Bases de données des mutations

Dimension: px
Commencer à balayer dès la page:

Download "Bases de données des mutations"

Transcription

1 Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, septembre 2014

2 Accès libre Initiée en 1989, consortium «Cystic Fibrosis Genetic Analysis» Catalogue de variations du gène CFTR Soumission par les labos lors de la 1ere identification du variant Septembre 2014

3 Nom «HGVS» Nom usuel Génotype Contributeur Clinique Mise à jour ou info supp Annotations phénotypique, génotypique limitées

4 2010 Application nomenclature HGVS

5 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del

6 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del Deep intronic kbA>G c kba>g c a>g kbC->T c c>t c c>t

7 Insertion : 81 petites insertions 75 % insertion sont dans repeat = duplication dup TCGGCGATGTTTTTT - CTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT CFMDB c.227_228inst c.228_229inst c.233_234inst c.49_50instt HGVS c.233dup c.233dup c.233dup c.49_50dup Délétion del CAGACATATACCAAATCC CAGACATATACCAAATCC CAGACATACCAAATCC CAGACATACCAAATCC CFMDB HGVS c.111_112 delat c.112_113del

8 Guidelines HGVS NM_ :c.112_113del https://mutalyzer.nl/index

9 Accès libre Initié en 2009 Implication phénotypique et fonctionnelle des variants CFTR => mutation CF causing quand en trans CF causing? => critères cliniques des patients

10 25 Registres CF patients Clinique TS (62 %) fonction pulmonaire (63 %) statut pancréatique (76 %) colonisation pseudomonas 89% variants identifiés variations différentes 159 variations, fréq allélique 0,01% 96% des allèles CF identifiés

11 variations, fréquence allélique 0,01% évaluation clinique et fonctionnelle chez les patients 80 PTC => CF causing! 2 délétions en phase (507 et 508del) 10 site épissage => impact ARN? 65 faux sens => impact protéine? fq chez pères et dans 1,000 génomes

12 CFTR2 web 200 mutations caractérisées

13 127 (129) (12) (6) CFTR2 web 200 mutations caractérisées

14 MOYENNES TS f pulmonaire PI/PS Pseudomonas âge Résumé résultats études fonctionnelles (Nat Genet)

15 Nomenclature HGVS : mêmes remarques que CFMDB 15 insertions décrites => 13 erreurs ins au lieu de dup 5T c [5] c t[5]

16 CFTR-France Les objectifs Les phénotypes Les variants L interprétation https://cftr.iurc.montp.inserm.fr/cftr/ Initiée en Décembre 2008 Collaboration entre 9 laboratoires de niveau 2 et Vaincre La Mucoviscidose Accès restreint aux collaborateurs

17 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale

18 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

19 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Résultats des outils bioinformatiques Données issues de la littérature Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

20 CFTR-France Les objectifs Les phénotypes Les variants L interprétation individus

21 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

22 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

23 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Corrélations génotype-phénotype Les variations «large spectre» Exemples : L206W, R347H, S945L Unclassified variants 37% Disease-causing 55% Classées «CF-causing» par CFTR2 mais pas que CFTR-France (trans mut sévère) L206W : 21 CF et 31 CFTR-RD R347H : 18 CF et 10 CFTR-RD S945L : 12 CF et 5 CFTR-RD Important pour le conseil génétique

24 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% Corrélations génotype-phénotype Les associations de variants en cis Exemples : Connu : CFTR2 CFTR-France I148T ; 3199del6 8 patients S1251N ; F508C X 7 patients V754M ; CFTRdele3-10,14b-16 X 3 patients Moins connu : G622D ; G>A X 6 patients (2 ségrégations) Important pour la pratique quotidienne des laboratoires de diagnostic

25 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% 74 % de faux-sens

26 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Occurrence des 198 faux-sens non-classés Non disease-causing 8% > 10x 6x y 10x Unclassified variants 37% Disease-causing 55% 3x y 5x 2x Difficile à interpréter 74 % de faux-sens gros travail à réaliser pour caractériser ces faux-sens! ( 7% étiquetés dans CFTR2)

27 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants?

28 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients

29 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients Juin 2013 : convention entre le Registre National et CFTR-France : échanges de données - Banque de données patients (infos cliniques +++ et mutations causales) - Données proviennent des CRCM CF +++ mais aussi DNN et quelques CFTR-RD - Dernier bilan annuel : données patients suivis MAJ annuelle / suivi du patient Erreur possible de retranscription des mutations et génotype incomplet

30 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - -

31 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - - Données anonymisées Recherche des correspondances patients communs entre les 2 banques CF (50% des CF de CFTR-France) 121 CFTR-RD 304 NBS données cliniques du registre en attente

32 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 2 / Recenser les études fonctionnelles publiées Seibert et al Sosnay et al Van Goor et al / Caractériser l impact fonctionnel de variations Prédictions bioinformatiques (198 faux-sens) Etudes in vitro Etudes ex vivo => projet collaboratif : analyse fonctionnelle 19 faux-sens (impact sur épissage prédit)

33 CFTR-France Bientôt un accès public

34 CFTR-France Bientôt un accès public Infos générales -CFTR-France - gène et protéine - variations (nomenclature HGVS, classification, ) - CFTR-opathies Moteur de recherche variant Statistiques - variations - génotypes - phénotypes

35 Merci de votre attention

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Mucoviscidose (gène CFTR) Hémochromatose (gène HFE) Thrombophilies (gènes F2 et F5) Caractéristiques génétiques à des fins médicales

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Jacques Robert I NSERM U916 I nstitut Bergonié Université de Bordeaux Le génome constitutionnel 3 milliards de paires

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec

Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec Enjeux liés au diagnostic et à la prise en charge initiale des enfants atteints de la fibrose kystique au Québec Août 2012 Institut national de santé publique du Québec Enjeux liés au diagnostic et à

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

4. MUCOVISCIDOSE A. INCIDENCE & GÉNÉTIQUE

4. MUCOVISCIDOSE A. INCIDENCE & GÉNÉTIQUE 4. MUCOVISCIDOSE A. Incidence & génétique B. Diagnostic C. Atteinte respiratoire D. Manifestations extra-respiratoires E. Pronostic F. Perspectives A. INCIDENCE & GÉNÉTIQUE La mucoviscidose est l'affection

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Métabolisme du fer : hepcidine Fer absorbé par les entérocytes des villosités duodénales : transporteur

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B. Coordonnateurs : F Nguyen Khac, E Chapiro

Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B. Coordonnateurs : F Nguyen Khac, E Chapiro 1 Fiche : CARACTERISATION CYTOGENETIQUE ET MOLECULAIRE DES LEUCEMIES PROLYMPHOCYTAIRES B Coordonnateurs : F Nguyen Khac, E Chapiro CONTEXTE La leucémie prolymphocytaire B (LPL B) est une pathologie rare,

Plus en détail

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011)

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011) UP-CNV 2.0 Banque de données en ligne répertoriant les CNVs (Copy Number Variations) identifiés par CGH-array chez les patients atteints de retard mental, anomalie du développement 2.0 Projet financé par

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

PLACE DES DOSAGES DES APOLIPOPROTEINES A1 ET B

PLACE DES DOSAGES DES APOLIPOPROTEINES A1 ET B PLACE DES DOSAGES DES APOLIPOPROTEINES A1 ET B DANS LE BILAN LIPIDIQUE TEXTE COURT SEPTEMBRE 2008 Service évaluation des actes professionnels 2 avenue du Stade de France 93218 Saint-Denis La Plaine CEDEX

Plus en détail

Bases de données et outils bioinformatiques utiles en génétique

Bases de données et outils bioinformatiques utiles en génétique Bases de données et outils bioinformatiques utiles en génétique Collège National des Enseignants et Praticiens de Génétique Médicale C. Beroud Date de création du document 2010-2011 Table des matières

Plus en détail

MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE

MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE MASTER (LMD) MANAGEMENT DE PROJET ET INNOVATION EN BIOTECHNOLOGIE RÉSUMÉ DE LA FORMATION Type de diplôme : Master (LMD) Domaine ministériel : Sciences, Technologies, Santé Mention : BIOLOGIE SANTE Spécialité

Plus en détail

Les plateformes de génétique

Les plateformes de génétique Thérapies ciblées : de l anatomopathologie th l à la biothérapie i Les plateformes de génétique moléculaire PO Schischmanoff UF Génétique moléculaire et oncogénétique CHU Avicenne ACP FHF 29 mars 2012

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Le test de dépistage qui a été pratiqué

Le test de dépistage qui a été pratiqué élever CommenT UN enfant ayant une mucoviscidose Q Le test de dépistage qui a été pratiqué à la maternité a révélé que votre bébé pouvait être atteint de mucoviscidose. Le test de la sueur vient de confirmer

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

Qu est-ce que la maladie de Huntington?

Qu est-ce que la maladie de Huntington? Qu est-ce que la maladie de Huntington? Description sommaire Qu est-ce que la maladie de Huntington? La maladie de Huntington (MH) est une maladie neurodégénérative longtemps connue sous le nom de Chorée

Plus en détail

Bases moléculaires des mutations Marc Jeanpierre

Bases moléculaires des mutations Marc Jeanpierre Bases moléculaires des mutations Marc Jeanpierre Chaque enfant qui naît hérite de 10 à 30 nouvelles mutations ponctuelles. L essentiel des ces mutations sont heureusement des variations neutres de séquence

Plus en détail

L axe 5 du Cancéropole Nord Ouest

L axe 5 du Cancéropole Nord Ouest L axe 5 du Cancéropole Nord Ouest Cancers, Individu id & Société L état des lieux d un pari Le Rapport Cordier 1 Biomarqueurs prédictifs 2 L axe 5 du Cancéropole Nord Ouest Cancers, Individu & Société

Plus en détail

Ouverture d un pavillon médical : Mesures mises en œuvre pour la mise en eau et suivi bactériologique

Ouverture d un pavillon médical : Mesures mises en œuvre pour la mise en eau et suivi bactériologique Ouverture d un pavillon médical : Mesures mises en œuvre pour la mise en eau et suivi bactériologique Congrès de la SF2H - 9 Juin 2011 S. Coudrais Biohygiéniste Unité d Hygiène et Epidémiologie - Groupement

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

Anomalies observées avant la naissance associées aux mutations HNF1B

Anomalies observées avant la naissance associées aux mutations HNF1B Anomalies observées avant la naissance associées aux mutations HNF1B Laurence Heidet Centre de Référence des Maladies Rénales Héréditaires de l Enfant et de l Adulte. Service de Néphrologie Pédiatrique

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

VI) MARQUEURS BIOLOGIQUES DU CANCER THYROIDIEN

VI) MARQUEURS BIOLOGIQUES DU CANCER THYROIDIEN VI) MARQUEURS BIOLOGIQUES DU CANCER THYROIDIEN 1) Thyroglobuline a) Indications et fréquence Exclusivement sécrétée par la thyroïde Marqueur de choix pour le suivi du cancer différencié de la thyroïde

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Rapport scientifique DEBRA France. Année 2013

Rapport scientifique DEBRA France. Année 2013 Rapport scientifique DEBRA France Année 2013 Pr. Alain Hovnanian Services de Génétique et de Dermatologie Coordinateur du projet Européen GENEGRAFT Centre de diagnostic des maladies génétiques cutanées

Plus en détail

Les tests génétiques à des fins médicales

Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Nous avons tous hérité d une combinaison unique de gènes de la part de nos parents. Cette constitution originale et l

Plus en détail

Univers Vivant Révision. Notions STE

Univers Vivant Révision. Notions STE Univers Vivant Révision Notions STE Chap. 13) L Écologie 1) a) Qu est-ce que l empreinte écologique? L empreinte écologique correspond à la surface terrestre et aquatique totale nécessaire à un individu,

Plus en détail

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012

CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 CAMPAGNE D EMPLOIS ENSEIGNANTS 2012 ETABLISSEMENT : UM2 COMPOSANTE : Faculté des Sciences SITE : Campus Triolet IDENTIFICATION DU POSTE : N : Corps : Section CNU : 67 Nature demandée : Maître de Conférence

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Genopole Siège Campus 1 - Bâtiment Genavenir 8 5, rue Henri Desbruères F-91030 Evry cedex T. +33 1 60 87 83 00 - F.

Genopole Siège Campus 1 - Bâtiment Genavenir 8 5, rue Henri Desbruères F-91030 Evry cedex T. +33 1 60 87 83 00 - F. Annuaire Genopole Mars 2007 G opole Genopole Siège Campus 1 - Bâtiment Genavenir 8, rue Henri Desbruères F-91030 Evry cedex T. +33 1 60 87 83 00 - F. +33 1 60 87 83 01 prénom.nom@genopole.fr 2 Réussir

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail

Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA

Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA Claude SAEGERMAN Département des maladies infectieuses et parasitaires, Service d épidémiologie et analyse de risques appliquées aux

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Yves Clément, Jacques David & Sylvain Glémin Journées ARCAD 28/10/2014 Outline Sélection sur l usage

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

I - CLASSIFICATION DU DIABETE SUCRE

I - CLASSIFICATION DU DIABETE SUCRE I - CLASSIFICATION DU DIABETE SUCRE 1- Définition : Le diabète sucré se définit par une élévation anormale et chronique de la glycémie. Cette anomalie est commune à tous les types de diabète sucré, mais

Plus en détail

Intérêt des recherches génétiques

Intérêt des recherches génétiques Intérêt du chien dans la pathologie et la génétique comparée: exemples de maladies et de gènes partagées entre l'homme et le chien Dr. Catherine André candre@univ-rennes1.fr Intérêt des recherches génétiques

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Les questions biologiques auxquelles s intéresse l ITMO ont traditionnellement fait appel à la génétique, à la génétique des populations,

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Titre : Hémiplégie Alternante : une étude des épisodes paroxystiques.

Titre : Hémiplégie Alternante : une étude des épisodes paroxystiques. I.B.AHC 1. DESCRIPTION DE L ETUDE Titre : Hémiplégie Alternante : une étude des épisodes paroxystiques. Auteurs : Elisa De Grandis MD PhD, G Gaslini Institute, University of Genoa Melania Giannotta MD,

Plus en détail

Le chercheur responsable, en collaboration avec le personnel technique de

Le chercheur responsable, en collaboration avec le personnel technique de Direction des services vétérinaires Procédure normalisée de fonctionnement Objet : Gestion des colonies internes de souris Numéro : RE-1 Portée : Ceci est une directive de la Direction des services vétérinaires

Plus en détail

Mort subite : les généticiens nantais à la pointe du diagnostic préventif

Mort subite : les généticiens nantais à la pointe du diagnostic préventif Mort subite : les généticiens nantais à la pointe du diagnostic préventif Inserm-Patrice Latron Inserm-Jean-Christophe Lambry Inaugurations du séquenceur haut-débit et du centre de prise en charge de la

Plus en détail

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS E. Desmarais J.C. Avarre, C. Breton, K. Belkhir et B. Guinand Institut des Sciences de l Evolution - Montpellier

Plus en détail

Elisabeth DELAIS ROUSSARIE UMR 7110 / LLF Laboratoire de Linguistique formelle Université de Paris Diderot

Elisabeth DELAIS ROUSSARIE UMR 7110 / LLF Laboratoire de Linguistique formelle Université de Paris Diderot Elisabeth DELAIS ROUSSARIE UMR 7110 / LLF Laboratoire de Linguistique formelle Université de Paris Diderot JOURNEES IPFC Paris, 5 et 6 décembre 2011 Pour travailler sur l acquisition de la dimension orale

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

1 Des innovations génétiques favorables

1 Des innovations génétiques favorables ACTIVITÉ 1 Des innovations génétiques favorables ou défavorables Les mutations sont des innovations génétiques qui apparaissent de manière aléatoire dans le génome des organismes. Elles peuvent avoir des

Plus en détail

Evaluation péri-opératoire de la tolérance à l effort chez le patient cancéreux. Anne FREYNET Masseur-kinésithérapeute CHU Bordeaux

Evaluation péri-opératoire de la tolérance à l effort chez le patient cancéreux. Anne FREYNET Masseur-kinésithérapeute CHU Bordeaux Evaluation péri-opératoire de la tolérance à l effort chez le patient cancéreux Anne FREYNET Masseur-kinésithérapeute CHU Bordeaux Je déclare n avoir aucun conflit d intérêt en lien avec cette présentation

Plus en détail

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008),

GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), G F εn I ε R GENIFER GENANIMAL : ANR-GANI-015 (2006-2008), Mesures phénotypiques et étude du polymorphisme de gènes candidats de QTL de fertilité femelle en race Prim Holstein Patrice HUMBLOT 1, Yves AMIGUES

Plus en détail

COMMISSION DE LA TRANSPARENCE AVIS DE LA COMMISSION. 10 octobre 2001

COMMISSION DE LA TRANSPARENCE AVIS DE LA COMMISSION. 10 octobre 2001 COMMISSION DE LA TRANSPARENCE AVIS DE LA COMMISSION 10 octobre 2001 VIRAFERONPEG 50 µg 80 µg 100 µg 120 µg 150 µg, poudre et solvant pour solution injectable B/1 B/4 Laboratoires SCHERING PLOUGH Peginterféron

Plus en détail

Chapitre 2 - Complexité des relations entre génotype et phénotype

Chapitre 2 - Complexité des relations entre génotype et phénotype Chapitre 2 - Complexité des relations entre génotype et phénotype Chaque chromosome est en double exemplaire Donc chaque gène (situé sur son locus) est en double exemplaires : et peut être sous différente

Plus en détail

Phénotypage de l asthme : En pratique. Lilia Malot, Pneumo-pédiatre Allergologue

Phénotypage de l asthme : En pratique. Lilia Malot, Pneumo-pédiatre Allergologue Phénotypage de l asthme : En pratique Lilia Malot, Pneumo-pédiatre Allergologue Asthme du nourrisson Enfant d âge préscolaire < 3 ans Diagnostic d asthme la première année de vie : épisodes itératifs de

Plus en détail

- CONFIDENTIEL - Postes ouverts ULB - BT. [20110115_postes] Version : 1 Auteur: IB Date: 20110115 Pg. 1/7 BONE THERAPEUTICS. Postes ouverts ULB - BT

- CONFIDENTIEL - Postes ouverts ULB - BT. [20110115_postes] Version : 1 Auteur: IB Date: 20110115 Pg. 1/7 BONE THERAPEUTICS. Postes ouverts ULB - BT [20110115_postes] Version : 1 Auteur: IB Date: 20110115 Pg. 1/7 BONE THERAPEUTICS [20110115_postes] Version : 1 Auteur: IB Date: 20110115 Pg. 2/7 Technicien de Laboratoire Le laboratoire de Biologie Osseuse

Plus en détail

Évaluation du risque cardiovasculaire dans le contexte de l hypertension artérielle et de son traitement

Évaluation du risque cardiovasculaire dans le contexte de l hypertension artérielle et de son traitement Évaluation du risque cardiovasculaire dans le contexte de l hypertension artérielle et de son traitement DIU HTA François Gueyffier Service de pharmacologie clinique UMR CNRS 5558 CIC 201, LYON francois.gueyffier@chu-lyon.fr

Plus en détail

Le Plan cancer 2009-2013 en France : pilotage et bilan d étape

Le Plan cancer 2009-2013 en France : pilotage et bilan d étape Le Plan cancer 2009-2013 en France : pilotage et bilan d étape Symposium Plan cancer Bruxelles, 26 novembre 2012 Catherine Morin, responsable du suivi du Plan cancer - INCa Sommaire de la présentation

Plus en détail

DIAPOSITIVE 1 Cette présentation a trait à la réglementation sur les thérapies cellulaires.

DIAPOSITIVE 1 Cette présentation a trait à la réglementation sur les thérapies cellulaires. Produits de thérapie cellulaire DIAPOSITIVE 1 Cette présentation a trait à la réglementation sur les thérapies cellulaires. DIAPOSITIVE 2 La fabrication des thérapies cellulaires est examinée par la Division

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES

TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES Classement NABM : non inscrit code : non codé DÉCEMBRE 2006 Service évaluation des actes professionnels

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

It was generally thought that genes were almost always present in two copies in a genome.

It was generally thought that genes were almost always present in two copies in a genome. COPY NUMBER VARIATION (CNV) It was generally thought that genes were almost always present in two copies in a genome. However, recent discoveries have revealed that large segments of DNA, ranging in size

Plus en détail

Statistique en grande dimension pour les données génomiques

Statistique en grande dimension pour les données génomiques Statistique en grande dimension pour les données génomiques Franck Picard UMR CNRS-5558, Laboratoire de Biométrie et Biologie Evolutive franck.picard@univ-lyon1.fr January 10, 2014 F. Picard, 1/90 Outline

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

F.Benabadji Alger 22.11.13

F.Benabadji Alger 22.11.13 F.Benabadji Alger 22.11.13 ALLERGIE DANS LE MONDE 4ÉME RANG MONDIAL (OMS) PROBLÈME DE SANTÉ PUBLIQUE LES CAUSES Notre environnement (industriel, technologique, scientifique et climatique) * Allergènes

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Hépatite C une maladie silencieuse..

Hépatite C une maladie silencieuse.. Hépatite C une maladie silencieuse.. F. Bally Centre de Maladies Infectieuses et Epidémiologie Institut Central des Hôpitaux Valaisans Histoire Années 70 Hépatite non-a-non-b = hépatite post-transfusionelle

Plus en détail

La politique européenne de la Mutualité Française en matière de dispositifs médicaux

La politique européenne de la Mutualité Française en matière de dispositifs médicaux La politique européenne de la Mutualité Française en matière de dispositifs médicaux Assises du Médicament GT 6 Sabine Bonnot Chargée de mission Politique des produits de santé 6 avril 2011 Sommaire: -

Plus en détail

Tests de détection de la production d Interferon gamma pour le diagnostic des infections tuberculeuses

Tests de détection de la production d Interferon gamma pour le diagnostic des infections tuberculeuses Tests de détection de la production d Interferon gamma pour le diagnostic des infections tuberculeuses Recommandations de l HAS Lille le 23 Octobre 2007 Tuberculose infection et tuberculose-maladie Contact

Plus en détail

Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011

Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011 Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011 Projet ANRS-12186 Évaluation de l échec virologique et résistance aux ARV chez des patients VIH positifs pris en charge dans les programmes

Plus en détail

Quel apport de l imagerie dans les traitements anti-angiogéniques?

Quel apport de l imagerie dans les traitements anti-angiogéniques? Quel apport de l imagerie dans les traitements anti-angiogéniques? L Fournier, D Balvay, CA Cuénod Service de radiologie, Hôpital Européen Georges Pompidou Laboratoire de Recherche en Imagerie, Equipe

Plus en détail

STATION 1A Plateforme de séquençage de nouvelle génération

STATION 1A Plateforme de séquençage de nouvelle génération STATION 1A Plateforme de séquençage de nouvelle génération Dr JACQUES SIMARD Le mandat de cette plateforme est d offrir l expertise à la fine pointe de la technologie afin de générer des données de séquence

Plus en détail

d évaluation de la toux chez l enfant

d évaluation de la toux chez l enfant Validation d un questionnaire d évaluation de la toux chez l enfant Mémoire présenté par Caroline TROCCY Pour l obtention du diplôme de master(e) en kinésithérapie Promoteur: Monsieur G. Reychler Année

Plus en détail

Transplantation pulmonaire et mucoviscidose. Optimiser la prise en charge médicale

Transplantation pulmonaire et mucoviscidose. Optimiser la prise en charge médicale Transplantation pulmonaire et mucoviscidose Optimiser la prise en charge médicale Dr Isabelle Danner-Boucher CRCM adulte de Nantes Unité de Transplantation Thoracique 11èmes Journées Scientifiques de la

Plus en détail

Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011

Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011 Mesure 21 SOINS ET VIE DES MALADES Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011 COLLECTION Rapports & synthèses POUR UN ACCÈS AUX THÉRAPIES CIBLÉES : - LES PLATEFORMES

Plus en détail

La médecine personnalisée

La médecine personnalisée La médecine personnalisée Clément Cousin Notes de l atelier s étant tenu à Science Po le 20 mai 2014 dans le cadre de la Semaine doctorale intensive clement.cousin@riseup.net Table des matières 1 Définition

Plus en détail