Rapport Scientifique Seine-Aval 3

Dimension: px
Commencer à balayer dès la page:

Download "Rapport Scientifique Seine-Aval 3"

Transcription

1 Rapport Scientifique Seine-Aval 3 Séminaire Seine-Aval 2008 Fiches de synthèse des propositions SA4 THEME 3 : TABLEAU DE BORD ET INDICATEURS OPERATIONNELS PUCES A ADN CHEZ MYTILUS EDULIS Danger J-M. C. Lévêque C. Dégremont GIP Seine-Aval 12 Avenue Aristide Briand Rouen tel : fax :

2 1 Résumé L objectif de la proposition de recherche était d isoler des produits de gènes différentiellement régulés par un mélange de xénobiotiques regroupant 4 classes principales de contaminants. Cette partie du projet constitue une des étapes nécessaire à la construction de puces à ADN les plus exhaustives possibles permettant un suivi environnemental des populations de moules bleues qui sont largement utilisées comme espèce sentinelle dans les programmes de biosurveillance. Ces clones complètent le panel de gènes qui avait précédemment été isolé et «imprimé» sur des puces à ADN après exposition à l atrazine. Les banques construites au cours de cette phase 2004 du programme Seine-Aval sont au nombre de 8. Elles visent à dégager des gènes régulés positivement ou négativement par les xénobiotiques tout en prenant en compte les paramètres de tidalité. En effet, les moules sont soumises à une alternance d immersion/émersion qui constitue un stress supplémentaire à celui engendré par la contamination anthropique. Les banques comprennent près de 1300 gènes qui vont enrichir les 1175 clones qui avaient été déjà obtenus chez la moule bleue (voir rapports antérieurs). L ensemble de ces clones peut donc être déposé sur des puces à ADN. L utilisation des puces à ADN qui est fondée sur la comparaison deux à deux de signaux d hybridation d acides nucléiques marqués, requiert une normalisation stricte de ces signaux. Cette normalisation est généralement calculée à partir de gènes qui ne présentent pas de régulation différentielle. Des banques non soustraites sont également construites afin de répondre à cet aspect technique de normalisation. Un total de 800 clones aléatoirement sélectionnés est suffisant pour permettre une normalisation statistiquement satisfaisante. L étape de test des puces à ADN et d établissement d empreintes spécifiques de classes de contaminants fait l objet de la suite de ce travail proposé et accepté pour l année par le programme Seine-Aval. 2 Rappel des objectifs Le travail proposé visait à mettre en œuvre la méthodologie de comparaison des transcriptomes par construction de banques soustractives afin d isoler et d identifier chez la moule bleue des acteurs moléculaires impliqués dans les processus de détoxication et de lutte contre le stress spécifique à l exposition aux contaminants chimiques. L établissement d une collection de clones constitue l étape préalable à la fabrication de puces à ADN dédiées au diagnostic environnemental présentant un nombre suffisant de gènes analysés. 3 Résultats 3.1 Animaux Les moules, Mytilus edulis, sont prélevées à Yport. Leur taille est d environ 4 cm. Les animaux sont ensuite transférés dans des bacs pour une période de dépuration d une semaine. L eau de mer, fournie en flux continu, est prélevée au niveau de la côte près de Saint-Adrien au nord du Havre. Elle est filtrée à 50 µm et épurée sur des filtres à charbon actif. La température de l eau de mer est de 10 C en moyenne. Pendant cette période et lors de l exposition au mélange de contaminants, les animaux sont nourris par un flux continu pendant 2 heures par jour d algues mises en culture (grâce à l aimable collaboration de l association Aquacaux). Deux grandes classes d animaux sont soumises ou non à un régime de marées (6 heures basse mer, 6 heures haute mer). Chaque classe comprend 3 groupes de moules ; les individus témoins, les moules exposées à un mélange de contaminants et les individus exposés à du DMSO (qui est utilisé comme diluant des contaminants). Le mélange

3 de contaminant est composé de benzo-[a]-pyrène (0,5 µg.ml -1 ), phénanthrène (5 µg.ml -1 ), PCB-153 (0,5 µg.ml -1 ), nonylphénol (5 µg.ml -1 ) et carbamazépine (30 µg.ml -1 ) dilués dans du DMSO. Il est distribué dans les différents bacs par l intermédiaire d une pompe péristaltique afin d obtenir les concentrations finales précisées. Chaque groupe d animaux (témoin, témoin DMSO, exposés) comporte cent individus. Les mesures chimiques précises des concentrations en contaminants et en DMSO seront effectuées ultérieurement par le LPTC de l Université de Bordeaux. La période d exposition est de 14 jours, à l issue de laquelle les animaux sont rapidement disséqués (branchies et manteaux). Les tissus, pris individuellement pour chaque animal, sont aussitôt congelés dans de l azote liquide. Une coquille des bivalves est systématiquement conservée afin de déterminer la taille moyenne des individus qui est de 3,9 ± 0,3 cm, ce qui correspond à des animaux de 4 ans environ). La mortalité durant le maintien des animaux en conditions de laboratoire s est élevée au total de 6 individus répartis de façon aléatoire dans l ensemble des groupes. 3.2 Détermination du sexe Le mélange de contaminant contenant des composés susceptibles d avoir un effet perturbateur endocrinien et/ou oestrogéno-mimétique, les sexes des individus doivent être déterminés. Pour cela, il est fait appel à une stratégie par PCR fondée sur l analyse du polymorphisme lié au sexe du gène mitochondrial codant pour la sous-unité 3 de la cytochrome c oxydase. En effet, chez Mytilus edulis, les individus mâles possèdent dans leurs gonades des mitochondries d origine paternelle tandis que chez les femelles, ces organites ont une origine exclusivement maternelle. Les ARN totaux sont extraits du manteau à l aide de TRI Reagent (Sigma). Ces ARN comprennent les ARN ribosomaux, messagers ainsi que les ARN de transfert et l ensemble des ARN mitochondriaux. Ces derniers sont sélectivement rétrotranscrits à l aide du KIT RobusT-II (Finnzyme) à partir du mélange des 4 amorces de PCR dont les séquences sont données ci-après. La PCR est conduite dans le même tube. Deux couples d amorces sont utilisés pour amplifier des fragments de gènes «mâles» (MmtDNAfor : TGGAGTCGCTTTATTTATTTTATCTGA, MmtDNArev: ATACTACA- AACCACAGCCTCACTCATA) et «femelles» (FmtDNAfor : TATGTACCAG- GTCCAAGTCCGTG, FmtDNArev : CACATACACTAAGCACCACAATG). Cette réaction PCR permet de générer des fragments d amplification de 530 et de 753 pb respectivement pour les individus mâles et femelles. Les amplifications PCR sont effectuées dans des plaques 96 puits à l aide de thermocycleurs Biorad et/ou Hybaid. Aucune anomalie des rapports de sexe n est notée dans les différentes échantillons de moules. 3.3 Construction de banques soustractives Extraction et purification des ARNm Les tissus branchiaux provenant de 50 individus mâles sont rassemblés. Les ARN totaux sont extraits à l aide de TRI Reagent (Sigma) suivant le protocole décrit par le fabricant du réactif. Les ARN totaux sont contrôlés par électrophorèse sur gel d agarose à 1,5% dans du tampon TAE en présence de SDS à 0,1%. La quantité d ARN totaux et le spectre UV sont déterminés à l aide d un spectrophotomètre à barrettes (Nanodrop) sur un aliquot de 1 µl. Les rapports de DO260nm/280nm obtenus sont supérieurs à 1,9. Les ARN messagers sont ensuite purifiés sur des particules paramagnétiques à l aide du Kit PolyATtract mrna Isolation Systems Promega. Brièvement, les ARN sont mis en présence d oligod(t) biotinylés dans un tampon d hybridation composé de 5 x SCC. Seuls les ARNm s hybrident et sont piégés à l aide de particules paramagnétiques liées à l avidine. La qualité des messagers et leur pureté est

4 estimée par spectrophotométrie UV (Nanodrop) avant de procéder à la construction de banques soustractives Rétranscription Les ARNm (2,0 µg au total) sont soumis à une digestion à la DNase I afin d éliminer toute contamination d ADN génomique. Ils sont ensuite de nouveau purifiés par extraction au phénol-chloroforme-alcool isoamylique avant d être rétrotranscrits. La rétrotranscription est réalisée à l aide de la SuperscriptIII (Life Sciences Technologies) en utilisant une amorce dégénérée de séquence TTTTGTACAAGCTT 30 N 1 N. La réaction est conduite pendant 1h30 à 42 C Synthèse du second brin d ADN La synthèse du second brin d ADNc est assurée par un cocktail enzymatique composé ADN polymérase I (fragment de Klenow), RNase H d ADN ligase d E. coli. La réaction est ensuite complétée par l ajout d ADN polymérase de T4. La réaction est ensuite arrêtée et une extraction au phénol chloroforme est effectuée Digestion par RsaI Les ADNc sont soumis à une digestion complète par RsaI. Cette digestion est contrôlée par électrophorèse sur gel d agarose. Cette digestion constitue l étape finale pour la fabrication des échantillons qualifiés de «driver» qui seront ensuite utilisés comme soustracteurs lors des hybridations Ligation des adaptateurs Les fragments de digestion RsaI subissent parallèlement deux ligations avec deux adaptateurs différents partiellement bicaténaires (adaptateurs 1 et 2R) en présence de T4 ADN ligase. Les ADNc munis d adaptateurs constituent les «testers» c'est-à-dire les espèces nucléiques qui subissent la soustraction Hybridations Une première série d hybridations est réalisée entre, d une part, les «testers» munis d adaptateurs 1 et les «drivers» et, d autre part, les «testers» munis d adaptateurs 2R et les «drivers». Ces hybridations sont effectuées pendant 8 heures à 68 C. Une seconde hybridation est ensuite réalisée en mélangeant les deux échantillons avec un excès de «driver». Les espèces différentiellement exprimées issues de la soustraction «tester» «driver» sont ensuite amplifiées par PCR suppressive PCR suppressive Les ADNc munis d adaptateurs subissent ensuite un «fill in» afin de remplir les extrémités dépassantes. Une première PCR de 27 cycles est effectuée à l aide d une amorce unique (CTAATACGACTCACTATAGGGC) complémentaire d une portion des adaptateurs 1 et 2R. Ensuite une seconde amplification de 12 cycles est ensuite conduite en utilisant comme matrice une dilution au 1/10 de la première PCR et comme amorces les oligonucléotides (TCGAGCGGCCGCCCG-GGCAGGT et AGCGTGGTCGCGGCCGAGGT). Les produits de chaque PCR sont déposés sur gel d agarose à 2% pour analyse par électrophorèse.

5 3.3.8 Ligation dans le vecteur pgem-t Les produits issus de la seconde PCR sont introduits par TA-cloning dans le vecteur pgem-t à l aide de T4 DNA ligase Transformation dans les bactéries de la souche Xl1-Blue Les cellules XL1-Blue électro-compétentes sont préparées selon la méthode usuelle. La transformation bactérienne des produits de ligation est effectuée par électroporation (GenePulser, Biorad). Les clones bactériens sont cultivés sur Petri LB additionnés d ampicilline, d Xgal et d IPTG Mise en culture des clones bactériens Chaque colonie est prélevée et cultivée individuellement dans LB ampicilline. Des stocks glycérol des clones bactériens sont systématiquement réalisés Amplification par PCR des inserts Pour chaque clone, une amplification par PCR de l insert est effectuée à l aide des amorces T7 et Sp6 qui s hybrident de part et d autre du «polylinker» de pgem-t. La taille moyenne des inserts obtenus est de 550 bp. 3.4 Analyse des banques Un total de 8 banques soustractives a été construit suivant le schéma suivant : Ces banques comprennent un nombre total de 1293 clones qui doivent maintenant être analysés sur des puces à ADN. La suite du projet est prévue dans le cadre du programme Seine-Aval III pour l année

6 3.5 Construction de banques d ADN Afin de disposer d un panel de clones dits contrôles sur les puces à ADN (projet , Seine-Aval III), des banques d ADNc non soustraites sont construites Extraction et purification des ARNm Les ARN totaux sont extraits à partir de 3 moules non exposées provenant d Yport suivant le protocole décrit plus haut. La méthode utilisée permet de sélectionner des messagers complets notamment à leur extrémité Traitement à la phosphotase alcaline Les ARN isolés sont soumis à une déphosphorylation par la phosphatase alcaline qui laisse les seuls ARN non munis d une coiffe (7MeGppp) avec des extrémités 5 non-phosphorylées. Les messagers complets étant protégés par cette coiffe de l action de la CIP Traitement à la pyrophosphatase Les ARN sont ensuite soumis à l action de la pyrophosphatase acide de tabac qui attaque les messagers munis d une coiffe et génère au niveau ceux-ci une extrémité 5 -phosphate Ligation d un oligo-ribonucléotide Un ARN oligonucléotide de séquence (CGACUGGAGCACGAGGACACUGACAUGGAC- UGAAGGAGUAGAAA) est ligasé aux extrémités 5 phosphate des ARN qui en sont encore pourvus (les ARNm complets) Transcription inverse La transcription inverse est conduite avec de la Superscript III en utilisant comme amorce l oligonucléotide de séquence GCTGTCAACGATACGCTACGTAACGGCATGACA- GTGT Amplification par PCR Les ADNc monocaténaires construits sont ensuite amplifiés par PCR en utilisant comme amorces des oligonucléotides complémentaires de l oligorna (CGACTGGAGCACGA) et l amorce de rétro-transcription (GCTGTCAACGATA). Les produits PCR sont contrôlés par électrophorèse sur gel d agarose Digestion par RsaI Une partie des produits PCR est digérée à l aide de l enzyme RsaI afin de générer des fragments de tailles comparables à celles des inserts obtenus lors de la construction de banques soustractives.

7 3.5.8 Ligation d adaptateurs L adaptateur 1 utilisé lors de la construction de banques soustractive est ligasé à l aide de la T4 DNA ligase sur les fragments RsaI PCR et clonage dans pgem-t Les produits de ligation obtenus à l étape précédente sont amplifiés par PCR à l aide de l amorce utilisée lors de la PCR suppressive. Les produits sont ensuite clonés dans le vecteur plasmidique pgem-t, puis la transformation est effectuée dans des bactéries Xl1-Blue électrocompétentes. L utilisation de cette procédure permet de générer une banque comprenant près de 800 clones qui sont prélèvés de façon aléatoire. Cela doit permettre de construire un segment «contrôle» sur les puces à ADN qui seront construite afin d aider à la normalisation des puces. 4 Conclusion Les banques soustractives construites doivent permettre de faire la distinction entre les effets des contaminants dans le contexte d une alternance des marées. Par ailleurs, les banques nonsoustraites fournissent un ensemble de clones contrôles nécessaires à la normalisation des puces à ADN. Il est désormais possible de passer à la seconde étape de la construction des puces à ADN qui est décrite dans le projet déposé et accepté pour l année du programme Seine-Aval. De façon parallèle et hors programme Seine-Aval, une démarche similaire est développée chez la moule zébrée Dreissena polymorpha. Les résultats obtenus chez les deux espèces de bivalves l une marine, l autre dulcicole, sont confrontés. 5 Publications sur le thème en Article : Masson R., Loup B., Bultelle F., Siah A., Leboulenger F et Danger J.M.. Identification of gene encoding DnaK-type molecular chaperone as potentially down regulated in blue mussels (Mytilus edulis) exposed to acute exposure to atrazine. Hydrobiologia. (Soumis). 5.2 Communications orales ou affichées Masson R., Bultelle F., Siah A., Loup B., Panchout M., Leboulenger F. et Danger J.M. Analyse différentielle des transcriptomes de bivalves bioindicateurs exposés à des contaminants organiques. 18ème Congrès de l ACFAS. Montréal, Canada, Mai Loup B., Marin M., Masson R., Manduzio H., Maillet G., Poret A., Siah A., Bultelle F., Le Foll F., Rocher B. et Danger J.M. Ecotoxicologie moléculaire chez les bivalves : transcriptomique, protéomique et signalisation ionique. 12 Journée de l IFRMP. Dieppe, France. Juin 2004.

8 Masson R., Bultelle F., Loup B., Panchout M., Siah A. and Danger J.M. (2004). Transcriptome analysis in bivalve species (Mytilus edulis and Dreissena polymorpha) as a tool to identify new biomarkers of exposure to xenobiotics. 38 ème Symposium de l Estuarine and Coastal Sciences Association (ECSA). Rouen, Septembre Danger J.M. Development of a genetically modified yeast and of DNA arrays as tools for environmental risk assessment. Symposium on Biotechnologies. Incheon, Corée. Décembre 2004.

9 Crédits photos : C. Dégremont, R. Hocdé, C. Lévêque, S. Moussard Pour tout renseignement, veuillez contacter la coordination scientifique : Le GIP Seine-Aval ne saurait être tenu responsable d'évènements pouvant résulter de l'utilisation et de l'interprétation des informations mises à disposition. Travaux co-financés par :

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Département de biologie Page 1 sur 6

Département de biologie Page 1 sur 6 Département de biologie Page 1 sur 6 TP de Biologie Moléculaire : BIO 36 Marion Benoîst, Keith Dudley, Dominique Charmot Introduction Lors de ce TP vous allez cloner des molécules d ADN. L objectif est

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

CHAPITRE III: Le Clonage

CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN But de la manipulation Le but de cette manipulation est l introduction d un gène de méduse codant pour une protéine fluorescente dans des bactéries par l

Plus en détail

MLVA Streptococcus pneumoniae

MLVA Streptococcus pneumoniae H.I.A. Robert Picqué Bordeaux Laboratoire de Biologie moléculaire Version Internet 2 MLVA Streptococcus pneumoniae 1. DESCRIPTION DES OPERATIONS 1.1 Culture et extraction des ADN NB : prévoir dans la série

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Hybridation et marquage Affymetrix puce HU133 Plate-Forme. plus 2

Hybridation et marquage Affymetrix puce HU133 Plate-Forme. plus 2 PRECAUTIONS GENERALES : HYBRIDATION AFFYMETRIX - Toutes les manipulations se font avec des gants de façon à limiter le risque de dépôt de RNAses présentes en grande quantité sur notre peau. - Tout le matériel

Plus en détail

Guide d utilisation des kits Perfect Master Mix SYBR Green

Guide d utilisation des kits Perfect Master Mix SYBR Green Guide d utilisation des kits Perfect Master Mix SYBR Green Pour les produits AnyGenes : Cat # PMSX-F2S Cat # PMSX-F4S Cat # PMSX-F8S Cat # PMSX-F12S Cat # PMSX-F24S (* Cat # pour toutes les références

Plus en détail

REGULATION GLOBALE DE L EXPRESSION DES GENES

REGULATION GLOBALE DE L EXPRESSION DES GENES REGULATION GLOBALE DE L EXPRESSION DES GENES TP4 : Les puces à ADN -introduction 21 -réactifs et matériel 22 -protocoles extraction des ARN totaux de levure 23 purification des ARN messagers 24 synthèse

Plus en détail

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE THÈME : Des débuts de la génétique aux enjeux actuels des biotechnologies Niveau : Spécialité terminale S TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE EXTRAIT DU BO: Notions et contenus

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

TUTORAT UE spécifiques 2010-2011

TUTORAT UE spécifiques 2010-2011 FACULTE de PHARMACIE TUTORAT UE spécifiques 2010-2011 Méthodes d étude et d analyse du génome Eric Badia, Bernard Carcy Séance préparée par Alexandre Leboucher (ATM²), Astrid Robert (ATP) QCM n 1: Synthèse

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

TP BC : ADN recombinant BCPST1, ENCPB

TP BC : ADN recombinant BCPST1, ENCPB TP BC : principe et analyse de résultats des technologies de l ADN recombinant = clonage moléculaire = génie génétique Sources des illustrations : Analyse génétique moderne, Griffith et al., De Boeck,

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Manipulation des acides nucléiques

Manipulation des acides nucléiques Manipulation des acides nucléiques (voir chapitre 6 du Voet et Voet) - les acides nucléiques forment des polymères : ADN et ARN - ils sont composés de 4 nucléotides: A, C, G et T pour l ADN A, C, G et

Plus en détail

STAGE EN MILIEU PROFESSIONNEL. Année scolaire 2006/2007

STAGE EN MILIEU PROFESSIONNEL. Année scolaire 2006/2007 STAGE EN MILIEU PROFESSIONNEL Année scolaire 2006/2007 Etablissement d accueil : ENSAIA, groupe GPBA (Génie des Procédés Biotechnologiques et Alimentaires) laboratoire de Jean-Louis Georgen (Jean-Louis.Goergen@ensaia.inpl-nancy.fr)

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml

Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml Pour la purification de l ADN génomique des kits de prélèvements Oragene et ORAcollect. Pour tout protocole et

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00)

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00) Pour jeudi 12/02/2014 DEVOIR A LA MAISON BMGG (temps recommandé : 2H00) Calculatrice non autorisée Dictionnaire anglais/français autorisé. Clonage et PCR En 1983, Kary Mullis conçut l'idée de la réaction

Plus en détail

Master ICMV 1 ére année. TP UE S8

Master ICMV 1 ére année. TP UE S8 1 Master ICMV 1 ére année. TP UE S8 PRODUCTION ET SELECTION DE BACULOVIRUS RECOMBINANTS DANS DES CELLULES D INSECTES EN CULTURE Présentation générale : les baculovirus d insectes, vecteurs d expression

Plus en détail

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Français - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA purification Français Introduction

Plus en détail

Nouveau protocole Affymetrix (1 er juin 2004)

Nouveau protocole Affymetrix (1 er juin 2004) Nouveau protocole Affymetrix (1 er juin 2004) Important : pipettez toujours un volume égal ou supérieur à 2 µl. Étape 1 : préparation des ARN poly-a contrôles Quantité d ARN Dilutions en série à ajouter

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI 2 Digestion par les enzymes SalI et EcoRV Digestion par les enzymes XhoI et SmaI Klenow: sous-unité de l ADN Polymérase I d E. coli possédant une activité ADN polymérase 5-3 et une activité exonucléasique

Plus en détail

L2 microbiologie TD08: méthodes de la microbiologie moléculaire

L2 microbiologie TD08: méthodes de la microbiologie moléculaire # Andrew Tolonen (atolonen@gmail.com) # avril 2013 L2 microbiologie TD08: méthodes de la microbiologie moléculaire Exercise 1: amplification d'un gène d'intéret par PCR Vous êtes un médecin travaillant

Plus en détail

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus Projet I Vérifier la carte de restriction d une insertion d ADN Objectifs Déterminer quel gène vous avez (Bioinfo) Générer une carte théorique (Bioinfo) Vérifier expérimentalement la carte Déterminer l

Plus en détail

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010 Kits de travaux pratiques Génétique - Biotechnologie CATALOGUE 2009-2010 L École de l ADN est un centre de formation et d information sur les avancées des sciences biologiques. Sa mission principale consiste

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser.

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser. AVERTISSEMENT Au fil de l ouvrage, les termes ou les notions importantes développés dans le livre de cours Bases cellulaires et moléculaires du développement (Ellipses, 2007), sont notés (I) ou (I, p.x).

Plus en détail

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine Exercice 1 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine 2) Parmi ces bases, lesquelles : a) contiennent du ribose.

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine POLASZEK André juin 2012 Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine Sommaire RAPPORT DE STAGE 1 Sommaire 2 Introduction 3 Méthode 6 Migration sur gel d

Plus en détail

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats.

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats. Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats Ivan Starikov Encadrant: Lotfi Aleya Co-encadrant: Nicolas Capelli UMR CNRS 6249

Plus en détail

Rapport de Stage d Excellence :

Rapport de Stage d Excellence : VASSEUR Julien UJF- L1 Rapport de Stage d Excellence : Caractérisation de la structure du Pilus Maître de stage : Anne-Marie Di Guilmi Directeur de Laboratoire : Thierry Vernet 1 Remerciements En premier

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Techniques générales de biologie moléculaire

Techniques générales de biologie moléculaire Techniques générales de biologie moléculaire Plan du cours : - Introduction - Préparation du matériel biologique - Les extractions d acides nucléiques - Les précipitations d acides nucléiques - Le dosage

Plus en détail

EXPRESSION IN VIVO DU GÈNE GFP SOUS LA FORME D UNE PROTÉINE DE FUSION

EXPRESSION IN VIVO DU GÈNE GFP SOUS LA FORME D UNE PROTÉINE DE FUSION Analele tiin ifice ale Universit ii Alexandru Ioan Cuza, Sec iunea Genetic i Biologie Molecular, TOM VII, 2006 EXPRESSION IN VIVO DU GÈNE GFP SOUS LA FORME D UNE PROTÉINE DE FUSION LUCIAN NEGUR 1*, ANCA

Plus en détail

Synthèse du premier brin d ADNc

Synthèse du premier brin d ADNc Synthèse du premier brin d ADNc (1 er juin 2004) L ARN total doit avoir une concentration d au moins 2 µg/µl pour la synthèse du premier brin d ADNc. Si la concentration d ARN total est inférieure à 2

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Les acides nucléiques : structure et fonction

Les acides nucléiques : structure et fonction Les acides nucléiques : structure et fonction Acide nucléique = ADN - ARN. Il s agit d une macromolécule formée par polymérisation de nucléotide. Il comporte 2 messages. Le message intrinsèque nécessite

Plus en détail

Guide sur le PCR en temps réel (qpcr)

Guide sur le PCR en temps réel (qpcr) Guide sur le PCR en temps réel (qpcr) Un service complet est offert par la plateforme de génomique de l IRIC pour le qpcr incluant l analyse de votre ARN, la préparation de vos cdna, le design des essais,

Plus en détail

Explications théoriques

Explications théoriques Explications théoriques L'ADN: Définitions L'ADN (Acide Désoxyribo Nucléique) est la molécule qui est utilisée dans la nature comme support matériel de l'information génétique des êtres vivants, un peu

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

S 4B0602: Biologie Moléculaire pour les Biotechnologies

S 4B0602: Biologie Moléculaire pour les Biotechnologies S 4B0602: Biologie Moléculaire pour les Biotechnologies 16h TP: Sexage de viande bovine Production d une protéine recombinante, la TAQ ADN Polymérase. 12h CM: Empreintes génétiques Détection d OGM Construction

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat

Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat TECHNIQUES DE SEPARATION : ADN, ARN & PLASMIDES Connaître les principes des techniques de base de la biologie moléculaire.

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY)

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) Lise Vézina, technicienne de laboratoire Michel Lacroix, agronome-phytopathologiste Direction de l innovation scientifique et technologique Au Laboratoire

Plus en détail

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction) L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Corinne.sailleau@anses.fr Agence Nationale de Sécurité

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

É L É M E N T D E P R O D U I T

É L É M E N T D E P R O D U I T Immucor Transplant Diagnostics, Inc. 550 West Avenue, Stamford, Connecticut 06902 ; États-Unis Tél. : +1(203) 328-9500 ou (888) 329-0255 (aux États-Unis et au Canada), Télécopie : +1 (203) 328-9599 WWW.IMMUCOR.COM

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

LE GENIE GENETIQUE ET LE CLONAGE D'ADN

LE GENIE GENETIQUE ET LE CLONAGE D'ADN LE GENIE GENETIQUE ET LE CLONAGE D'ADN Le génie génétique est un ensemble de techniques de biologie moléculaire permettant d'isoler des gènes spécifiques, de les reconstruire puis de les réinsérer dans

Plus en détail

Procédure normalisée de fonctionnement du RCBT Dérivés de tissu Extraction d ADN

Procédure normalisée de fonctionnement du RCBT Dérivés de tissu Extraction d ADN Procédure normalisée de fonctionnement du RCBT Numéro de PNF: 08.03.008 Version: f2.0 Remplace: 8.3.008 e1.0 Catégorie: Manipulation du matériel et de la documentation Tissu solide Approuvée par: Le groupe

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE MARCH 16, 2014 SERVICES DE SEQUENÇAGE Centre d innovation Génome Québec et Université McGill Services de Validation et détection de SNP Technologie de Séquençage de Nouvelle Génération Guide de l utilisateur

Plus en détail

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation PROTOCOLE AUTOMATISÉ Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation Mode d emploi des produits A1751 et A2751 Réservé

Plus en détail

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles»

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles» Ministère de l Enseignement Supérieur et de la Recherche Scientifique Université Virtuelle de Tunis Génie de la biocatalyse et génie des procédés «Production d enzymes industrielles» Concepteur du cours:

Plus en détail

CONCOURS EXTERNE D ACCES AU CORPS DES TECHNICIENS DE RECHERCHE ET FORMATION

CONCOURS EXTERNE D ACCES AU CORPS DES TECHNICIENS DE RECHERCHE ET FORMATION Concours Externe Technicien en SVT et Biotechnologies CONCOURS ITRF 2014 BAP A : science du vivant Biologie et recherche médicale Durée de l épreuve : 3h NUMERO DU CANDIDAT :. (Numéro indiqué sur l étiquette

Plus en détail

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI Mlle ImaneSmaili SVI4 Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI PLAN 1. Introduction 2.Définition 3. Principe 4.Les applications de la PCR Introduction La PCR «Polymerase

Plus en détail

Kit d extraction PicoPure RNA

Kit d extraction PicoPure RNA Isoler des ARN même à partir d une cellule Le kit d extraction PicoPure RNA a été développé pour obtenir une haute qualité des ARNs totaux à partir d un minimum de dix cellules. Le haut rendement obtenu

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Examen BIO 231 : Novembre 2009 Nom: Prénom :

Examen BIO 231 : Novembre 2009 Nom: Prénom : Examen BIO 231 : Novembre 2009 Nom: Prénom : 1- On dispose de 3 cultures bactériennes d'une même souche de bacillus subtilis qui ont été obtenues par ensemencement de milieu LB à partir de 3 pré-cultures

Plus en détail

Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN

Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN Numéro de PNF: 08.03.009 Version: f2.0 Remplace: 8.3.009 f1.0 Catégorie: Manipulation et documentation du matériel Tissu

Plus en détail

TD1 : Epissage alternatif

TD1 : Epissage alternatif TD1 : Epissage alternatif Le gène de la tropomyosine α de xénope possède trois exons 3' terminaux, appelés exon 9A9', 9B et 9D, dont la sélection différentielle en fonction du contexte tissulaire produit

Plus en détail

FORMATIONS VWR 2015. Biochimie, biologie cellulaire et moléculaire. Botanique et science du végétal. Chimie et électrochimie

FORMATIONS VWR 2015. Biochimie, biologie cellulaire et moléculaire. Botanique et science du végétal. Chimie et électrochimie FORMATIONS VWR 2015 FORMATIONS VWR 2015 Biochimie, biologie cellulaire et moléculaire Botanique et science du végétal Chimie et électrochimie Environnement et développement durable Hygiène, sécurité et

Plus en détail

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence.

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence. METHODOLOGIE Southern, Northern,, Western, PCR,Séquence. Les grandes étapes * Transciptase Reverse : 1970 (Temin et Baltimore) * Enzymes de Restriction : 1970 (Smith et Nathan) * Vecteurs recombinants

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail