ALTERNATIVES POURQUOI? Inconvénients des méthodes classiques Besoins: Rapidité Précision Faible coût Spécificité Principe des méthodes alternatives: pas de mise en culture LES ACTIVITES ENZYMATIQUES PHOSPHATASES 4-paranitrophényl

Plus en détail

Diagnostic de la rage en laboratoire. Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA

Diagnostic de la rage en laboratoire. Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA Diagnostic de la rage en laboratoire Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA Structure de gouvernance - ACIA L ACIA relève du ministre de l Agriculture,

Plus en détail

évaluation des risques professionnels

évaluation des risques professionnels évaluation des professionnels Inventaire des Etablissement : Faculté de Médecine Unité de travail : Laboratoire de Biochimie Médicale Année : 2013 Locaux Bureaux Salle de Microscopie Culture cellulaire

Plus en détail

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE 4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE L écologie microbienne (ou étude des micro-organismes de l environnement) étudie : les relations entre les différentes populations de micro-organismes

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire Produire une protéine recombinante Principes et Méthodes de Biologie Moléculaire Gabrielle Potocki-Veronese INSA-Laboratoire Biotechnologie-Bioprocédés Toulouse Equipe Ingénierie Enzymatique Moléculaire

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits 2.0 Interprétation des cotes d évaluation des risques relatifs aux produits L interprétation des cotes attribuées dans le cadre des évaluations des risques relatifs aux produits décrite plus loin repose

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

LES BIOTECHNOLOGIES DANS LE DIAGNOSTIC DES MALADIES INFECTIEUSES ET LE DÉVELOPPEMENT DES VACCINS

LES BIOTECHNOLOGIES DANS LE DIAGNOSTIC DES MALADIES INFECTIEUSES ET LE DÉVELOPPEMENT DES VACCINS CHAPITRE 1.1.7. LES BIOTECHNOLOGIES DANS LE DIAGNOSTIC DES MALADIES INFECTIEUSES ET LE DÉVELOPPEMENT DES VACCINS INTRODUCTION Les méthodes de biologie moléculaire ont de plus en plus d applications dans

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Les méthodes potentiométriques

Les méthodes potentiométriques Le ph-mètre (réf :Skoog, West, Holler, Section 19-A. p 412) Les méthodes potentiométriques 2 e partie Erreur dans la mesure d une tension à l aide d un ph-mètre (ionomètre) Maintenant que nous avons explorés

Plus en détail

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral.

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral. - La cytométrie en flux est une méthode d analyse de cellules en suspension, véhiculées à grande vitesse jusqu à une chambre d analyse traversée par des faisceaux lasers. L interaction des cellules avec

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

SESSION DE FORMATION A L'UTILISATION DE LA TECHNIQUE PCR POUR LE DIAGNOSTIC DE L'INFECTION A HERPESVIRUS CHEZ LES HUITRES

SESSION DE FORMATION A L'UTILISATION DE LA TECHNIQUE PCR POUR LE DIAGNOSTIC DE L'INFECTION A HERPESVIRUS CHEZ LES HUITRES SESSION DE FORMATION A L'UTILISATION DE LA TECHNIQUE PCR POUR LE DIAGNOSTIC DE L'INFECTION A HERPESVIRUS CHEZ LES HUITRES De la I!rande théorie aux petites recettes - ImEMER La Tremblade 23 et 24 avril

Plus en détail

Production d une protéine recombinante

Production d une protéine recombinante 99 Production d une protéine recombinante Lic. B. PIRSON Lic. J-M. SERONT ISICHt - Mons Production de la protéine recombinante GFP (Green Fluorescent Protein d Aequoria victoria) par une bactérie ( E.

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

L ADN dans le diagnostic médical

L ADN dans le diagnostic médical Valise Pédagogique: À la découverte de l ADN Une collaboration entre l Université de Fribourg et le Musée d histoire naturelle de Fribourg L ADN dans le diagnostic médical Protocole pour l enseignant Léonard

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705 356-3961 356-3963 356-4705 DOMAINE D APPLICATION La gélose RAPID Salmonella est un milieu chromogénique utilisé pour la recherche des Salmonella spp. lors de l'analyse des produits d alimentation humaine

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

HRP H 2 O 2. O-nitro aniline (λmax = 490 nm) O-phénylène diamine NO 2 NH 2

HRP H 2 O 2. O-nitro aniline (λmax = 490 nm) O-phénylène diamine NO 2 NH 2 ! #"%$'&#()"*!(,+.-'/0(,()1)2"%$ Avant d effectuer le dosage en IR de la biotine, il est nécessaire de s assurer de la reconnaissance du traceur par la streptavidine immobilisée sur les puits. Pour cela,

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage dans le vin (OIV-Oeno 427-2010)

Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage dans le vin (OIV-Oeno 427-2010) Méthode OIV- -MA-AS315-23 Type de méthode : critères Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage (OIV-Oeno 427-2010) 1 Définitions des

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Test d immunofluorescence (IF)

Test d immunofluorescence (IF) Test d immunofluorescence (IF) 1.1 Prélèvement du cerveau et échantillonnage Avant toute manipulation, il est fondamental de s assurer que tout le personnel en contact avec un échantillon suspect soit

Plus en détail

LA RÉACTION DE POLYMÉRISATION EN CHAÎNE (PCR) PRINCIPE ET APPLICATIONS

LA RÉACTION DE POLYMÉRISATION EN CHAÎNE (PCR) PRINCIPE ET APPLICATIONS Muséum de Nîmes 19, rand rue BP 81295 F-30015 Nîmes cedex 1 L RÉTION DE POLYMÉRISTION EN HÎNE (PR) PRINIPE ET PPLITIONS Tel / Fax : +33(0)466 67 82 29 E-mail : info@ecole-adn.fr http://www.ecole-adn.fr

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail