Gènes Diffusion - EPIC 2010

Dimension: px
Commencer à balayer dès la page:

Download "Gènes Diffusion - EPIC 2010"

Transcription

1

2 Gènes Diffusion - EPIC Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses et applications en animal. 7. Gestion des données de grandes dimensions.

3 La société Gènes Diffusion Un groupe coopératif international. Création, production et diffusion de la génétique animale. Reproduction assistée dans 4 espèces : Bovins Porcins Lapins Equins

4 USA Minesota Gènes Diffusion - international Madison 310 places Madison EUROPE CHINE Wisconsin Michigan Ommen Iowa Indianapolis 100 places Illinois Indiana Ohio Ostende Pologne Beijing Pologne 150 places Bureau Slovaquie 3 places Génisses Porcs Taureaux Roumanie 3 places Tchéquie 15 places Lleida 120 places Lleida Hongrie 20 places

5 Notions de génétique animale D une génération à l autre : sans aucune sélection. Pas d évolution génétique.

6 Notions de génétique animale Représentation d une étape de sélection. Evolution génétique sur les descendants.

7 Notions de génétique animale Aide à la sélection : AVANT L ADN : Sélection avec les mesures phénotypiques des animaux. AVEC l ADN : Sélection grâce à la génétique des animaux (avec parfois validation avec les données phénotypiques). Objectifs : Mettre à la disposition des filières un type d animaux adaptés à leurs besoins en exploitant des différences d origines génétiques. Moyens : Développement d outils et de techniques susceptibles d entraîner un progrès génétique. La plateforme génomique de Gènes Diffusion.

8 L équipe de la plateforme génomique 1 Manager 1 ingénieur en génétique animale (+1 doctorant) 1 ingénieur biomoléculaire 1 ingénieur en bioinformatique (+ 1 doctorant) 1 technicien de laboratoire 1 consultant en statistique et génétique quantitative Laboratoire transcriptomique et génomique appliquée

9 Les données animales : les phénotypes Nous possédons de grandes bases de données contenant : des informations mesurées sur nos animaux (les traits) : mesure de la production de lait pour les vaches poids des animaux, taille des jambons des informations sur la généalogie de ces animaux.

10 Les données génomiques Rappel : La génomique c est la discipline qui étudie les génomes (ensemble du matériel génétique d un individu ou d une espèce). Point de départ : Le séquençage du génome bovin et porcin. A G T C

11 Les données génomiques Le génotypage : c est une application du séquençage. Cette technologie est utilisable grâce à l augmentation spectaculaire du nombre de marqueurs disponibles. A A T T G G C C T T A C

12 Les données génomiques Dans notre laboratoire : utilisation des puces porcines marqueurs et des puces bovines marqueurs.

13 Les données génomiques A quoi cela ressemble informatiquement?

14 L objectif général ANIMAUX (avec Généalogie) GENOTYPES Analyse (QTL mapping, sélection génomique ) RESULTS

15 Environnement matériel et logiciel Le minimum pour la gestion de fichiers génotypes et phénotypes : Un logiciel pour la gestion des échantillons biologiques LIMS : laboratory information management system. Sauvegarde/Archivage Des données : 2 serveurs à l IPL et à Gènes Diffusion.

16 Environnement logiciel RESULTATS GENOTYPES INDIVIDUS AVEC MESURES PHENOTYPIQUES PLINK Perl Formatage des données pour l analyse Contrôle Qualité des échantillons et des marqueurs (MAF, HWE ) ENVIRONNEMENT BIOINFORMATIQUE Construction du/des score(s) : Correction phénotypique (prise en compte de l âge, du sexe, du centre d appartenance) Environnement logiciel s fonctionnel : Construction d haplotypes Analyse QTL Déploiement sur architecture parallèle Résultats et rapport graphique

17 L analyse et l application en animal

18 La recherche de QTL QTL : Quantitative Trait Locus. Locus, une région du génome ne correspond pas forcément à un seul gène, peut impliquer plusieurs gènes. Les polymorphismes (tels que les SNPs) sur une région QTL sont une des causes de variation phénotypiques d un trait quantitatif.

19 Les objectives d une analyse QTL 1. Identifier des régions du génome contenant des QTL. 2. Estimer les effets de ce QTL sur notre trait : Quantifier en quoi la variation du trait est causée par cette region spécifique. Quel allèle de notre SNPs est associé avec un effet favorable? 3. Utilisation du QTL et des informations génétiques pour assigner des scores d index à nos animaux.

20 Utilisation des QTLs L ensemble des QTLs pour un trait donné (exemple : longévité,vitalités à la naissance ) est utilisé pour évaluer génétiquement nos animaux. Le modèle génétique se décompose comme tel : Gi : Ui : Hij1 : Hij2 : la valeur génétique. la composante polygénique : les gènes non suivis par nos marqueurs. l effet du QTLs paternels. l effet de QTLs maternels.

21 La sélection génomique (sg) Une évolution par rapport à l analyse QTLs. Utilisation, de façon optimale, les dernières technologies de génotypages (puce à haute-densité de marqueurs). Prédire la valeur génétique d un animal à partir de l ensemble des informations de son génome : à la naissance sur un embryon. Pour simplifier, on part du postulat de base que chaque marqueur est un QTL, et on calcule les effets de chaque marqueur pour obtenir la valeur génétique de l animal.

22 La sg : principe de base Publiée par Meuwissen et Goddard (2001, Genetics 157:1819). A partir d une population de référence P + P : quelques milliers d animaux avec génotypes (ex : puce à ) et phénotypes Grâce à une partie de P et P, on établit une équation de prédiction des phénotypes à partir des marqueurs On passe à une étape de validation de l équation sur P. On utilise cette équation pour obtenir les scores d index génomique de candidats C à la sélection par exemple à la naissance! P P C

23 Impact sur la diversité Il faut savoir que la SG peut être bien ou mal utilisée Impact sur la diversité a priori favorable : Minimisation du poids de l information familiale, minimisation de la diffusion des reproducteurs dit «d élite». Par conséquent : on obtient un grand nombre de reproducteurs «efficaces». On pourrait arriver à un «turn-over» rapides des taureaux (au bout d 1 an? De doses produites?).

24 Grande dimension Les puces contiennent l information de marqueurs mais la nouvelle puce bovine sortie en septembre comprend marqueurs. La sélection génomique nécessite une population de référence de plusieurs milliers d animaux (de 4000 à 8000 actuellement). On veut être capable d étudier d autres types d intéractions : Epistasie (comprendre les interactions entre gènes) Epigénétique (comprendre les régulations de l expression des gènes).

25 Grande dimension Nécessité d adaptation matérielle et logicielle face à ces masses de données. Il devient aujourd hui difficile de faire tourner des analyses marqueurs par marqueurs (temps de calcul +++ ).

26 Adaptation matérielle Plusieurs solutions existent : utilisation de Cluster de calcul utilisation de grille de calcul. Il est nécessaire d adapter les logiciels pour le déploiement sur ce type d architecture (Parallélisation ). Des solutions plus exploratoires : le GPU.

27 Adaptation logicielle & méthodologique Les approches Bayésiennes : Bayesian mapping : Chaine de Markov, stochastic search variable selection, shrinkage analysis Combiner méthodologies statistiques et algorithmes d optimisations.

28 Conclusion D énormes progrès techniques ces dernières années. Les enjeux : La bio-informatique, la bio-statistique et le développement de méthodologies nouvelles : pour gérer et valoriser la masse de données générées. Au niveau des éleveurs : La récolte des phénotypes est un point critique : toujours nécessaires pour mesurer l effet des marqueurs : les phénotypes doivent être définis précisément.

29 Merci de votre attention

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit La génétique, pari gagnant le pour pari produire gagnant du pour lait produire à un coût maîtrisé du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique

Plus en détail

L aventure génétique, Le cas du lapin

L aventure génétique, Le cas du lapin Histoire de lapins... Le lapin européen (Oryctolagus Cuniculus) De la Renaissance au XIXème siècle : Des élevages de production apparaissent (Olivier de Serres), les lapins sont élevés en clapier et les

Plus en détail

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE Fronts de science Philippe Monget Directoire Opérationnel d AGENAE Sélection génomique Genome Wide Association Succès, échecs, polémique Missing heritability Epistasie Epigénétique Phénotypage La nutrigénomique

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Les questions biologiques auxquelles s intéresse l ITMO ont traditionnellement fait appel à la génétique, à la génétique des populations,

Plus en détail

La génomique fonctionnelle

La génomique fonctionnelle Marc Noël, B.Sc. Agr. Chargé de comptes principal Merial Canada Inc. Journée bovine de l Estrie 2006 25 novembre 2006 All animals are equal but some animals are more equal than others. George Orwell -

Plus en détail

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle 2013. Journées Recherche Porcine, 45, 213-218. Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle Thierry TRIBOUT (1,2), Catherine LARZUL (1,2), Jean

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010 Le GIE Elevage envoie aux partenaires GENIVAL une lettre d information sur l évolution de l outil et l offre en taureaux d élevage. Merci de la diffuser auprès de tous les techniciens et éleveurs de votre

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

Analyse des données génétiques : approches. Christophe LALANNE 13 novembre 2009

Analyse des données génétiques : approches. Christophe LALANNE 13 novembre 2009 Analyse des données génétiques : approches univariées, multivariées et perspectives biomédicales Christophe LALANNE 13 novembre 2009 Plan de l exposé Type de données et enjeux épidémiologiques Approche

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Leroy G. 1,2, Danchin-Burge C. 3, Verrier E. 1,2

Leroy G. 1,2, Danchin-Burge C. 3, Verrier E. 1,2 Innovations Agronomiques 29 (2013), 75-83 Faire face à de nouveaux enjeux : re-diversifier des ressources génétiques? Impacts de la réintroduction de ressources cryoconservées dans un programme de sélection

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Les défis de la Bioinformatique:

Les défis de la Bioinformatique: Les défis de la Bioinformatique: Une introduction à la Journée du 19 octobre Marie-Paule LEFRANC Journées du CINES 19-21 octobre 2004 organisées par Laetitia Regnier Importance des facteurs génétiques

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Première partie. Introduction Générale

Première partie. Introduction Générale Première partie Introduction Générale IX L amélioration des espèces cultivées a pour but de produire des variétés présentant des caractéristiques nouvelles pour des caractères d intérêt agronomique (création

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI Centre de Jouy-en-Josas 5 février 2015 SOMMAIRE Unité GABI : Génétique Animale et Biologie Intégrative Présentation Générale Projets marquants

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER Forum TERATEC Vincent Frouin Déluge de données S Laguitton (CATI-CEA) B damota (INRIA-CEA) 28 JUIN 202 28 JUIN 202 CEA

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Structuration du séquençage de nouvelle génération à visée diagnostique en cancérologie

Structuration du séquençage de nouvelle génération à visée diagnostique en cancérologie Appel à projets 2013 Structuration du séquençage de nouvelle génération à visée diagnostique en cancérologie Action 21 Soumission en ligne: http://www.e-cancer.fr/aap/recherche/ngs2013 Date limite: 2 juillet

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008),

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), G F εn I ε R GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), Mesures phénotypiques et étude du polymorphisme de gènes candidats de QTL de fertilité femelle en race Prim Holstein Patrice HUMBLOT 1, Yves AMIGUES

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale»

Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale» Présentation des projets financés au titre de l édition 2008 du Programme «Génomique animale» Amasgen : Approches Méthodologiques et Applications de la Sélection GENomique chez les bovins laitiers CapSeqAn

Plus en détail

Une population est un ensemble d individus de la même espèce se reproduisant

Une population est un ensemble d individus de la même espèce se reproduisant V. EFFETS DES REGIMES DE REPRODUCTION La moyenne et la variance des caractères quantitatifs peuvent dépendre de la manière dont les géniteurs sont utilisés, au sein d une population donnée ou entre populations.

Plus en détail

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Alexia AUBRY IFIP-Institut du porc «L accès aux données pour la recherche & l innovation» Workshop ACTA 8 octobre

Plus en détail

ET La CLASSIFICATION I/ ENUMERATION DES CRITERES

ET La CLASSIFICATION I/ ENUMERATION DES CRITERES Les CRITÈRES DE SELECTION en race AUBRAC ET La CLASSIFICATION des ANIMAUX I/ ENUMERATION DES CRITERES Les différents critères de sélection pris en compte en race Aubrac peuvent être répartis en 3 groupes

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Genomics. Analytics adaptés aux jeux de données les plus volumineux.

Genomics. Analytics adaptés aux jeux de données les plus volumineux. FICHE PRODUIT JMP Genomics Découvrez les caractéristiques biologiques des données génomiques grâce à deux références en matière de logiciels d analyse : SAS et JMP. Qu est-ce que JMP Genomics? JMP Genomics

Plus en détail

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY Yvan Le Bras yvan.le_bras@irisa.fr Cyril Monjeaud, Mathieu Bahin, Claudia Hériveau, Olivier Quenez, Olivier Sallou, Aurélien Roult, Olivier

Plus en détail

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht

Actualités sur la sélection des pondeuses Prospections futures. Dr. Matthias Schmutz, Lohmann Tierzucht Actualités sur la sélection des pondeuses Prospections futures Dr. Matthias Schmutz, Lohmann Tierzucht Alimentation et démographie mondiale Augmentation annuelle de 80 millions Croissance surtout dans

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Contributions à la Stratégie Nationale de Recherche ITMO Génétique, Génomique et Bioinformatique

Contributions à la Stratégie Nationale de Recherche ITMO Génétique, Génomique et Bioinformatique 1 Contributions à la Stratégie Nationale de Recherche ITMO Génétique, Génomique et Bioinformatique L ITMO Génétique, Génomique et Bioinformatique (GGB) vise à coordonner les efforts de recherche autour

Plus en détail

Incidence technico-économique des maladies pulmonaires

Incidence technico-économique des maladies pulmonaires N 69 Novembre 2009 Incidence technico-économique des maladies pulmonaires Cette étude, menée par l Ifip et l Afssa, a pour objectif d évaluer l impact des lésions pulmonaires sur les résultats économiques

Plus en détail

QUALVIVOL QUALité des VIandes de VOLailles

QUALVIVOL QUALité des VIandes de VOLailles QUALVIVOL QUALité des VIandes de VOLailles C. Berri, E. le Bihan-Duval (INRA, URA), F. Pitel (INRA, LGC) V. Sibut (URA, ITAVI) AGENAVI VII Colloque AGENAE-GENANIMAL Du 21 au 23 octobre 2009 Tours Approche

Plus en détail

L INSTITUT DE RECHERCHE EN

L INSTITUT DE RECHERCHE EN 1 L INSTITUT DE RECHERCHE EN IMMUNOLOGIE ET EN CANCÉROLOGIE COMMERCIALISATION DE LA RECHERCHE VISION Être un centre reconnu internationalement pour ses activités de maximisation de la valeur de la recherche

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

La résistance génétique des moutons aux strongles gastro-intestinaux

La résistance génétique des moutons aux strongles gastro-intestinaux La résistance génétique des moutons aux strongles gastro-intestinaux Académie Vétérinaire de France 18 décembre 2008 Jacquiet P., Barillet F., Bouix J. François D., Moreno C., Terefe G. INRA Départements

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Data Mining et Big Data

Data Mining et Big Data Data Mining et Big Data Eric Rivals LIRMM & Inst. de Biologie Computationnelle CNRS et Univ. Montpellier 14 novembre 2015 E. Rivals (LIRMM & IBC) Big Data 14 novembre 2015 1 / 30 Introduction, contexte

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Le concept de pharmacogénétique

Le concept de pharmacogénétique Le génome : avancées scientifiques et thérapeutiques et conséquences sociales The genome: scientific and therapeutic developments and social consequences 2002 Éditions scientifiques et médicales Elsevier

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement.

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Les gènes gouvernent la synthèse des protéines qui participent à la réalisation du phénotype mais d'autres éléments, comme

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Le chercheur responsable, en collaboration avec le personnel technique de

Le chercheur responsable, en collaboration avec le personnel technique de Direction des services vétérinaires Procédure normalisée de fonctionnement Objet : Gestion des colonies internes de souris Numéro : RE-1 Portée : Ceci est une directive de la Direction des services vétérinaires

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Des exemples concrets de valorisation de données

Des exemples concrets de valorisation de données L accès aux données pour la recherche & innovation» Workshop ACTA 8 Octobre 2015 Des exemples concrets de valorisation de données (problèmes rencontrés, solutions trouvées, valeur ajoutée du service...)

Plus en détail

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Ingénieur de recherche en bioinformatique Journée Min2RIEN - 06/12/2012 1

Plus en détail

Votre projet de formation Eleveur- pensionneur

Votre projet de formation Eleveur- pensionneur Votre projet de formation Eleveur- pensionneur 24 Rue du Château des Rentiers 75013 PARIS (France) Tel 01 83 64 05 99 AUDRECO FORMATION SA au capital de 38113 EUROS SIRET 39335113500024 CODE APE 8559A

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

UNITE ET DIVERSITE DES ËTRES HUMAINS

UNITE ET DIVERSITE DES ËTRES HUMAINS UNITE ET DIVERSITE DES ËTRES HUMAINS Rappels : - organisation du corps humain - La fécondation L HEREDITE ET SON SUPPORT Chaque individu possède des ressemblances et des différences même au sein d une

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

B/. 1 1 fr -I- 2 f", I! Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances

B/. 1 1 fr -I- 2 f, I! Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances NOTE Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances J.-L. FOULLEY C. CHEVALET LN.R.A., Station de Génétique quantitative et appliquée, Centre de Recherches

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2008 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR B CANDIDATS DES SECTEURS A ET C

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

STATION 1A Plateforme de séquençage de nouvelle génération

STATION 1A Plateforme de séquençage de nouvelle génération STATION 1A Plateforme de séquençage de nouvelle génération Dr JACQUES SIMARD Le mandat de cette plateforme est d offrir l expertise à la fine pointe de la technologie afin de générer des données de séquence

Plus en détail

Ingénieur R&D en bio-informatique

Ingénieur R&D en bio-informatique Ingénieur R&D en bio-informatique Spécialisé Bases De Données 33 ans, Célibataire. Biologie & Informatique gabriel.chandesris[at]laposte.net {06 56 41 97 37} Use the bipper! http://gabriel.chandesris.free.fr/

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

altitudinaux à l'aide de dispositifs de transplantation croisée

altitudinaux à l'aide de dispositifs de transplantation croisée Mesure du potentiel d'adaptation des arbres forestiers au changement climatique Approches in et ex situ sur gradients altitudinaux à l'aide de dispositifs de transplantation croisée GRAAL GICC 21 mai Paris

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Journée de formation Bioinformatique (24 nov. 2005)

Journée de formation Bioinformatique (24 nov. 2005) Centre Intégré de Bioinformatique de Lille Journée de formation Bioinformatique (24 nov. 2005) "Stockage, gestion et analyse des données de transcriptomiques issues d'expériences de puces à ADN par l'utilisation

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

PROGRAMME. de Sélection COllective de l'huître creuse, Crassostrea gigas, à des fins de Captage orienté (SCORE)

PROGRAMME. de Sélection COllective de l'huître creuse, Crassostrea gigas, à des fins de Captage orienté (SCORE) PROGRAMME de Sélection COllective de l'huître creuse, Crassostrea gigas, à des fins de Captage orienté (SCORE) I- OBJECTIFS DU PROGRAMME Le Comité National de la Conchyliculture a déposé le projet SCORE

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

La Performance Digitale en Business to Business

La Performance Digitale en Business to Business La Performance Digitale en Business to Business En quoi la performance digitale B2B et son optimisation, est-elle différente d une stratégie digitale B2C? Florent Bourc his - Marketing Stratégique - 2015

Plus en détail

résultats TechNico-écoNoMiques 2010 du réseau de références PorciN de MarTiNique Programme Posei france

résultats TechNico-écoNoMiques 2010 du réseau de références PorciN de MarTiNique Programme Posei france RÉSEAUX D ÉLEVAGE POUR LE CONSEIL ET LA PROSPECTIVE COLLECTION RÉSULTATS ANNUELS résultats TechNico-écoNoMiques 21 du réseau de références PorciN de MarTiNique Programme Posei france PORCINS les résultats

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Élevage Le bénéfice des Systèmes d information et des technologies numériques

Élevage Le bénéfice des Systèmes d information et des technologies numériques 10:07 Page 29 Élevage Le bénéfice des Systèmes d information et des technologies numériques Les Systèmes d information (SI) d élevage répondent aux besoins de l «entreprise élevage» au sens large. Cette

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Si les conditions physiques telles que l âge, les antécédents, mais aussi des facteurs sociaux, psychiques et culturels influencent

Plus en détail