Gènes Diffusion - EPIC 2010

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Gènes Diffusion - EPIC 2010"

Transcription

1

2 Gènes Diffusion - EPIC Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses et applications en animal. 7. Gestion des données de grandes dimensions.

3 La société Gènes Diffusion Un groupe coopératif international. Création, production et diffusion de la génétique animale. Reproduction assistée dans 4 espèces : Bovins Porcins Lapins Equins

4 USA Minesota Gènes Diffusion - international Madison 310 places Madison EUROPE CHINE Wisconsin Michigan Ommen Iowa Indianapolis 100 places Illinois Indiana Ohio Ostende Pologne Beijing Pologne 150 places Bureau Slovaquie 3 places Génisses Porcs Taureaux Roumanie 3 places Tchéquie 15 places Lleida 120 places Lleida Hongrie 20 places

5 Notions de génétique animale D une génération à l autre : sans aucune sélection. Pas d évolution génétique.

6 Notions de génétique animale Représentation d une étape de sélection. Evolution génétique sur les descendants.

7 Notions de génétique animale Aide à la sélection : AVANT L ADN : Sélection avec les mesures phénotypiques des animaux. AVEC l ADN : Sélection grâce à la génétique des animaux (avec parfois validation avec les données phénotypiques). Objectifs : Mettre à la disposition des filières un type d animaux adaptés à leurs besoins en exploitant des différences d origines génétiques. Moyens : Développement d outils et de techniques susceptibles d entraîner un progrès génétique. La plateforme génomique de Gènes Diffusion.

8 L équipe de la plateforme génomique 1 Manager 1 ingénieur en génétique animale (+1 doctorant) 1 ingénieur biomoléculaire 1 ingénieur en bioinformatique (+ 1 doctorant) 1 technicien de laboratoire 1 consultant en statistique et génétique quantitative Laboratoire transcriptomique et génomique appliquée

9 Les données animales : les phénotypes Nous possédons de grandes bases de données contenant : des informations mesurées sur nos animaux (les traits) : mesure de la production de lait pour les vaches poids des animaux, taille des jambons des informations sur la généalogie de ces animaux.

10 Les données génomiques Rappel : La génomique c est la discipline qui étudie les génomes (ensemble du matériel génétique d un individu ou d une espèce). Point de départ : Le séquençage du génome bovin et porcin. A G T C

11 Les données génomiques Le génotypage : c est une application du séquençage. Cette technologie est utilisable grâce à l augmentation spectaculaire du nombre de marqueurs disponibles. A A T T G G C C T T A C

12 Les données génomiques Dans notre laboratoire : utilisation des puces porcines marqueurs et des puces bovines marqueurs.

13 Les données génomiques A quoi cela ressemble informatiquement?

14 L objectif général ANIMAUX (avec Généalogie) GENOTYPES Analyse (QTL mapping, sélection génomique ) RESULTS

15 Environnement matériel et logiciel Le minimum pour la gestion de fichiers génotypes et phénotypes : Un logiciel pour la gestion des échantillons biologiques LIMS : laboratory information management system. Sauvegarde/Archivage Des données : 2 serveurs à l IPL et à Gènes Diffusion.

16 Environnement logiciel RESULTATS GENOTYPES INDIVIDUS AVEC MESURES PHENOTYPIQUES PLINK Perl Formatage des données pour l analyse Contrôle Qualité des échantillons et des marqueurs (MAF, HWE ) ENVIRONNEMENT BIOINFORMATIQUE Construction du/des score(s) : Correction phénotypique (prise en compte de l âge, du sexe, du centre d appartenance) Environnement logiciel s fonctionnel : Construction d haplotypes Analyse QTL Déploiement sur architecture parallèle Résultats et rapport graphique

17 L analyse et l application en animal

18 La recherche de QTL QTL : Quantitative Trait Locus. Locus, une région du génome ne correspond pas forcément à un seul gène, peut impliquer plusieurs gènes. Les polymorphismes (tels que les SNPs) sur une région QTL sont une des causes de variation phénotypiques d un trait quantitatif.

19 Les objectives d une analyse QTL 1. Identifier des régions du génome contenant des QTL. 2. Estimer les effets de ce QTL sur notre trait : Quantifier en quoi la variation du trait est causée par cette region spécifique. Quel allèle de notre SNPs est associé avec un effet favorable? 3. Utilisation du QTL et des informations génétiques pour assigner des scores d index à nos animaux.

20 Utilisation des QTLs L ensemble des QTLs pour un trait donné (exemple : longévité,vitalités à la naissance ) est utilisé pour évaluer génétiquement nos animaux. Le modèle génétique se décompose comme tel : Gi : Ui : Hij1 : Hij2 : la valeur génétique. la composante polygénique : les gènes non suivis par nos marqueurs. l effet du QTLs paternels. l effet de QTLs maternels.

21 La sélection génomique (sg) Une évolution par rapport à l analyse QTLs. Utilisation, de façon optimale, les dernières technologies de génotypages (puce à haute-densité de marqueurs). Prédire la valeur génétique d un animal à partir de l ensemble des informations de son génome : à la naissance sur un embryon. Pour simplifier, on part du postulat de base que chaque marqueur est un QTL, et on calcule les effets de chaque marqueur pour obtenir la valeur génétique de l animal.

22 La sg : principe de base Publiée par Meuwissen et Goddard (2001, Genetics 157:1819). A partir d une population de référence P + P : quelques milliers d animaux avec génotypes (ex : puce à ) et phénotypes Grâce à une partie de P et P, on établit une équation de prédiction des phénotypes à partir des marqueurs On passe à une étape de validation de l équation sur P. On utilise cette équation pour obtenir les scores d index génomique de candidats C à la sélection par exemple à la naissance! P P C

23 Impact sur la diversité Il faut savoir que la SG peut être bien ou mal utilisée Impact sur la diversité a priori favorable : Minimisation du poids de l information familiale, minimisation de la diffusion des reproducteurs dit «d élite». Par conséquent : on obtient un grand nombre de reproducteurs «efficaces». On pourrait arriver à un «turn-over» rapides des taureaux (au bout d 1 an? De doses produites?).

24 Grande dimension Les puces contiennent l information de marqueurs mais la nouvelle puce bovine sortie en septembre comprend marqueurs. La sélection génomique nécessite une population de référence de plusieurs milliers d animaux (de 4000 à 8000 actuellement). On veut être capable d étudier d autres types d intéractions : Epistasie (comprendre les interactions entre gènes) Epigénétique (comprendre les régulations de l expression des gènes).

25 Grande dimension Nécessité d adaptation matérielle et logicielle face à ces masses de données. Il devient aujourd hui difficile de faire tourner des analyses marqueurs par marqueurs (temps de calcul +++ ).

26 Adaptation matérielle Plusieurs solutions existent : utilisation de Cluster de calcul utilisation de grille de calcul. Il est nécessaire d adapter les logiciels pour le déploiement sur ce type d architecture (Parallélisation ). Des solutions plus exploratoires : le GPU.

27 Adaptation logicielle & méthodologique Les approches Bayésiennes : Bayesian mapping : Chaine de Markov, stochastic search variable selection, shrinkage analysis Combiner méthodologies statistiques et algorithmes d optimisations.

28 Conclusion D énormes progrès techniques ces dernières années. Les enjeux : La bio-informatique, la bio-statistique et le développement de méthodologies nouvelles : pour gérer et valoriser la masse de données générées. Au niveau des éleveurs : La récolte des phénotypes est un point critique : toujours nécessaires pour mesurer l effet des marqueurs : les phénotypes doivent être définis précisément.

29 Merci de votre attention

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

L aventure génétique, Le cas du lapin

L aventure génétique, Le cas du lapin Histoire de lapins... Le lapin européen (Oryctolagus Cuniculus) De la Renaissance au XIXème siècle : Des élevages de production apparaissent (Olivier de Serres), les lapins sont élevés en clapier et les

Plus en détail

La Performance Digitale en Business to Business

La Performance Digitale en Business to Business La Performance Digitale en Business to Business En quoi la performance digitale B2B et son optimisation, est-elle différente d une stratégie digitale B2C? Florent Bourc his - Marketing Stratégique - 2015

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins

Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Les dispositifs de Gestion technique (GTTT) et technico-économique (GTE) des élevages porcins Alexia AUBRY IFIP-Institut du porc «L accès aux données pour la recherche & l innovation» Workshop ACTA 8 octobre

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010

Une offre de taureaux toujours en augmentation sur GENIVAL. Nombre de taureaux inscrits sur GENIVAL. novembre. mars 2011 mai 2011 2010 Le GIE Elevage envoie aux partenaires GENIVAL une lettre d information sur l évolution de l outil et l offre en taureaux d élevage. Merci de la diffuser auprès de tous les techniciens et éleveurs de votre

Plus en détail

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI

La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI Centre de Jouy-en-Josas 5 février 2015 SOMMAIRE Unité GABI : Génétique Animale et Biologie Intégrative Présentation Générale Projets marquants

Plus en détail

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce Année 2007-2008 Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce B. Monsuez Projet informatique «Voyageur de commerce» Résolution

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit

du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique De mon AteLier LAit La génétique, pari gagnant le pour pari produire gagnant du pour lait produire à un coût maîtrisé du lait à un coût maîtrisé un investissement rentable Pour AméLiorer DurAbLement Le résultat technico-économique

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

La génomique fonctionnelle

La génomique fonctionnelle Marc Noël, B.Sc. Agr. Chargé de comptes principal Merial Canada Inc. Journée bovine de l Estrie 2006 25 novembre 2006 All animals are equal but some animals are more equal than others. George Orwell -

Plus en détail

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service ASA-Advanced Solutions Accelerator Partenaire informatique des Laboratoires de Recherche 100lims Solution pour la gestion des données des laboratoires et des plateformes de service Parce que vous cherchez

Plus en détail

Chapitre 3 : conserver ou transmettre l information génétique.

Chapitre 3 : conserver ou transmettre l information génétique. Chapitre 3 : conserver ou transmettre l information génétique. Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Cisco Unified Business Attendant Console

Cisco Unified Business Attendant Console Cisco Unified Business Attendant Console Cisco Unified Communications est un système étendu de communications IP, d applications et de produits voix, vidéo, données et mobilité. Il rend les communications

Plus en détail

Ingénieur de recherche en statistique

Ingénieur de recherche en statistique Ingénieur de recherche en statistique E1D24 Statistique - IR Dans le cadre d une étude ou d un projet de recherche, l ingénieur de recherche en statistique conçoit le plan d analyse statistique et prend

Plus en détail

AfiFarm. L'outil fondamental pour la gestion de troupeau

AfiFarm. L'outil fondamental pour la gestion de troupeau AfiFarm L'outil fondamental pour la gestion de troupeau AfiFarm L'outil fondamental pour la gestion de troupeau Les éleveurs laitiers se trouvent aujourd'hui dans un environnement difficile et ont besoin

Plus en détail

www.bluestone.fr 55, rue du Faubourg Montmartre 75009 Paris +33 (0)1 53 35 02 10 contact@bluestone.fr

www.bluestone.fr 55, rue du Faubourg Montmartre 75009 Paris +33 (0)1 53 35 02 10 contact@bluestone.fr www.bluestone.fr 55, rue du Faubourg Montmartre 75009 Paris +33 (0)1 53 35 02 10 contact@bluestone.fr Une équipe de 120 Data Scientists, dont les compétences couvrent l intégralité du spectre d intervention

Plus en détail

Chef de projet ou expert systèmes informatiques, réseaux et télécommunications

Chef de projet ou expert systèmes informatiques, réseaux et télécommunications Chef de projet ou expert systèmes informatiques, réseaux et télécommunications E1C23 Systèmes informatiques, réseaux et télécommunications - IR Le chef de projet ou l expert systèmes informatiques, réseaux

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

Sommaire. 01 / Pourquoi choisir MGM? 02 / Nouveautés de la version 4.0. 03 / MGM - la solution base de données. 04 / Références. 05 / Conclusion.

Sommaire. 01 / Pourquoi choisir MGM? 02 / Nouveautés de la version 4.0. 03 / MGM - la solution base de données. 04 / Références. 05 / Conclusion. Sommaire 01 / Pourquoi choisir MGM? 02 / Nouveautés de la version 4.0. 03 / MGM - la solution base de données. 04 / Références. 05 / Conclusion. 06 / Contacts. Pourquoi choisir MGM 4.0? Pourquoi choisir

Plus en détail

Eco-conception de maisons à énergie positive

Eco-conception de maisons à énergie positive MEXICO Rencontres 2015, Clermont-Ferrand 06 octobre 2015 Eco-conception de maisons à énergie positive Mots-clés : Optimisation multicritère, algorithme génétique, fronts de Pareto Thomas RECHT : thomas.recht@mines-paristech.fr

Plus en détail

MANUEL QUALITÉ. Plate-forme Biopuces Toulouse. selon la norme ISO 9001 version 2008

MANUEL QUALITÉ. Plate-forme Biopuces Toulouse. selon la norme ISO 9001 version 2008 1 MANUEL QUALITÉ Plate-forme Biopuces Toulouse selon la norme ISO 9001 version 2008 135, avenue de Rangueil - 31077 TOULOUSE CEDEX 4 Tél. 05 61 55 96 87 - fax 05 61 55 94 00 http://biopuce.insa-toulouse.fr

Plus en détail

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES QUI SOMMES-NOUS? MEJT, dont le siège est basé à Champagne au Mont d Or (69) a été créée en 1994 par Gilles GUILLERME. A sa création, MEJT

Plus en détail

Ce certificat généalogique relatif à un bovin contient les indications conformes à celles du modèle suivant :

Ce certificat généalogique relatif à un bovin contient les indications conformes à celles du modèle suivant : Annexe CHAPITRE I er. Conditions zootechniques pour le taureau dont le sperme est collecté, traité ou stocké en qualité de sperme de bovin reproducteur de race pure dans un centre de collecte agréé A.

Plus en détail

Copyright 2006 Rockwell Automation, Inc. Tous droits réservés. Imprimé aux Etats-Unis.

Copyright 2006 Rockwell Automation, Inc. Tous droits réservés. Imprimé aux Etats-Unis. Publication EMSE00-BR371A-FR-E Avril 2006 Copyright 2006 Rockwell Automation, Inc. Tous droits réservés. Imprimé aux Etats-Unis. EXPERTISE EN GESTION DE PROJET VOUS POUVEZ COMPTER SUR DES SERVICES DE GESTION

Plus en détail

TerrOïko : JEU en collaboration avec la SEEM

TerrOïko : JEU en collaboration avec la SEEM TerrOïko : JEU en collaboration avec la SEEM Journée EcoInnovation et Biodiversité 21 mai 2014 - Contact: Catherine de Roincé, catherine.deroince@terroiko.fr Historique d une start-up issue de la recherche

Plus en détail

Outils Statistiques du Data Mining

Outils Statistiques du Data Mining Outils Statistiques du Data Mining Pr Roch Giorgi roch.giorgi@univ-amu.fr SESSTIM, Faculté de Médecine, Aix-Marseille Université, Marseille, France http://sesstim-orspaca.org http://optim-sesstim.univ-amu.fr

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Stratégie projet pour valoriser l'apport des technologies mobiles. Fréderic FADDA. Mobility GBS Leader, IBM

Stratégie projet pour valoriser l'apport des technologies mobiles. Fréderic FADDA. Mobility GBS Leader, IBM Stratégie projet pour valoriser l'apport des technologies mobiles Fréderic FADDA Mobility GBS Leader, IBM L introduction des technologies Mobiles, un accélérateur Business, Opérationnel et IT L introduction

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

L éco-conception entre donneur d ordres et PME ou comment changer nos habitudes dans l évaluation des technologies en aéronautique Projet CORINE

L éco-conception entre donneur d ordres et PME ou comment changer nos habitudes dans l évaluation des technologies en aéronautique Projet CORINE L éco-conception entre donneur d ordres et PME ou comment changer nos habitudes dans l évaluation des technologies en aéronautique Projet CORINE EcoMundo, Fangcun ZHOU 1 Présentation du Projet CORINE Conception

Plus en détail

RC SOFT. SaaS RC SOFT. / solution de gestion à la demande RC SOFT OUTILS D'ANALYSE ACCESSIBILITÉ GESTION DE LA TVA SAISIE & DONNÉES ÉDITIONS & EXPORT

RC SOFT. SaaS RC SOFT. / solution de gestion à la demande RC SOFT OUTILS D'ANALYSE ACCESSIBILITÉ GESTION DE LA TVA SAISIE & DONNÉES ÉDITIONS & EXPORT C O M P TA B I L I T É Le module - Comptabilité permet de tenir l ensemble de votre comptabilité, de la saisie d écritures au bilan. Vous pouvez partager l ensemble des données avec vos collaborateurs

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Audits Sécurité. Des architectures complexes

Audits Sécurité. Des architectures complexes Audits Sécurité Des architectures complexes L avènement d Internet et le développement des applications Intranet/Extranet ont permis aux entreprises d accroître leur compétitivité par l ouverture de leurs

Plus en détail

Management des processus opérationnels

Management des processus opérationnels Ecole Nationale Supérieure de Management Master Management des organisations Management des processus opérationnels Dr TOUMI Djamila Cours n 4: l approche processus et le management du système d informations

Plus en détail

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7 Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques Elec 2311 : S7 1 Plan du cours Qu est-ce l optimisation? Comment l optimisation s intègre dans la conception?

Plus en détail

Webinar EBG Nouvelles perspectives d'exploitation des données clients avec le big data

Webinar EBG Nouvelles perspectives d'exploitation des données clients avec le big data Webinar EBG Nouvelles perspectives d'exploitation des données clients avec le big data Approches & opportunités face aux enjeux de volume, variété et vélocité France, 2012-2014 28 mars 2013 Ce document

Plus en détail

Maximiser l efficacité de vos actifs, tout en diminuant votre investissement initial

Maximiser l efficacité de vos actifs, tout en diminuant votre investissement initial Maximiser l efficacité de vos actifs, tout en diminuant votre investissement initial Présenté par Stéphane Rioux et Laurent Garrigues, OSIsoft Francois Ruel, Hulix Déroulement Une évolution des besoins

Plus en détail

Créer de la valeur avec l Open Data

Créer de la valeur avec l Open Data Créer de la valeur avec l Open Data Des enjeux économiques majeurs Entre 106 et 141 par personne et par an Entre 387 et 640 par personne et par an (~les intérêts de la dette en France) Leviers pour créer

Plus en détail

SCI03 - Analyse de données expérimentales

SCI03 - Analyse de données expérimentales SCI03 - Analyse de données expérimentales Introduction à la statistique Thierry Denœux 1 1 Université de Technologie de Compiègne tél : 44 96 tdenoeux@hds.utc.fr Automne 2014 Qu est ce que la statistique?

Plus en détail

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5 LICENCE 3 2013-2014 Mention Biologie Parcours Génie Biologique et Informatique 1. Editorial du responsable La licence de BIOLOGIE se distingue par la richesse des enseignements dispensés dans les différents

Plus en détail

Présentation du logiciel Ludiscape

Présentation du logiciel Ludiscape Ludiscape se présente sous la forme d'une palette d'outils intégrée conçue pour créer du contenu de formation, du e-learning, du mobile-learning et des jeux sérieux. Ludiscape a été conçu comme une solution

Plus en détail

Section 9. Établissement de rapports et communication des résultats

Section 9. Établissement de rapports et communication des résultats Section 9 Établissement de rapports et communication des résultats 135 Établissement de rapports et communication des résultats Distribuer rapidement les résultats aux parties prenantes. Choisir le moyen

Plus en détail

CADARM 2014 LES NEWS

CADARM 2014 LES NEWS CADARM 2014 LES NEWS Remerciements! Ce document présente succinctement les principales nouveautés apportées à la nouvelle version CadARM 2014. Nous remercions tous nos clients, grâce auxquels cette version

Plus en détail

Analyse des images après lecture

Analyse des images après lecture http://transcriptome.ens.fr 1 Analyse des images après lecture Utilisation d un logiciel d analyse d image!: Sur la plate-forme de l ENS, nous avons choisi de travailler avec le logiciel GenePix Pro, vous

Plus en détail

FORMATION EN QUALITE-MÉTHODES NORMES ET SYSTEMES DE MANAGEMENT DE LA QUALITE

FORMATION EN QUALITE-MÉTHODES NORMES ET SYSTEMES DE MANAGEMENT DE LA QUALITE FORMATION EN QUALITE-MÉTHODES NORMES ET SYSTEMES DE MANAGEMENT DE LA QUALITE STRATEGIE, ORGANISATION ET MANAGEMENT D ENTREPRISE Page 2 FORMATION PERSONNALISEE Evaluation du besoin Ecoute de votre besoin

Plus en détail

Les identités du patient dans les profils IHE

Les identités du patient dans les profils IHE Les identités du patient dans les profils IHE 1 ère Journée Nationale de l Identito-Vigilance Besançon, 27 janvier 2009 François Macary - GMSIH Sommaire Positionnement et apports d IHE La gestion des identités

Plus en détail

Demande d attribution de ressources informatiques. Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis

Demande d attribution de ressources informatiques. Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis Demande d attribution de ressources informatiques Sur le Centre de Calculs Interactifs de l Université de Nice Sophia-Antipolis Titre du projet : Nom du laboratoire : Nom de l établissement hébergeur :

Plus en détail

Intégration de données multiéchelles pour caractériser la. qualité des fruits

Intégration de données multiéchelles pour caractériser la. qualité des fruits Intégration de données multiéchelles pour caractériser la qualité des fruits Workshop IN-OVIVE - PAFIA 02/07/2013 Julie Bourbeillon et François Vallée Contexte La pomme 1er fruit dans le panier de la ménagère

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Calatik, la vision métier et technique pour simplifier le pilotage du système d information

Calatik, la vision métier et technique pour simplifier le pilotage du système d information Calatik, la vision métier et technique pour simplifier le pilotage du système d information Le contexte : trop d outils, d écrans et de complexité Dans le domaine du pilotage du système d information,

Plus en détail

Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation. P. Faverdin INRA, UMR 1080 Production du lait

Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation. P. Faverdin INRA, UMR 1080 Production du lait Modèles dynamiques et outils d'aide à la décision, liens avec l'expérimentation P. Faverdin INRA, UMR 1080 Production du lait Un contexte à la recherche d outils pour aider à piloter les systèmes agricoles

Plus en détail

MÉTHODOLOGIE PROJET SYSTÈME D INFORMATION DÉCISIONNEL BI - BUSINESS INTELLIGENCE. En résumé :

MÉTHODOLOGIE PROJET SYSTÈME D INFORMATION DÉCISIONNEL BI - BUSINESS INTELLIGENCE. En résumé : En résumé : Phase I : collecte des besoins I - Expression des besoins II - Étude de faisabilité III - Définition des priorités IV - Rédaction puis validation du cahier des charges Phase II : implémentation

Plus en détail

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert

Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Développement multi-sites d'une application graphique J2SE pour l'analyse de données de biopuces «ace.map» Guillaume Brysbaert Ingénieur de recherche en bioinformatique Journée Min2RIEN - 06/12/2012 1

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

DON DONNÉES NÉES GAGNEZ EN EFFICACITÉ

DON DONNÉES NÉES GAGNEZ EN EFFICACITÉ DEVENEZ LE PILOTE DE TOUTES VOS DONNÉES GAGNEZ EN EFFICACITÉ TR DEVELOPPEMENT, société éditrice d, a développé pour vous une solution permettant une vision globale de votre entreprise en quelques clics.

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE

Séminaire. Fronts de science. Philippe Monget Directoire Opérationnel d AGENAE Fronts de science Philippe Monget Directoire Opérationnel d AGENAE Sélection génomique Genome Wide Association Succès, échecs, polémique Missing heritability Epistasie Epigénétique Phénotypage La nutrigénomique

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Rmixmod Le package R de MIXMOD R

Rmixmod Le package R de MIXMOD R Rmixmod Le package R de MIXMOD R MIXMOD Rencontres R 2012 - Bordeaux Florent Langrognet Laboratoire de Mathématiques de Besançon F. Langrognet () Rmixmod Juillet 2012 1 / 41 Rmixmod 1 Contexte Le projet

Plus en détail

PRÉSENTATION. L évaluation sensorielle par les consommateurs, un outil stratégique en innovation. Sophie Vincent, 22 janvier 2015

PRÉSENTATION. L évaluation sensorielle par les consommateurs, un outil stratégique en innovation. Sophie Vincent, 22 janvier 2015 PRÉSENTATION L évaluation sensorielle par les consommateurs, un outil stratégique en innovation Sophie Vincent, Spécialiste en recherche consommateurs et évaluation sensorielle 22 janvier 2015 CINTECH

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle

Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle 2013. Journées Recherche Porcine, 45, 213-218. Etude, par simulations, de l intérêt d une sélection génomique dans une population porcine de type mâle Thierry TRIBOUT (1,2), Catherine LARZUL (1,2), Jean

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

Mobilité Innovante. Solutions intelligentes pour les véhicules en milieux incertains.

Mobilité Innovante. Solutions intelligentes pour les véhicules en milieux incertains. Mobilité Innovante Solutions intelligentes pour les véhicules en milieux incertains. Simulation en robotique mobile en milieux naturels. D une action LabEx à l entreprise innovante. Historique 2 Thèses

Plus en détail

Mise en place d une base de données géoréférencées: outil d aide à la décision pour la protection des prises d eau

Mise en place d une base de données géoréférencées: outil d aide à la décision pour la protection des prises d eau Mise en place d une base de données géoréférencées: outil d aide à la décision pour la protection des prises d eau Contexte Exigences croissantes en matière de qualité et de sécurité d approvisionnement

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Agenda. Le groupe Keyrus. Orange Tunisie. Présentation du projet. Choix initial de Talend Open Studio. Evolution de la plateforme. Nécessité de migrer

Agenda. Le groupe Keyrus. Orange Tunisie. Présentation du projet. Choix initial de Talend Open Studio. Evolution de la plateforme. Nécessité de migrer Keyrus Talend Connect Business case Orange Tunisie Agenda Le groupe Keyrus Orange Tunisie Présentation du projet Choix initial de Talend Open Studio Evolution de la plateforme Nécessité de migrer Réalisation

Plus en détail

UE 5 Management des systèmes d informations. Le programme

UE 5 Management des systèmes d informations. Le programme UE 5 Management des systèmes d informations Le programme Légende : Modifications de l arrêté du 8 mars 2010 Suppressions de l arrêté du 8 mars 2010 Partie inchangée par rapport au programme antérieur 1.

Plus en détail

gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet

gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet management sup gestion industrielle Lean management Méthodes et exercices Barbara Lyonnet Le pictogramme qui figure ci-contre mérite une explication. Son objet est d alerter le lecteur sur la menace que

Plus en détail

Problème du voyageur de commerce par algorithme génétique

Problème du voyageur de commerce par algorithme génétique Problème du voyageur de commerce par algorithme génétique 1 Problème du voyageur de commerce Le problème du voyageur de commerce, consiste en la recherche d un trajet minimal permettant à un voyageur de

Plus en détail

RESSOURCES HUMAINES. Yourcegid Ressources Humaines, des solutions pour les entreprises qui s investissent dans leur capital humain.

RESSOURCES HUMAINES. Yourcegid Ressources Humaines, des solutions pour les entreprises qui s investissent dans leur capital humain. Yourcegid Ressources Humaines, des solutions pour les entreprises qui s investissent dans leur capital humain. Solutions de gestion RESSOURCES HUMAINES Parce que votre entreprise est unique, parce que

Plus en détail

moobee mail vous ouvre les portes de l e-mailing

moobee mail vous ouvre les portes de l e-mailing vous ouvre les portes de l e-ing one to one One to One Développez votre communication. Renforcez votre relation client. La solution e-ing pour gérer et suivre en toute autonomie vos campagnes. Vous préparez

Plus en détail

Systèmes d information

Systèmes d information 11 Systèmes Cette famille rassemble des métiers dont la finalité est de concevoir, développer, exploiter et entretenir des solutions (logicielles et matérielles) répondant aux besoins collectifs et individuels

Plus en détail

Wellness Management 66 Avenue des Champs-Elysées 75008 - PARIS www.wellness-management.com contact@wellness-management.com. Feel Well Work Well

Wellness Management 66 Avenue des Champs-Elysées 75008 - PARIS www.wellness-management.com contact@wellness-management.com. Feel Well Work Well Wellness Management 66 Avenue des Champs-Elysées 75008 - PARIS www.wellness-management.com contact@wellness-management.com Feel Well Work Well POUR MIEUX TRAVAILLER ensemble LE CAPITAL HUMAIN RESTE LA

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

CONNAISSANCE DU MARCHE STRATEGIE COMMERCIALE ET COMMUNICATION ETUDIER SON MARCHE GRACE A L'EXPLORATION DOCUMENTAIRE

CONNAISSANCE DU MARCHE STRATEGIE COMMERCIALE ET COMMUNICATION ETUDIER SON MARCHE GRACE A L'EXPLORATION DOCUMENTAIRE ET ETUDIER SON GRACE A L'EXPLORATION DOCUMENTAIRE L'objectif de ce module de formation en e-learning est de vous amener à établir un plan prévisionnel de ventes à trois ou cinq ans, en allant chercher

Plus en détail

répondre aux défis de l ingénierie logicielle déploiement et mise en œuvre opérationnelle : l'industrialisation au service de la compétitivité

répondre aux défis de l ingénierie logicielle déploiement et mise en œuvre opérationnelle : l'industrialisation au service de la compétitivité répondre aux défis de l ingénierie logicielle déploiement et mise en œuvre opérationnelle : l'industrialisation au service de la compétitivité philippe.ensarguet@orange.com directeur technique Orange Business

Plus en détail

Architecte d infrastructures informatiques

Architecte d infrastructures informatiques Architecte d infrastructures informatiques E1C23 Infrastructures informatiques - IR L architecte d infrastructures informatiques pilote la conception, le déploiement et la mise en oeuvre d'architectures

Plus en détail

Votre projet de formation Eleveur- pensionneur

Votre projet de formation Eleveur- pensionneur Votre projet de formation Eleveur- pensionneur 24 Rue du Château des Rentiers 75013 PARIS (France) Tel 01 83 64 05 99 AUDRECO FORMATION SA au capital de 38113 EUROS SIRET 39335113500024 CODE APE 8559A

Plus en détail

Colloque 30 ans de modélisation numérique à l UTC 25 26 novembre 2004

Colloque 30 ans de modélisation numérique à l UTC 25 26 novembre 2004 Optimisation Développement Produits (ODP) par le Développement de Plateforme Métier (DPM). Application au dimensionnement des éléments de liaison au sol. Colloque 30 ans de modélisation numérique à l UTC

Plus en détail

Raisonnement de la fertilisation des prairies

Raisonnement de la fertilisation des prairies Raisonnement de la fertilisation des prairies Un outil de caractérisation des pratiques de fertilisation : les indices de nutrition (analyses d herbe) Mise au point de l outil : l équipe ORPHEE de l INRA

Plus en détail

Openvista Ils mettent au cœur de leur priorité la réalisation de vos objectifs les plus ambitieux.»

Openvista Ils mettent au cœur de leur priorité la réalisation de vos objectifs les plus ambitieux.» «Avoir une connaissance fine de ses clients, maîtriser ses coûts fournisseurs, gérer efficacement la connaissance des différents collaborateurs dans son entreprise au fil du temps, optimiser les flux de

Plus en détail