Gènes Diffusion - EPIC 2010

Dimension: px
Commencer à balayer dès la page:

Download "Gènes Diffusion - EPIC 2010"

Transcription

1

2 Gènes Diffusion - EPIC Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses et applications en animal. 7. Gestion des données de grandes dimensions.

3 La société Gènes Diffusion Un groupe coopératif international. Création, production et diffusion de la génétique animale. Reproduction assistée dans 4 espèces : Bovins Porcins Lapins Equins

4 USA Minesota Gènes Diffusion - international Madison 310 places Madison EUROPE CHINE Wisconsin Michigan Ommen Iowa Indianapolis 100 places Illinois Indiana Ohio Ostende Pologne Beijing Pologne 150 places Bureau Slovaquie 3 places Génisses Porcs Taureaux Roumanie 3 places Tchéquie 15 places Lleida 120 places Lleida Hongrie 20 places

5 Notions de génétique animale D une génération à l autre : sans aucune sélection. Pas d évolution génétique.

6 Notions de génétique animale Représentation d une étape de sélection. Evolution génétique sur les descendants.

7 Notions de génétique animale Aide à la sélection : AVANT L ADN : Sélection avec les mesures phénotypiques des animaux. AVEC l ADN : Sélection grâce à la génétique des animaux (avec parfois validation avec les données phénotypiques). Objectifs : Mettre à la disposition des filières un type d animaux adaptés à leurs besoins en exploitant des différences d origines génétiques. Moyens : Développement d outils et de techniques susceptibles d entraîner un progrès génétique. La plateforme génomique de Gènes Diffusion.

8 L équipe de la plateforme génomique 1 Manager 1 ingénieur en génétique animale (+1 doctorant) 1 ingénieur biomoléculaire 1 ingénieur en bioinformatique (+ 1 doctorant) 1 technicien de laboratoire 1 consultant en statistique et génétique quantitative Laboratoire transcriptomique et génomique appliquée

9 Les données animales : les phénotypes Nous possédons de grandes bases de données contenant : des informations mesurées sur nos animaux (les traits) : mesure de la production de lait pour les vaches poids des animaux, taille des jambons des informations sur la généalogie de ces animaux.

10 Les données génomiques Rappel : La génomique c est la discipline qui étudie les génomes (ensemble du matériel génétique d un individu ou d une espèce). Point de départ : Le séquençage du génome bovin et porcin. A G T C

11 Les données génomiques Le génotypage : c est une application du séquençage. Cette technologie est utilisable grâce à l augmentation spectaculaire du nombre de marqueurs disponibles. A A T T G G C C T T A C

12 Les données génomiques Dans notre laboratoire : utilisation des puces porcines marqueurs et des puces bovines marqueurs.

13 Les données génomiques A quoi cela ressemble informatiquement?

14 L objectif général ANIMAUX (avec Généalogie) GENOTYPES Analyse (QTL mapping, sélection génomique ) RESULTS

15 Environnement matériel et logiciel Le minimum pour la gestion de fichiers génotypes et phénotypes : Un logiciel pour la gestion des échantillons biologiques LIMS : laboratory information management system. Sauvegarde/Archivage Des données : 2 serveurs à l IPL et à Gènes Diffusion.

16 Environnement logiciel RESULTATS GENOTYPES INDIVIDUS AVEC MESURES PHENOTYPIQUES PLINK Perl Formatage des données pour l analyse Contrôle Qualité des échantillons et des marqueurs (MAF, HWE ) ENVIRONNEMENT BIOINFORMATIQUE Construction du/des score(s) : Correction phénotypique (prise en compte de l âge, du sexe, du centre d appartenance) Environnement logiciel s fonctionnel : Construction d haplotypes Analyse QTL Déploiement sur architecture parallèle Résultats et rapport graphique

17 L analyse et l application en animal

18 La recherche de QTL QTL : Quantitative Trait Locus. Locus, une région du génome ne correspond pas forcément à un seul gène, peut impliquer plusieurs gènes. Les polymorphismes (tels que les SNPs) sur une région QTL sont une des causes de variation phénotypiques d un trait quantitatif.

19 Les objectives d une analyse QTL 1. Identifier des régions du génome contenant des QTL. 2. Estimer les effets de ce QTL sur notre trait : Quantifier en quoi la variation du trait est causée par cette region spécifique. Quel allèle de notre SNPs est associé avec un effet favorable? 3. Utilisation du QTL et des informations génétiques pour assigner des scores d index à nos animaux.

20 Utilisation des QTLs L ensemble des QTLs pour un trait donné (exemple : longévité,vitalités à la naissance ) est utilisé pour évaluer génétiquement nos animaux. Le modèle génétique se décompose comme tel : Gi : Ui : Hij1 : Hij2 : la valeur génétique. la composante polygénique : les gènes non suivis par nos marqueurs. l effet du QTLs paternels. l effet de QTLs maternels.

21 La sélection génomique (sg) Une évolution par rapport à l analyse QTLs. Utilisation, de façon optimale, les dernières technologies de génotypages (puce à haute-densité de marqueurs). Prédire la valeur génétique d un animal à partir de l ensemble des informations de son génome : à la naissance sur un embryon. Pour simplifier, on part du postulat de base que chaque marqueur est un QTL, et on calcule les effets de chaque marqueur pour obtenir la valeur génétique de l animal.

22 La sg : principe de base Publiée par Meuwissen et Goddard (2001, Genetics 157:1819). A partir d une population de référence P + P : quelques milliers d animaux avec génotypes (ex : puce à ) et phénotypes Grâce à une partie de P et P, on établit une équation de prédiction des phénotypes à partir des marqueurs On passe à une étape de validation de l équation sur P. On utilise cette équation pour obtenir les scores d index génomique de candidats C à la sélection par exemple à la naissance! P P C

23 Impact sur la diversité Il faut savoir que la SG peut être bien ou mal utilisée Impact sur la diversité a priori favorable : Minimisation du poids de l information familiale, minimisation de la diffusion des reproducteurs dit «d élite». Par conséquent : on obtient un grand nombre de reproducteurs «efficaces». On pourrait arriver à un «turn-over» rapides des taureaux (au bout d 1 an? De doses produites?).

24 Grande dimension Les puces contiennent l information de marqueurs mais la nouvelle puce bovine sortie en septembre comprend marqueurs. La sélection génomique nécessite une population de référence de plusieurs milliers d animaux (de 4000 à 8000 actuellement). On veut être capable d étudier d autres types d intéractions : Epistasie (comprendre les interactions entre gènes) Epigénétique (comprendre les régulations de l expression des gènes).

25 Grande dimension Nécessité d adaptation matérielle et logicielle face à ces masses de données. Il devient aujourd hui difficile de faire tourner des analyses marqueurs par marqueurs (temps de calcul +++ ).

26 Adaptation matérielle Plusieurs solutions existent : utilisation de Cluster de calcul utilisation de grille de calcul. Il est nécessaire d adapter les logiciels pour le déploiement sur ce type d architecture (Parallélisation ). Des solutions plus exploratoires : le GPU.

27 Adaptation logicielle & méthodologique Les approches Bayésiennes : Bayesian mapping : Chaine de Markov, stochastic search variable selection, shrinkage analysis Combiner méthodologies statistiques et algorithmes d optimisations.

28 Conclusion D énormes progrès techniques ces dernières années. Les enjeux : La bio-informatique, la bio-statistique et le développement de méthodologies nouvelles : pour gérer et valoriser la masse de données générées. Au niveau des éleveurs : La récolte des phénotypes est un point critique : toujours nécessaires pour mesurer l effet des marqueurs : les phénotypes doivent être définis précisément.

29 Merci de votre attention

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

L aventure génétique, Le cas du lapin

L aventure génétique, Le cas du lapin Histoire de lapins... Le lapin européen (Oryctolagus Cuniculus) De la Renaissance au XIXème siècle : Des élevages de production apparaissent (Olivier de Serres), les lapins sont élevés en clapier et les

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

La génomique fonctionnelle

La génomique fonctionnelle Marc Noël, B.Sc. Agr. Chargé de comptes principal Merial Canada Inc. Journée bovine de l Estrie 2006 25 novembre 2006 All animals are equal but some animals are more equal than others. George Orwell -

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit La génétique, pari gagnant le pour pari produire gagnant du pour lait produire à un coût maîtrisé du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI Centre de Jouy-en-Josas 5 février 2015 SOMMAIRE Unité GABI : Génétique Animale et Biologie Intégrative Présentation Générale Projets marquants

Plus en détail

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010 Le GIE Elevage envoie aux partenaires GENIVAL une lettre d information sur l évolution de l outil et l offre en taureaux d élevage. Merci de la diffuser auprès de tous les techniciens et éleveurs de votre

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Alexia AUBRY IFIP-Institut du porc «L accès aux données pour la recherche & l innovation» Workshop ACTA 8 octobre

Plus en détail

La Performance Digitale en Business to Business

La Performance Digitale en Business to Business La Performance Digitale en Business to Business En quoi la performance digitale B2B et son optimisation, est-elle différente d une stratégie digitale B2C? Florent Bourc his - Marketing Stratégique - 2015

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Ce certificat généalogique relatif à un bovin contient les indications conformes à celles du modèle suivant :

Ce certificat généalogique relatif à un bovin contient les indications conformes à celles du modèle suivant : Annexe CHAPITRE I er. Conditions zootechniques pour le taureau dont le sperme est collecté, traité ou stocké en qualité de sperme de bovin reproducteur de race pure dans un centre de collecte agréé A.

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

MANUEL QUALITÉ. Plate-forme Biopuces Toulouse. selon la norme ISO 9001 version 2008

MANUEL QUALITÉ. Plate-forme Biopuces Toulouse. selon la norme ISO 9001 version 2008 1 MANUEL QUALITÉ Plate-forme Biopuces Toulouse selon la norme ISO 9001 version 2008 135, avenue de Rangueil - 31077 TOULOUSE CEDEX 4 Tél. 05 61 55 96 87 - fax 05 61 55 94 00 http://biopuce.insa-toulouse.fr

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE Fronts de science Philippe Monget Directoire Opérationnel d AGENAE Sélection génomique Genome Wide Association Succès, échecs, polémique Missing heritability Epistasie Epigénétique Phénotypage La nutrigénomique

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

TerrOïko : JEU en collaboration avec la SEEM

TerrOïko : JEU en collaboration avec la SEEM TerrOïko : JEU en collaboration avec la SEEM Journée EcoInnovation et Biodiversité 21 mai 2014 - Contact: Catherine de Roincé, catherine.deroince@terroiko.fr Historique d une start-up issue de la recherche

Plus en détail

Analyse des données génétiques : approches. Christophe LALANNE 13 novembre 2009

Analyse des données génétiques : approches. Christophe LALANNE 13 novembre 2009 Analyse des données génétiques : approches univariées, multivariées et perspectives biomédicales Christophe LALANNE 13 novembre 2009 Plan de l exposé Type de données et enjeux épidémiologiques Approche

Plus en détail

Section 9. Établissement de rapports et communication des résultats

Section 9. Établissement de rapports et communication des résultats Section 9 Établissement de rapports et communication des résultats 135 Établissement de rapports et communication des résultats Distribuer rapidement les résultats aux parties prenantes. Choisir le moyen

Plus en détail

Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer

Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer Benjamin Grenier-Boley UMR744 - Santé publique et épidémiologie 17/05/2011 Benjamin Grenier-Boley, IPL Recherche d associations

Plus en détail

Première partie. Introduction Générale

Première partie. Introduction Générale Première partie Introduction Générale IX L amélioration des espèces cultivées a pour but de produire des variétés présentant des caractéristiques nouvelles pour des caractères d intérêt agronomique (création

Plus en détail

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER Forum TERATEC Vincent Frouin Déluge de données S Laguitton (CATI-CEA) B damota (INRIA-CEA) 28 JUIN 202 28 JUIN 202 CEA

Plus en détail

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle 2013. Journées Recherche Porcine, 45, 213-218. Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle Thierry TRIBOUT (1,2), Catherine LARZUL (1,2), Jean

Plus en détail

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr Plateforme de Recherche de Mutations contact: pfm@genoscope.cns.fr La plateforme recherche de mutations La plateforme mutation: - Gis Institut des maladies rares et IbiSA. - Les instituts thématiques de

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Évaluations génomiques. et d un pays à l autre

Évaluations génomiques. et d un pays à l autre Évaluations génomiques fiables d une race et d un pays à l autre Sander de Roos CRV, Pays Bas Valeurs d élevage estimées génomiques (VÉEG) fiables Nous voulons tous des VÉEG plus fiables Sélection plus

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Ingénieur de recherche en statistique

Ingénieur de recherche en statistique Ingénieur de recherche en statistique E1D24 Statistique - IR Dans le cadre d une étude ou d un projet de recherche, l ingénieur de recherche en statistique conçoit le plan d analyse statistique et prend

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce Année 2007-2008 Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce B. Monsuez Projet informatique «Voyageur de commerce» Résolution

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Logiciels et services AEI - ARSOE de DOUAI

Logiciels et services AEI - ARSOE de DOUAI 7 G e s t i o n d e L a b o r at o i r e d e S e m e n c e s B o v i n e s Outil informatique à destination des techniciens de Laboratoires de Semences Bovines permettant de gérer la taurellerie, la production

Plus en détail

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service ASA-Advanced Solutions Accelerator Partenaire informatique des Laboratoires de Recherche 100lims Solution pour la gestion des données des laboratoires et des plateformes de service Parce que vous cherchez

Plus en détail

Outils Statistiques du Data Mining

Outils Statistiques du Data Mining Outils Statistiques du Data Mining Pr Roch Giorgi roch.giorgi@univ-amu.fr SESSTIM, Faculté de Médecine, Aix-Marseille Université, Marseille, France http://sesstim-orspaca.org http://optim-sesstim.univ-amu.fr

Plus en détail

Concours EXTERNE d ingénieur des systèmes d information et de communication. «Session 2009»

Concours EXTERNE d ingénieur des systèmes d information et de communication. «Session 2009» Concours EXTERNE d ingénieur des systèmes d information et de communication «Session 2009» Meilleure copie "Rapport Technique" Thème : conception et développement logiciel Note : 15,75/20 Rapport technique

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

AfiFarm. L'outil fondamental pour la gestion de troupeau

AfiFarm. L'outil fondamental pour la gestion de troupeau AfiFarm L'outil fondamental pour la gestion de troupeau AfiFarm L'outil fondamental pour la gestion de troupeau Les éleveurs laitiers se trouvent aujourd'hui dans un environnement difficile et ont besoin

Plus en détail

Les défis de la Bioinformatique:

Les défis de la Bioinformatique: Les défis de la Bioinformatique: Une introduction à la Journée du 19 octobre Marie-Paule LEFRANC Journées du CINES 19-21 octobre 2004 organisées par Laetitia Regnier Importance des facteurs génétiques

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Demande d attribution de ressources informatiques. Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis

Demande d attribution de ressources informatiques. Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis Demande d attribution de ressources informatiques Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis Titre du projet : Nom du laboratoire : Nom de l établissement hébergeur :

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7 Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques Elec 2311 : S7 1 Plan du cours Qu est-ce l optimisation? Comment l optimisation s intègre dans la conception?

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet

gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet management sup gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet Le pictogramme qui figure ci-contre mérite une explication. Son objet est d alerter le lecteur sur la menace que

Plus en détail

Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation. P. Faverdin INRA, UMR 1080 Production du lait

Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation. P. Faverdin INRA, UMR 1080 Production du lait Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation P. Faverdin INRA, UMR 1080 Production du lait Un contexte à la recherche d outils pour aider à piloter les systèmes agricoles

Plus en détail

Les «très grandes» études épidémiologiques. Mode ou nécessité?

Les «très grandes» études épidémiologiques. Mode ou nécessité? Les «très grandes» études épidémiologiques Mode ou nécessité? P.Ducimetiere IFR69 INSERM-Paris XI Villejuif Société Française de Santé Publique NANTES 2009 Il y a 15 ans Epidemiology faces its limits!

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

Clusters for Application Service Providers. T. Monteil, J.M. Garcia P. Pascal, S. Richard

Clusters for Application Service Providers. T. Monteil, J.M. Garcia P. Pascal, S. Richard Clusters for Application Service Providers (www.laas.fr/casp) T. Monteil, J.M. Garcia P. Pascal, S. Richard 1 Généralités Le monde du calcul dans un environnement ASP Les ASP : Application Service Provider

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

SCI03 - Analyse de données expérimentales

SCI03 - Analyse de données expérimentales SCI03 - Analyse de données expérimentales Introduction à la statistique Thierry Denœux 1 1 Université de Technologie de Compiègne tél : 44 96 tdenoeux@hds.utc.fr Automne 2014 Qu est ce que la statistique?

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Double cursus en BioInformatique. Christine Froidevaux Pr. Université Paris Sud LRI CNRS UMR 8623 et INRIA Saclay Christine.Froidevaux@u-psud.

Double cursus en BioInformatique. Christine Froidevaux Pr. Université Paris Sud LRI CNRS UMR 8623 et INRIA Saclay Christine.Froidevaux@u-psud. Double cursus en BioInformatique Christine Froidevaux Pr. Université Paris Sud LRI CNRS UMR 8623 et INRIA Saclay Christine.Froidevaux@u-psud.fr Double cursus et Interdisciplinarité Mon propre parcours

Plus en détail

ET La CLASSIFICATION I/ ENUMERATION DES CRITERES

ET La CLASSIFICATION I/ ENUMERATION DES CRITERES Les CRITÈRES DE SELECTION en race AUBRAC ET La CLASSIFICATION des ANIMAUX I/ ENUMERATION DES CRITERES Les différents critères de sélection pris en compte en race Aubrac peuvent être répartis en 3 groupes

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

La Gestion de la Relation Client n est pas un luxe : c est une nécessité pour gagner en efficacité

La Gestion de la Relation Client n est pas un luxe : c est une nécessité pour gagner en efficacité SAGE CRM EXPRESS La Gestion de la Relation Client n est pas un luxe : c est une nécessité pour gagner en efficacité Titre de la rubrique Pourquoi un logiciel de Gestion de la Relation Client? Découvrir

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

Problème du voyageur de commerce par algorithme génétique

Problème du voyageur de commerce par algorithme génétique Problème du voyageur de commerce par algorithme génétique 1 Problème du voyageur de commerce Le problème du voyageur de commerce, consiste en la recherche d un trajet minimal permettant à un voyageur de

Plus en détail

État des lieux et modernisation du parc bâtiment auvergnat

État des lieux et modernisation du parc bâtiment auvergnat État des lieux et modernisation du parc bâtiment auvergnat Focus sur le cantal Mardi 10 décembre 2013 M.Poucheret En regard des applications du PMBE depuis 2005, quels sont aujourd hui les besoins de modernisation

Plus en détail

Gene Predictis parce que je suis unique

Gene Predictis parce que je suis unique Gene Predictis parce que je suis unique Route de Chantemerle 64 - CP 160 - CH-1763 Granges-Paccot Téléphone: +41 26 466 15 45 Fax: +41 26 466 15 46 info@genepredictis.com www.genepredictis.com Gene Predictis

Plus en détail

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Ingénieur de recherche en bioinformatique Journée Min2RIEN - 06/12/2012 1

Plus en détail

Stratégie projet pour valoriser l'apport des technologies mobiles. Fréderic FADDA. Mobility GBS Leader, IBM

Stratégie projet pour valoriser l'apport des technologies mobiles. Fréderic FADDA. Mobility GBS Leader, IBM Stratégie projet pour valoriser l'apport des technologies mobiles Fréderic FADDA Mobility GBS Leader, IBM L introduction des technologies Mobiles, un accélérateur Business, Opérationnel et IT L introduction

Plus en détail

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 Numéro dans le SI local : Référence GESUP : 4113 Corps : Maître de conférences du Muséum national d'histoire naturelle Article : 32ou40 Chaire

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5 LICENCE 3 2013-2014 Mention Biologie Parcours Génie Biologique et Informatique 1. Editorial du responsable La licence de BIOLOGIE se distingue par la richesse des enseignements dispensés dans les différents

Plus en détail

Leroy G. 1,2, Danchin-Burge C. 3, Verrier E. 1,2

Leroy G. 1,2, Danchin-Burge C. 3, Verrier E. 1,2 Innovations Agronomiques 29 (2013), 75-83 Faire face à de nouveaux enjeux : re-diversifier des ressources génétiques? Impacts de la réintroduction de ressources cryoconservées dans un programme de sélection

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Edouard Duchesnay Benoit Da Mota

Edouard Duchesnay Benoit Da Mota Le calcul haute performance pour l'analyse de données de neuroimagerie-génétique en grandes dimensions Edouard Duchesnay Benoit Da Mota Donnons de la suite à vos idées Problème et enjeux Compréhension

Plus en détail

Présentation du logiciel Ludiscape

Présentation du logiciel Ludiscape Ludiscape se présente sous la forme d'une palette d'outils intégrée conçue pour créer du contenu de formation, du e-learning, du mobile-learning et des jeux sérieux. Ludiscape a été conçu comme une solution

Plus en détail

Cisco Unified Business Attendant Console

Cisco Unified Business Attendant Console Cisco Unified Business Attendant Console Cisco Unified Communications est un système étendu de communications IP, d applications et de produits voix, vidéo, données et mobilité. Il rend les communications

Plus en détail

CEA/SACLAY DEPARTEMENT DES TECHNOLOGIES DES SYSTEMES INTELLIGENTS SERVICE ARCHITECTURES ET CONCEPTION

CEA/SACLAY DEPARTEMENT DES TECHNOLOGIES DES SYSTEMES INTELLIGENTS SERVICE ARCHITECTURES ET CONCEPTION Laboratoire Systèmes de Vision Embarqués CEA/SACLAY DEPARTEMENT DES TECHNOLOGIES DES SYSTEMES INTELLIGENTS SERVICE ARCHITECTURES ET CONCEPTION RT LIST DTSI - LSVE CEA/SACLAY 91191 GIF-SUR-YVETTE CEDEX

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Rmixmod Le package R de MIXMOD R

Rmixmod Le package R de MIXMOD R Rmixmod Le package R de MIXMOD R MIXMOD Rencontres R 2012 - Bordeaux Florent Langrognet Laboratoire de Mathématiques de Besançon F. Langrognet () Rmixmod Juillet 2012 1 / 41 Rmixmod 1 Contexte Le projet

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Management des processus opérationnels

Management des processus opérationnels Ecole Nationale Supérieure de Management Master Management des organisations Management des processus opérationnels Dr TOUMI Djamila Cours n 4: l approche processus et le management du système d informations

Plus en détail