Gènes Diffusion - EPIC 2010

Dimension: px
Commencer à balayer dès la page:

Download "Gènes Diffusion - EPIC 2010"

Transcription

1

2 Gènes Diffusion - EPIC Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses et applications en animal. 7. Gestion des données de grandes dimensions.

3 La société Gènes Diffusion Un groupe coopératif international. Création, production et diffusion de la génétique animale. Reproduction assistée dans 4 espèces : Bovins Porcins Lapins Equins

4 USA Minesota Gènes Diffusion - international Madison 310 places Madison EUROPE CHINE Wisconsin Michigan Ommen Iowa Indianapolis 100 places Illinois Indiana Ohio Ostende Pologne Beijing Pologne 150 places Bureau Slovaquie 3 places Génisses Porcs Taureaux Roumanie 3 places Tchéquie 15 places Lleida 120 places Lleida Hongrie 20 places

5 Notions de génétique animale D une génération à l autre : sans aucune sélection. Pas d évolution génétique.

6 Notions de génétique animale Représentation d une étape de sélection. Evolution génétique sur les descendants.

7 Notions de génétique animale Aide à la sélection : AVANT L ADN : Sélection avec les mesures phénotypiques des animaux. AVEC l ADN : Sélection grâce à la génétique des animaux (avec parfois validation avec les données phénotypiques). Objectifs : Mettre à la disposition des filières un type d animaux adaptés à leurs besoins en exploitant des différences d origines génétiques. Moyens : Développement d outils et de techniques susceptibles d entraîner un progrès génétique. La plateforme génomique de Gènes Diffusion.

8 L équipe de la plateforme génomique 1 Manager 1 ingénieur en génétique animale (+1 doctorant) 1 ingénieur biomoléculaire 1 ingénieur en bioinformatique (+ 1 doctorant) 1 technicien de laboratoire 1 consultant en statistique et génétique quantitative Laboratoire transcriptomique et génomique appliquée

9 Les données animales : les phénotypes Nous possédons de grandes bases de données contenant : des informations mesurées sur nos animaux (les traits) : mesure de la production de lait pour les vaches poids des animaux, taille des jambons des informations sur la généalogie de ces animaux.

10 Les données génomiques Rappel : La génomique c est la discipline qui étudie les génomes (ensemble du matériel génétique d un individu ou d une espèce). Point de départ : Le séquençage du génome bovin et porcin. A G T C

11 Les données génomiques Le génotypage : c est une application du séquençage. Cette technologie est utilisable grâce à l augmentation spectaculaire du nombre de marqueurs disponibles. A A T T G G C C T T A C

12 Les données génomiques Dans notre laboratoire : utilisation des puces porcines marqueurs et des puces bovines marqueurs.

13 Les données génomiques A quoi cela ressemble informatiquement?

14 L objectif général ANIMAUX (avec Généalogie) GENOTYPES Analyse (QTL mapping, sélection génomique ) RESULTS

15 Environnement matériel et logiciel Le minimum pour la gestion de fichiers génotypes et phénotypes : Un logiciel pour la gestion des échantillons biologiques LIMS : laboratory information management system. Sauvegarde/Archivage Des données : 2 serveurs à l IPL et à Gènes Diffusion.

16 Environnement logiciel RESULTATS GENOTYPES INDIVIDUS AVEC MESURES PHENOTYPIQUES PLINK Perl Formatage des données pour l analyse Contrôle Qualité des échantillons et des marqueurs (MAF, HWE ) ENVIRONNEMENT BIOINFORMATIQUE Construction du/des score(s) : Correction phénotypique (prise en compte de l âge, du sexe, du centre d appartenance) Environnement logiciel s fonctionnel : Construction d haplotypes Analyse QTL Déploiement sur architecture parallèle Résultats et rapport graphique

17 L analyse et l application en animal

18 La recherche de QTL QTL : Quantitative Trait Locus. Locus, une région du génome ne correspond pas forcément à un seul gène, peut impliquer plusieurs gènes. Les polymorphismes (tels que les SNPs) sur une région QTL sont une des causes de variation phénotypiques d un trait quantitatif.

19 Les objectives d une analyse QTL 1. Identifier des régions du génome contenant des QTL. 2. Estimer les effets de ce QTL sur notre trait : Quantifier en quoi la variation du trait est causée par cette region spécifique. Quel allèle de notre SNPs est associé avec un effet favorable? 3. Utilisation du QTL et des informations génétiques pour assigner des scores d index à nos animaux.

20 Utilisation des QTLs L ensemble des QTLs pour un trait donné (exemple : longévité,vitalités à la naissance ) est utilisé pour évaluer génétiquement nos animaux. Le modèle génétique se décompose comme tel : Gi : Ui : Hij1 : Hij2 : la valeur génétique. la composante polygénique : les gènes non suivis par nos marqueurs. l effet du QTLs paternels. l effet de QTLs maternels.

21 La sélection génomique (sg) Une évolution par rapport à l analyse QTLs. Utilisation, de façon optimale, les dernières technologies de génotypages (puce à haute-densité de marqueurs). Prédire la valeur génétique d un animal à partir de l ensemble des informations de son génome : à la naissance sur un embryon. Pour simplifier, on part du postulat de base que chaque marqueur est un QTL, et on calcule les effets de chaque marqueur pour obtenir la valeur génétique de l animal.

22 La sg : principe de base Publiée par Meuwissen et Goddard (2001, Genetics 157:1819). A partir d une population de référence P + P : quelques milliers d animaux avec génotypes (ex : puce à ) et phénotypes Grâce à une partie de P et P, on établit une équation de prédiction des phénotypes à partir des marqueurs On passe à une étape de validation de l équation sur P. On utilise cette équation pour obtenir les scores d index génomique de candidats C à la sélection par exemple à la naissance! P P C

23 Impact sur la diversité Il faut savoir que la SG peut être bien ou mal utilisée Impact sur la diversité a priori favorable : Minimisation du poids de l information familiale, minimisation de la diffusion des reproducteurs dit «d élite». Par conséquent : on obtient un grand nombre de reproducteurs «efficaces». On pourrait arriver à un «turn-over» rapides des taureaux (au bout d 1 an? De doses produites?).

24 Grande dimension Les puces contiennent l information de marqueurs mais la nouvelle puce bovine sortie en septembre comprend marqueurs. La sélection génomique nécessite une population de référence de plusieurs milliers d animaux (de 4000 à 8000 actuellement). On veut être capable d étudier d autres types d intéractions : Epistasie (comprendre les interactions entre gènes) Epigénétique (comprendre les régulations de l expression des gènes).

25 Grande dimension Nécessité d adaptation matérielle et logicielle face à ces masses de données. Il devient aujourd hui difficile de faire tourner des analyses marqueurs par marqueurs (temps de calcul +++ ).

26 Adaptation matérielle Plusieurs solutions existent : utilisation de Cluster de calcul utilisation de grille de calcul. Il est nécessaire d adapter les logiciels pour le déploiement sur ce type d architecture (Parallélisation ). Des solutions plus exploratoires : le GPU.

27 Adaptation logicielle & méthodologique Les approches Bayésiennes : Bayesian mapping : Chaine de Markov, stochastic search variable selection, shrinkage analysis Combiner méthodologies statistiques et algorithmes d optimisations.

28 Conclusion D énormes progrès techniques ces dernières années. Les enjeux : La bio-informatique, la bio-statistique et le développement de méthodologies nouvelles : pour gérer et valoriser la masse de données générées. Au niveau des éleveurs : La récolte des phénotypes est un point critique : toujours nécessaires pour mesurer l effet des marqueurs : les phénotypes doivent être définis précisément.

29 Merci de votre attention

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle 2013. Journées Recherche Porcine, 45, 213-218. Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle Thierry TRIBOUT (1,2), Catherine LARZUL (1,2), Jean

Plus en détail

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Les questions biologiques auxquelles s intéresse l ITMO ont traditionnellement fait appel à la génétique, à la génétique des populations,

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010 Le GIE Elevage envoie aux partenaires GENIVAL une lettre d information sur l évolution de l outil et l offre en taureaux d élevage. Merci de la diffuser auprès de tous les techniciens et éleveurs de votre

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Première partie. Introduction Générale

Première partie. Introduction Générale Première partie Introduction Générale IX L amélioration des espèces cultivées a pour but de produire des variétés présentant des caractéristiques nouvelles pour des caractères d intérêt agronomique (création

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Une population est un ensemble d individus de la même espèce se reproduisant

Une population est un ensemble d individus de la même espèce se reproduisant V. EFFETS DES REGIMES DE REPRODUCTION La moyenne et la variance des caractères quantitatifs peuvent dépendre de la manière dont les géniteurs sont utilisés, au sein d une population donnée ou entre populations.

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008),

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), G F εn I ε R GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), Mesures phénotypiques et étude du polymorphisme de gènes candidats de QTL de fertilité femelle en race Prim Holstein Patrice HUMBLOT 1, Yves AMIGUES

Plus en détail

Incidence technico-économique des maladies pulmonaires

Incidence technico-économique des maladies pulmonaires N 69 Novembre 2009 Incidence technico-économique des maladies pulmonaires Cette étude, menée par l Ifip et l Afssa, a pour objectif d évaluer l impact des lésions pulmonaires sur les résultats économiques

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht Actualités sur la sélection des pondeuses Prospections futures Dr. Matthias Schmutz, Lohmann Tierzucht Alimentation et démographie mondiale Augmentation annuelle de 80 millions Croissance surtout dans

Plus en détail

Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale»

Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale» Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale» Amasgen : Approches Méthodologiques et Applications de la Sélection GENomique chez les bovins laitiers CapSeqAn

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Le chercheur responsable, en collaboration avec le personnel technique de

Le chercheur responsable, en collaboration avec le personnel technique de Direction des services vétérinaires Procédure normalisée de fonctionnement Objet : Gestion des colonies internes de souris Numéro : RE-1 Portée : Ceci est une directive de la Direction des services vétérinaires

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Genomics. Analytics adaptés aux jeux de données les plus volumineux.

Genomics. Analytics adaptés aux jeux de données les plus volumineux. FICHE PRODUIT JMP Genomics Découvrez les caractéristiques biologiques des données génomiques grâce à deux références en matière de logiciels d analyse : SAS et JMP. Qu est-ce que JMP Genomics? JMP Genomics

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

L INSTITUT DE RECHERCHE EN

L INSTITUT DE RECHERCHE EN 1 L INSTITUT DE RECHERCHE EN IMMUNOLOGIE ET EN CANCÉROLOGIE COMMERCIALISATION DE LA RECHERCHE VISION Être un centre reconnu internationalement pour ses activités de maximisation de la valeur de la recherche

Plus en détail

UNITE ET DIVERSITE DES ËTRES HUMAINS

UNITE ET DIVERSITE DES ËTRES HUMAINS UNITE ET DIVERSITE DES ËTRES HUMAINS Rappels : - organisation du corps humain - La fécondation L HEREDITE ET SON SUPPORT Chaque individu possède des ressemblances et des différences même au sein d une

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Élevage Le bénéfice des Systèmes d information et des technologies numériques

Élevage Le bénéfice des Systèmes d information et des technologies numériques 10:07 Page 29 Élevage Le bénéfice des Systèmes d information et des technologies numériques Les Systèmes d information (SI) d élevage répondent aux besoins de l «entreprise élevage» au sens large. Cette

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Les faits sur la semence ABS SEXATION

Les faits sur la semence ABS SEXATION Les faits sur la semence ABS SEXATION La procédure de sexage La semence sexée est produite en utilisant la technologie de la cytomètrie en flux qui permet de trier les cellules X (femelle) des cellules

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

L UTILISATION EN ELEVAGE DES GENES IDENTIFIES ET DES CARACATERES A DETERMINISME SIMPLE

L UTILISATION EN ELEVAGE DES GENES IDENTIFIES ET DES CARACATERES A DETERMINISME SIMPLE III. L UTILISATION EN ELEVAGE DES GENES IDENTIFIES ET DES CARACATERES A DETERMINISME SIMPLE A. Définition et aperçu historique Les caractères à déterminisme génétique simple sont des caractères pour lesquels

Plus en détail

IV. La ressemblance entre apparentés

IV. La ressemblance entre apparentés IV. La ressemblance entre apparentés La ressemblance entre apparentés est un phénomène de constatation courante chez l homme. Cependant, les proverbes «tel père, tel fils» et «à père avare, fils prodigue»

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/

Introduction, présentation de la plateforme South Green. hp://southgreen.cirad.fr/ Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/ SupAgro, Montpellier, 10 février 2014 Le déluge de données NGS Next-generation sequencing Rappel: synthèse de l ADN 5

Plus en détail

Journée de formation Bioinformatique (24 nov. 2005)

Journée de formation Bioinformatique (24 nov. 2005) Centre Intégré de Bioinformatique de Lille Journée de formation Bioinformatique (24 nov. 2005) "Stockage, gestion et analyse des données de transcriptomiques issues d'expériences de puces à ADN par l'utilisation

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

STATION 1A Plateforme de séquençage de nouvelle génération

STATION 1A Plateforme de séquençage de nouvelle génération STATION 1A Plateforme de séquençage de nouvelle génération Dr JACQUES SIMARD Le mandat de cette plateforme est d offrir l expertise à la fine pointe de la technologie afin de générer des données de séquence

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY Yvan Le Bras yvan.le_bras@irisa.fr Cyril Monjeaud, Mathieu Bahin, Claudia Hériveau, Olivier Quenez, Olivier Sallou, Aurélien Roult, Olivier

Plus en détail

Ingénieur R&D en bio-informatique

Ingénieur R&D en bio-informatique Ingénieur R&D en bio-informatique Spécialisé Bases De Données 33 ans, Célibataire. Biologie & Informatique gabriel.chandesris[at]laposte.net {06 56 41 97 37} Use the bipper! http://gabriel.chandesris.free.fr/

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE

MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE RÉSUMÉ DE LA FORMATION Type de diplôme : Master (LMD) Domaine ministériel : Sciences, Technologies, Santé Mention : BIOLOGIE SANTE Spécialité

Plus en détail

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 ETABLISSEMENT : UM2 COMPOSANTE : Faculté des Sciences SITE : Campus Triolet IDENTIFICATION DU POSTE : N : Corps : Section CNU : 67 Nature demandée : Maître de Conférence

Plus en détail

Collecte et gestion de l information zootechnique

Collecte et gestion de l information zootechnique Collecte et gestion de l information zootechnique Erik Rehben (Responsable Systèmes d Information & Traçabilité Animale - Institut de l Elevage) Points abordés Seulement les ruminants, ni les porcins ni

Plus en détail

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique Objectifs Clustering On ne sait pas ce qu on veut trouver : on laisse l algorithme nous proposer un modèle. On pense qu il existe des similarités entre les exemples. Qui se ressemble s assemble p. /55

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

EXTRAIT DE L ALMANACH 2003. Bertrand Jordan

EXTRAIT DE L ALMANACH 2003. Bertrand Jordan GROBIOSCIENCES EXTRAIT DE L ALMANACH 2003 CHATTE SUR UN THÈME BRÛLANT (LES DÉBUTS DU CLONAGE RÉCRÉATIF) Bertrand Jordan Edité par la Mission Agrobiosciences, avec le soutient du Sicoval, communauté d agglomération

Plus en détail

Premières estimations pour 2014 Le revenu agricole réel par actif en baisse de 1,7% dans l UE28

Premières estimations pour 2014 Le revenu agricole réel par actif en baisse de 1,7% dans l UE28 194/2014-15 décembre 2014 Premières estimations pour 2014 Le revenu agricole réel par actif en baisse de 1,7% dans l UE28 Par rapport à 2013, le revenu agricole réel par actif 1 a diminué de 1,7% dans

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Fouille de données orientée motifs, méthodes et usages.

Fouille de données orientée motifs, méthodes et usages. Fouille de données orientée motifs, méthodes et usages. François RIOULT GREYC - Équipe Données-Documents-Langues CNRS UMR 6072 Université de Caen Basse-Normandie France Résumé La fouille de données orientée

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

Lettre d information N 3 Juin 2015

Lettre d information N 3 Juin 2015 Lettre d information N 3 Juin 2015 Au sommaire Tour d horizon d AMAIZING en 2014 p. 2 Zoom sur quelques résultats et faits marquants : Effet de la sélection moderne sur la diversité génétique chez le maïs

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Gene Predictis parce que je suis unique

Gene Predictis parce que je suis unique Gene Predictis parce que je suis unique Route de Chantemerle 64 - CP 160 - CH-1763 Granges-Paccot Téléphone: +41 26 466 15 45 Fax: +41 26 466 15 46 info@genepredictis.com www.genepredictis.com Gene Predictis

Plus en détail

Biotechnologies chez le lapin

Biotechnologies chez le lapin La partie de l'image avec l'id de relation rid4 n'a pas été trouvé dans le fichier. 24/10/2012 Biotechnologies chez le lapin Thierry JOLY & Marielle AFANASSIEFF GFPC 23/10/2012 Pourquoi le lapin? Elevage:

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique Rapport de stage de deuxième année de DUT Génie Biologique option Bioinformatique Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes

Plus en détail

Apathie, profil actimétrique nocturne et gènes de l horloge biologique. Plan:

Apathie, profil actimétrique nocturne et gènes de l horloge biologique. Plan: Apathie, profil actimétrique nocturne et gènes de l horloge biologique CMRR Nice Emmanuel Mulin mulin.e@chu-nice.fr Plan: Préambule Apathie et maladie d Alzheimer Sommeil et maladie d Alzheimer Données

Plus en détail

Chapitre 3 bis. Sanitel

Chapitre 3 bis. Sanitel Chapitre 3 bis Sanitel Le système belge pour l Identification et l enregistrement des animaux. Associations régionales ARSIA : association régionale de santé et d identification animale http://www.arsia.be/

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

Réunion du réseau de génétique du Département EFPA

Réunion du réseau de génétique du Département EFPA 17 19 novembre 2014 Centre INRA de Nancy Lorraine Programme Lundi 17 novembre Salle Tilleul 13:00 Bus pour l'inra depuis la gare de Nancy 14:00 14:30 Introduction de la réunion tour de table 14:30 14:45

Plus en détail

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Partie 1, Chapitre 4 INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Constat : à l'exception des jumeaux, chaque individu est unique. Ses caractères héréditaires dependent des info génétiques (allèles) portées

Plus en détail

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011)

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011) UP-CNV 2.0 Banque de données en ligne répertoriant les CNVs (Copy Number Variations) identifiés par CGH-array chez les patients atteints de retard mental, anomalie du développement 2.0 Projet financé par

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Laboratoire d informatique Gaspard-Monge UMR 8049. Journée Labex Bézout- ANSES

Laboratoire d informatique Gaspard-Monge UMR 8049. Journée Labex Bézout- ANSES Laboratoire d informatique Gaspard-Monge UMR 8049 Journée Labex Bézout- ANSES Présentation du laboratoire 150 membres, 71 chercheurs et enseignants-chercheurs, 60 doctorants 4 tutelles : CNRS, École des

Plus en détail

Valeur fertilisante azotée des produits résiduaires organiques (PRO) : mieux prendre en compte la dynamique de la fourniture d azote

Valeur fertilisante azotée des produits résiduaires organiques (PRO) : mieux prendre en compte la dynamique de la fourniture d azote Valeur fertilisante azotée des produits résiduaires organiques (PRO) : mieux prendre en compte la dynamique de la fourniture d azote BOUTHIER Alain 1, TROCHARD Robert 2, PARNAUDEAU Virginie 3, NICOLARDOT

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Projet ANR SAMOGWAS. Specific Advanced MOdels for Genome-wide Association Studies. Journée de lancement officielle. Nantes - vendredi 11 octobre 2013

Projet ANR SAMOGWAS. Specific Advanced MOdels for Genome-wide Association Studies. Journée de lancement officielle. Nantes - vendredi 11 octobre 2013 Projet ANR SAMOGWAS Specific Advanced MOdels for Genome-wide Association Studies Journée de lancement officielle Nantes - vendredi 11 octobre 2013 1 Les partenaires LINA Nantes GIGA-R Liège INSERM Nantes

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol Lionel RANJARD, Samuel Dequiedt, Pierre-Alain Maron, Anne-Laure Blieux. UMR Agroécologie-plateforme

Plus en détail

Intérêt des recherches génétiques

Intérêt des recherches génétiques Intérêt du chien dans la pathologie et la génétique comparée: exemples de maladies et de gènes partagées entre l'homme et le chien Dr. Catherine André candre@univ-rennes1.fr Intérêt des recherches génétiques

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

I/ L information génétique se trouve dans les chromosomes du noyau.

I/ L information génétique se trouve dans les chromosomes du noyau. Chapitre 2 : localisation et organisation de l information génétique Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Statistique en grande dimension pour les données génomiques

Statistique en grande dimension pour les données génomiques Statistique en grande dimension pour les données génomiques Franck Picard UMR CNRS-5558, Laboratoire de Biométrie et Biologie Evolutive franck.picard@univ-lyon1.fr January 10, 2014 F. Picard, 1/90 Outline

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

1 les caractères des êtres humains.

1 les caractères des êtres humains. Quelques rappels des classes précédentes ACTIVITÉ livre pages 8 et 9 : apprendre le bilan de la page 9 Les êtres vivants sont répartis en espèces. Chaque être vivant est formé de cellules. schéma d une

Plus en détail

La Performance Digitale en Business to Business

La Performance Digitale en Business to Business La Performance Digitale en Business to Business En quoi la performance digitale B2B et son optimisation, est-elle différente d une stratégie digitale B2C? Florent Bourc his - Marketing Stratégique - 2015

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité

Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité Au sein d une espèce, la diversité entre les individus a pour origine les mutations, sources de création de nouveaux allèles,

Plus en détail