Bases de données des mutations

Dimension: px
Commencer à balayer dès la page:

Download "Bases de données des mutations"

Transcription

1 Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, septembre 2014

2 Accès libre Initiée en 1989, consortium «Cystic Fibrosis Genetic Analysis» Catalogue de variations du gène CFTR Soumission par les labos lors de la 1ere identification du variant Septembre 2014

3 Nom «HGVS» Nom usuel Génotype Contributeur Clinique Mise à jour ou info supp Annotations phénotypique, génotypique limitées

4 2010 Application nomenclature HGVS

5 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del

6 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del Deep intronic kbA>G c kba>g c a>g kbC->T c c>t c c>t

7 Insertion : 81 petites insertions 75 % insertion sont dans repeat = duplication dup TCGGCGATGTTTTTT - CTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT CFMDB c.227_228inst c.228_229inst c.233_234inst c.49_50instt HGVS c.233dup c.233dup c.233dup c.49_50dup Délétion del CAGACATATACCAAATCC CAGACATATACCAAATCC CAGACATACCAAATCC CAGACATACCAAATCC CFMDB HGVS c.111_112 delat c.112_113del

8 Guidelines HGVS NM_ :c.112_113del https://mutalyzer.nl/index

9 Accès libre Initié en 2009 Implication phénotypique et fonctionnelle des variants CFTR => mutation CF causing quand en trans CF causing? => critères cliniques des patients

10 25 Registres CF patients Clinique TS (62 %) fonction pulmonaire (63 %) statut pancréatique (76 %) colonisation pseudomonas 89% variants identifiés variations différentes 159 variations, fréq allélique 0,01% 96% des allèles CF identifiés

11 variations, fréquence allélique 0,01% évaluation clinique et fonctionnelle chez les patients 80 PTC => CF causing! 2 délétions en phase (507 et 508del) 10 site épissage => impact ARN? 65 faux sens => impact protéine? fq chez pères et dans 1,000 génomes

12 CFTR2 web 200 mutations caractérisées

13 127 (129) (12) (6) CFTR2 web 200 mutations caractérisées

14 MOYENNES TS f pulmonaire PI/PS Pseudomonas âge Résumé résultats études fonctionnelles (Nat Genet)

15 Nomenclature HGVS : mêmes remarques que CFMDB 15 insertions décrites => 13 erreurs ins au lieu de dup 5T c [5] c t[5]

16 CFTR-France Les objectifs Les phénotypes Les variants L interprétation https://cftr.iurc.montp.inserm.fr/cftr/ Initiée en Décembre 2008 Collaboration entre 9 laboratoires de niveau 2 et Vaincre La Mucoviscidose Accès restreint aux collaborateurs

17 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale

18 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

19 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Résultats des outils bioinformatiques Données issues de la littérature Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

20 CFTR-France Les objectifs Les phénotypes Les variants L interprétation individus

21 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

22 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

23 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Corrélations génotype-phénotype Les variations «large spectre» Exemples : L206W, R347H, S945L Unclassified variants 37% Disease-causing 55% Classées «CF-causing» par CFTR2 mais pas que CFTR-France (trans mut sévère) L206W : 21 CF et 31 CFTR-RD R347H : 18 CF et 10 CFTR-RD S945L : 12 CF et 5 CFTR-RD Important pour le conseil génétique

24 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% Corrélations génotype-phénotype Les associations de variants en cis Exemples : Connu : CFTR2 CFTR-France I148T ; 3199del6 8 patients S1251N ; F508C X 7 patients V754M ; CFTRdele3-10,14b-16 X 3 patients Moins connu : G622D ; G>A X 6 patients (2 ségrégations) Important pour la pratique quotidienne des laboratoires de diagnostic

25 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% 74 % de faux-sens

26 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Occurrence des 198 faux-sens non-classés Non disease-causing 8% > 10x 6x y 10x Unclassified variants 37% Disease-causing 55% 3x y 5x 2x Difficile à interpréter 74 % de faux-sens gros travail à réaliser pour caractériser ces faux-sens! ( 7% étiquetés dans CFTR2)

27 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants?

28 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients

29 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients Juin 2013 : convention entre le Registre National et CFTR-France : échanges de données - Banque de données patients (infos cliniques +++ et mutations causales) - Données proviennent des CRCM CF +++ mais aussi DNN et quelques CFTR-RD - Dernier bilan annuel : données patients suivis MAJ annuelle / suivi du patient Erreur possible de retranscription des mutations et génotype incomplet

30 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - -

31 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - - Données anonymisées Recherche des correspondances patients communs entre les 2 banques CF (50% des CF de CFTR-France) 121 CFTR-RD 304 NBS données cliniques du registre en attente

32 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 2 / Recenser les études fonctionnelles publiées Seibert et al Sosnay et al Van Goor et al / Caractériser l impact fonctionnel de variations Prédictions bioinformatiques (198 faux-sens) Etudes in vitro Etudes ex vivo => projet collaboratif : analyse fonctionnelle 19 faux-sens (impact sur épissage prédit)

33 CFTR-France Bientôt un accès public

34 CFTR-France Bientôt un accès public Infos générales -CFTR-France - gène et protéine - variations (nomenclature HGVS, classification, ) - CFTR-opathies Moteur de recherche variant Statistiques - variations - génotypes - phénotypes

35 Merci de votre attention

10.25/2. Shéma du processur de fibrose kystique sur une glande

10.25/2. Shéma du processur de fibrose kystique sur une glande Thème 1-A : Expression, stabilité et variation du patrimoine génétique TP 6 : La mucoviscidose : multiples échelons d un phénotype La mucoviscidose présente des indications visibles qui constituent un

Plus en détail

La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida

La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida DÉBAT POURTOUR MÉDITERRANÉEN Quels sont les partenariats existants? Quels sont les manques? La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida Présidente de la Société Algérienne de

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Notice destinée au médecin : test à 139 variants de la

Notice destinée au médecin : test à 139 variants de la Notice destinée au médecin : test à 139 variants de la fibrose kystique MiSeqDx(MC) DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT Tests génétiques et fibrose kystique La fibrose kystique est une maladie chronique

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Stratégies thérapeutiques dans la mucoviscidose en 2010

Stratégies thérapeutiques dans la mucoviscidose en 2010 Stratégies thérapeutiques dans la mucoviscidose en 2010 Gène anormal Protéine anormale Transport ionique altéré Mucus anormal Inflammation Infection Destruction tissulaire Thérapie génique Thérapie protéique

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx 1 / 35 2 / 35 Contexte 3 / 35 Risque cumulé de cancer à 70 ans Cancer du sein

Plus en détail

Formes révélées à l âge adulte. Dr S. Durupt CRCM adulte Lyon

Formes révélées à l âge adulte. Dr S. Durupt CRCM adulte Lyon La Mucoviscidose Formes révélées à l âge adulte Dr S. Durupt CRCM adulte Lyon Mucoviscidose Maladie complexe touchant de multiples organes Facteur(s) génétique(s) Facteurs infectieux Facteurs nutritionnels-métaboliques

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale Martin Krahn Département de Génétique

Plus en détail

Ch5 : Variation génétique et médecine

Ch5 : Variation génétique et médecine T3 : Corps humain et santé T3/U1 : Variation génétique et santé Ch5 : Variation génétique et médecine I. Les maladies génétiques germinales A. Rappel et définitions Une maladie est dite génétique germinale

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

Elucigene CF-EU2v1 Mode d emploi

Elucigene CF-EU2v1 Mode d emploi Elucigene CF-EU2v1 Mode d emploi Code cat. : CF2EUB2 50 tests CF2EUBX 10 tests Dispositif de diagnostic in vitro Fabriqué par Elucigene Diagnostics Elucigene Diagnostics Greenheys House Pencroft Way Manchester

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

UE GENETIQUE D.C.E.M. 1. Génétique moléculaire :

UE GENETIQUE D.C.E.M. 1. Génétique moléculaire : Université Bordeaux Segalen UE GENETIQUE D.C.E.M. 1 Année universitaire 2011-2012 Génétique moléculaire : Identification et conséquences des mutations. Exemple de la mucoviscidose (gène CFTR) Dr Caroline

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Mucoviscidose (gène CFTR) Hémochromatose (gène HFE) Thrombophilies (gènes F2 et F5) Caractéristiques génétiques à des fins médicales

Plus en détail

http://aptf-asso.org/blog/2011/09/19/la-mucoviscidose-actualite-therapeutique-dans-le-traitement-de-la-mucoviscidose/

http://aptf-asso.org/blog/2011/09/19/la-mucoviscidose-actualite-therapeutique-dans-le-traitement-de-la-mucoviscidose/ 1 CHAPITRE N 1 : LA MUCOVISIDOSE Correction du TP mucoviscidose 1) Les phénotypes de la mucoviscidose a) Phénotype macroscopique http://aptf-asso.org/blog/2011/09/19/la-mucoviscidose-actualite-therapeutique-dans-le-traitement-de-la-mucoviscidose/

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

Organisation et gestion des prescriptions en oncogénétique

Organisation et gestion des prescriptions en oncogénétique PR-0408.02 Page 1 / 5 OBJET : Ce document a pour objectif de définir tous les éléments concernant la partie préanalytique et post analytique nécessaires pour : - réaliser un criblage dans les gènes BRCA1

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Albinisme oculo-cutané : un peu de chemin parcouru ensemble.

Albinisme oculo-cutané : un peu de chemin parcouru ensemble. Albinisme oculo-cutané : un peu de chemin parcouru ensemble. Benoît Arveiler Laboratoire de Génétique Moléculaire, Service de Génétique Médicale CHU de Bordeaux Laboratoire Maladies Rares: Génétique et

Plus en détail

Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris

Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris DES, 12 Dec 2014 Mucoviscidose : historique DH Andersen P di Sant'Agnese M Knowles RC Boucher LC Tsui M Welsh

Plus en détail

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement.

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Les gènes gouvernent la synthèse des protéines qui participent à la réalisation du phénotype mais d'autres éléments, comme

Plus en détail

Pancréatites génétiques

Pancréatites génétiques Pancréatites génétiques Pr Philippe RUSZNIEWSKI Fédération Médico-Chirurgicale d'hépato-gastroentérologie Hôpital Beaujon, Clichy 23èmes Journées de la FMC-HGE Paris, 2 avril 2005 Connaître les principales

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH

Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH Polypose-SYN-Mutation-Mutyh-CVT:4 pages 24/06/11 15:53 Page 1 Mesure 23 SOINS ET VIE DES MALADES JUIN 2011 Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH COLLECTION

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Jacques Robert I NSERM U916 I nstitut Bergonié Université de Bordeaux Le génome constitutionnel 3 milliards de paires

Plus en détail

SOIGNER, RÉPARER, GUÉRIR

SOIGNER, RÉPARER, GUÉRIR DOSSIER DE PRESSE Septembre 2015 SOIGNER, RÉPARER, GUÉRIR 3 espoirs pour les patients, 3 défis pour la recherche Un enjeu fort pour les Virades de l espoir Contacts Presse : PRPA Isabelle CLOSET Tél. :

Plus en détail

Chapitre 6 L interaction des gènes

Chapitre 6 L interaction des gènes Chapitre 6 L interaction des gènes La variation dans la coloration de la coquille Saint-Jacques (Argopecten irradians) due à trois allèles d un même gène Des gènes aux phénotypes 1- La relation entre les

Plus en détail

Une polypose peut cacher

Une polypose peut cacher Une polypose peut cacher une mucoviscidose Journées DES 6 et 7 mars 2009 E.MEZGUELDI Service de pneumologie du Pr BELLON C est l histoire d Anton, né le 18/08/1997 ATCD perso : né à 40 SA PN = 3290g taille

Plus en détail

Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec

Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec Août 2012 Institut national de santé publique du Québec Enjeux liés au diagnostic et à

Plus en détail

Mucoviscidose. Caractéristiques cliniques de la maladie

Mucoviscidose. Caractéristiques cliniques de la maladie Mucoviscidose La mucoviscidose (MIM# 219700) est la plus fréquente des maladies héréditaires graves dans la population blanche, puisqu elle touche près de 1individu sur 2500 (toutes formes cliniques confondues).

Plus en détail

Repenser le cancer de l ovaire après. Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu

Repenser le cancer de l ovaire après. Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu Repenser le cancer de l ovaire après Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu Objectifs Faire une recherche exhaustive des anomalies génétiques et épigénétiques des

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Prédisposition génétique aux cancers

Prédisposition génétique aux cancers Prédisposition génétique aux cancers Plan de cours I-Introduction I-1 Fréquence des mutations I-2 Objectifs médicaux de l oncogénétique I-3 Rappels sur la prolifération cellulaire tumorale; la théorie

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

LE DÉPISTAGE NÉONATAL SYSTÉMATIQUE DE LA MUCOVISCIDOSE EN FRANCE : ÉTAT DES LIEUX ET PERSPECTIVES APRÈS 5 ANS DE FONCTIONNEMENT

LE DÉPISTAGE NÉONATAL SYSTÉMATIQUE DE LA MUCOVISCIDOSE EN FRANCE : ÉTAT DES LIEUX ET PERSPECTIVES APRÈS 5 ANS DE FONCTIONNEMENT ÉTAT DES LIEUX EN SANTÉ PUBLIQUE LE DÉPISTAGE NÉONATAL SYSTÉMATIQUE DE LA MUCOVISCIDOSE EN FRANCE : ÉTAT DES LIEUX ET PERSPECTIVES APRÈS 5 ANS DE FONCTIONNEMENT JANVIER 2009 1 Les recommandations et synthèse

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

examen clé du diagnostic ; indication multiples 3 étapes : stimulation de la sudation recueil de la sueur dosage du chlore et / ou du sodium

examen clé du diagnostic ; indication multiples 3 étapes : stimulation de la sudation recueil de la sueur dosage du chlore et / ou du sodium LA MUCOVISCIDOSE I/ Introduction Maladie héréditaire, génétique, la plus fréquente, qui affecte essentiellement la population caucasienne ; ce sont principalement des mutations fonctionnelles ; plus de

Plus en détail

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine Recherche et médecine personnalisée : le point de vue de l oncogénéticien Dr Dugast catherine cc Dépistage de masse K sein chez mère 60 ans, nulliparité? Antécédent de hodgkin à 15 ans???? Quel est mon

Plus en détail

Formes familiales du cancer colorectal

Formes familiales du cancer colorectal Tlemcen, 05/05/06 Formes familiales du cancer colorectal Emmanuel Mitry Fédération des spécialités digestives CHU Ambroise Paré AP-HP épithélium! normal! cancer sporadique :! M1! M2! M3!... Mn! tumeur!

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012

PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012 PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012 24/02/2012 F.ANTOINE M.BELFROY PREMIERE S Frédérique et Martine ACTIVITES PRATIQUES Activité préparant l ECE en Première

Plus en détail

Syndrome de Lynch : les risques tumoraux

Syndrome de Lynch : les risques tumoraux Lille - 22/03/2013 Syndrome de Lynch : les risques tumoraux Valérie Bonadona, MD, PhD Centre Léon Bérard & CNRS UMR 5558 Lyon Le Syndrome de Lynch = Syndrome HNPCC (Hereditary Nonpolyposis Colorectal Cancer)

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Analyses - Liste des analyses à accompagner d'une attestation de consultation

Analyses - Liste des analyses à accompagner d'une attestation de consultation Analyses - Liste des analyses à accompagner d'une attestation de consultation Libellé Document a joindre au prelevement Acétylcholinestérase - liquide amniotique attestation de consultation et consentement

Plus en détail

La mucoviscidose : du gène CFTR au conseil génétique

La mucoviscidose : du gène CFTR au conseil génétique La mucoviscidose : du gène CFTR au conseil génétique Collège National des Enseignants et Praticiens de Génétique Médicale C. FÉREC Laboratoire de Génétique Moléculaire C.H.R.U. Brest Directeur de l Inserm

Plus en détail

Interactions génétique environnement. Environnement. Spermatozoïdes physiologiquement non fécondants. Causes? Suivi des enfants

Interactions génétique environnement. Environnement. Spermatozoïdes physiologiquement non fécondants. Causes? Suivi des enfants Interactions génétique environnement Environnement Spermatozoïdes physiologiquement non fécondants Causes? ICSI Conceptus génétique infections Suivi des enfants Démarche diagnostique : Evaluation du risque

Plus en détail

Nouvelles mutations RAS

Nouvelles mutations RAS Nouvelles mutations RAS dans les cancers colo-rectaux Rappel RAS : interrupteur de plusieurs voies de signalisation ras MUTATION RAS /ras activé en permanence : signalisation continue de la prolifération

Plus en détail

Du gène au test. De la connaissance du gène au test utilisable en clinique

Du gène au test. De la connaissance du gène au test utilisable en clinique Du gène au test Du gène au test L évolution des connaissances en génétique entraîne une augmentation de la demande de tests génétiques. Or la fiabilité de ces tests et leur utilisation posent des problèmes

Plus en détail

SUGGESTIONS PÉDAGOGIQUES : CLASSE DE PREMIÈRE SÉRIES S, L ET ES

SUGGESTIONS PÉDAGOGIQUES : CLASSE DE PREMIÈRE SÉRIES S, L ET ES SUGGESTIONS PÉDAGOGIQUES : CLASSE DE PREMIÈRE SÉRIES S, L ET ES INTRODUCTION : LA BANQUE DE DONNÉES ET LES NOTIONS DU PROGRAMME Le programme de biologie de la classe de première est centré sur la façon

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

TRANSLOCATIONS. Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes

TRANSLOCATIONS. Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes TRANSLOCATIONS Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes Translocations Définition: passage d un segment chromosomique sur un autre chromosome 2 points de cassure : remaniements

Plus en détail

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient Laboratoires Saint Julien & Beaulieu L'attestation de consultation doit être délivrée par le prescripteur. Un formulaire de consentement est disponible au laboratoire du même type qu à la page 68 de ce

Plus en détail

RECHERCHE & MUCOVISCIDOSE : UPDATE 2014

RECHERCHE & MUCOVISCIDOSE : UPDATE 2014 RECHERCHE & MUCOVISCIDOSE : UPDATE 2014 Comme d habitude, notre numéro de septembre est consacré à un aperçu de ce que la recherche scientifique propose de nouveau en matière de mucoviscidose. Dans le

Plus en détail

Enfant 15 ans, toux chronique, diarrhée persistante, troubles de la régulation glycémique

Enfant 15 ans, toux chronique, diarrhée persistante, troubles de la régulation glycémique Enfant 15 ans, toux chronique, diarrhée persistante, troubles de la régulation glycémique Quelles hypothèses diagnostiques pouvez vous émettre, dans ce contexte, devant ces images kystiques de la région

Plus en détail

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Métabolisme du fer : hepcidine Fer absorbé par les entérocytes des villosités duodénales : transporteur

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Dépistage Non Invasif de la T21 Oùen sommes nous? Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Pr Alexandra Benachi Exerçant au CHU Antoine Béclère,

Plus en détail

Règles de bonnes pratiques en génétique constitutionnelle à des fins médicales (Hors diagnostic prénatal)

Règles de bonnes pratiques en génétique constitutionnelle à des fins médicales (Hors diagnostic prénatal) Règles de bonnes pratiques en génétique constitutionnelle à des fins médicales (Hors diagnostic prénatal) Sommaire Introduction... 3 A - Prise en charge des personnes... 5 1- Préambule... 5 2- La prescription...

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Les défis de la Bioinformatique:

Les défis de la Bioinformatique: Les défis de la Bioinformatique: Une introduction à la Journée du 19 octobre Marie-Paule LEFRANC Journées du CINES 19-21 octobre 2004 organisées par Laetitia Regnier Importance des facteurs génétiques

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Organisation du Génome humain Notions essentielles

Organisation du Génome humain Notions essentielles Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion «How to sequence a genome» (film): www.genome.gov/25019885 Human Genome Project: http://www.genome.gov/hgp/

Plus en détail

Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique

Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique Alexandre Belot, MD, PhD Service de Néphrologie, Rhumatologie, Dermatologie Pédiatriques Hôpital Femme Mère Enfant

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Chapitre 14 Oncogénétique digestive

Chapitre 14 Oncogénétique digestive Chapitre 14 Oncogénétique digestive 1. Place des gènes en oncologie générale 2. Carcinogenèse colorectale 3. Maladie génétique à transmission dominante 4. Exemples de prédispositions génétiques aux cancers

Plus en détail

4. MUCOVISCIDOSE A. INCIDENCE & GÉNÉTIQUE

4. MUCOVISCIDOSE A. INCIDENCE & GÉNÉTIQUE 4. MUCOVISCIDOSE A. Incidence & génétique B. Diagnostic C. Atteinte respiratoire D. Manifestations extra-respiratoires E. Pronostic F. Perspectives A. INCIDENCE & GÉNÉTIQUE La mucoviscidose est l'affection

Plus en détail

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011)

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011) UP-CNV 2.0 Banque de données en ligne répertoriant les CNVs (Copy Number Variations) identifiés par CGH-array chez les patients atteints de retard mental, anomalie du développement 2.0 Projet financé par

Plus en détail

Évaluation de l AERES sur l unité :

Évaluation de l AERES sur l unité : Section des Unités de recherche Évaluation de l AERES sur l unité : Laboratoire de génétique de Maladies rares : pathologie moléculaire, impact fonctionnel et bioinformatique génétique LGMR sous tutelle

Plus en détail

MODÈLE DE COMPTE RENDU DE GÉNÉTIQUE MOLÉCULAIRE POUR LA RECHERCHE DE MUTATIONS SOMATIQUES DANS LES TUMEURS SOLIDES

MODÈLE DE COMPTE RENDU DE GÉNÉTIQUE MOLÉCULAIRE POUR LA RECHERCHE DE MUTATIONS SOMATIQUES DANS LES TUMEURS SOLIDES MODÈLE DE COMPTE RENDU DE GÉNÉTIQUE MOLÉCULAIRE POUR LA RECHERCHE DE MUTATIONS SOMATIQUES DANS LES TUMEURS SOLIDES Octobre 2012 Mesure 21 : Garantir un accès égal aux traitements et aux innovations Ce

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B. Coordonnateurs : F Nguyen Khac, E Chapiro

Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B. Coordonnateurs : F Nguyen Khac, E Chapiro 1 Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B Coordonnateurs : F Nguyen Khac, E Chapiro CONTEXTE La leucémie prolymphocytaire B (LPL B) est une pathologie rare,

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

COMMISSION DE LA TRANSPARENCE Avis 23 septembre 2015

COMMISSION DE LA TRANSPARENCE Avis 23 septembre 2015 COMMISSION DE LA TRANSPARENCE Avis 23 septembre 2015 PULMOZYME 2500 U/2,5 ml, solution pour inhalation par nébuliseur B/6 ampoules de 2,5 ml (CIP : 34009 364 674 8 4) B/30 ampoules de 2,5 ml (CIP : 34009

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Data Mining et Big Data

Data Mining et Big Data Data Mining et Big Data Eric Rivals LIRMM & Inst. de Biologie Computationnelle CNRS et Univ. Montpellier 14 novembre 2015 E. Rivals (LIRMM & IBC) Big Data 14 novembre 2015 1 / 30 Introduction, contexte

Plus en détail

SBI3U Épreuve Génétique Nom:

SBI3U Épreuve Génétique Nom: SBI3U Épreuve Génétique Nom: PARTIE A (15) (Connaissances et compréhension) Inscrire la bonne réponse sur la carte SCANTRON 1. Une femme porteuse du gène d hémophilie et un homme hémophile sont croisés.

Plus en détail

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Octobre 2014 Médecine «génomique» personnalisée La médecine «génomique» personnalisée repose sur l identification de sous-groupes de

Plus en détail

N 43. Problèmes posés par les maladies génétiques, à propos :

N 43. Problèmes posés par les maladies génétiques, à propos : N 43. Problèmes posés par les maladies génétiques, à propos : d une maladie chromosomique : la trisomie 21 d une maladie génique : la mucoviscidose d une maladie d instabilité : le syndrome de l X fragile

Plus en détail

Le programme Anticorps Thérapeutiques. Nicolas GROUX

Le programme Anticorps Thérapeutiques. Nicolas GROUX Le programme Anticorps Thérapeutiques Nicolas GROUX Emergence du projet Historique : Journées collaboratives 2009 Constat : les Anticorps monoclonaux (mabs) représentent une partie de plus en plus importante

Plus en détail