Bases de données des mutations

Dimension: px
Commencer à balayer dès la page:

Download "Bases de données des mutations"


1 Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, septembre 2014

2 Accès libre Initiée en 1989, consortium «Cystic Fibrosis Genetic Analysis» Catalogue de variations du gène CFTR Soumission par les labos lors de la 1ere identification du variant Septembre 2014

3 Nom «HGVS» Nom usuel Génotype Contributeur Clinique Mise à jour ou info supp Annotations phénotypique, génotypique limitées

4 2010 Application nomenclature HGVS

5 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del

6 2010 Application nomenclature HGVS CFMDB HGVS Codon stop p.gly542x p.gly542ter ou p.gly542* Gde délétion bornes? c.(?_2989)_(3468_?)del c.2989-?_3468+?del Deep intronic kbA>G c kba>g c a>g kbC->T c c>t c c>t

7 Insertion : 81 petites insertions 75 % insertion sont dans repeat = duplication dup TCGGCGATGTTTTTT - CTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT TCGGCGATGTTTTTTTCTGGAGAT CFMDB c.227_228inst c.228_229inst c.233_234inst c.49_50instt HGVS c.233dup c.233dup c.233dup c.49_50dup Délétion del CAGACATATACCAAATCC CAGACATATACCAAATCC CAGACATACCAAATCC CAGACATACCAAATCC CFMDB HGVS c.111_112 delat c.112_113del

8 Guidelines HGVS NM_ :c.112_113del

9 Accès libre Initié en 2009 Implication phénotypique et fonctionnelle des variants CFTR => mutation CF causing quand en trans CF causing? => critères cliniques des patients

10 25 Registres CF patients Clinique TS (62 %) fonction pulmonaire (63 %) statut pancréatique (76 %) colonisation pseudomonas 89% variants identifiés variations différentes 159 variations, fréq allélique 0,01% 96% des allèles CF identifiés

11 variations, fréquence allélique 0,01% évaluation clinique et fonctionnelle chez les patients 80 PTC => CF causing! 2 délétions en phase (507 et 508del) 10 site épissage => impact ARN? 65 faux sens => impact protéine? fq chez pères et dans 1,000 génomes

12 CFTR2 web 200 mutations caractérisées

13 127 (129) (12) (6) CFTR2 web 200 mutations caractérisées

14 MOYENNES TS f pulmonaire PI/PS Pseudomonas âge Résumé résultats études fonctionnelles (Nat Genet)

15 Nomenclature HGVS : mêmes remarques que CFMDB 15 insertions décrites => 13 erreurs ins au lieu de dup 5T c [5] c t[5]

16 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Initiée en Décembre 2008 Collaboration entre 9 laboratoires de niveau 2 et Vaincre La Mucoviscidose Accès restreint aux collaborateurs

17 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale

18 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

19 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Compiler : TOUS les phénotypes CF Mais aussi CFTR-RD Sujets sains hétérozygotes composites Suspicion fœtale de mucoviscidose CFTR- France Curation à Montpellier TOUTES les variations Causales Non-classées (Supposés) Neutres +/- ségrégation familiale Résultats des outils bioinformatiques Données issues de la littérature Pour : Annoter les variants Analyser les corrélations génotype/phénotype Interpréter la pathogénicité des variants non-classés Favoriser les études collaboratives

20 CFTR-France Les objectifs Les phénotypes Les variants L interprétation individus

21 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

22 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55%

23 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Corrélations génotype-phénotype Les variations «large spectre» Exemples : L206W, R347H, S945L Unclassified variants 37% Disease-causing 55% Classées «CF-causing» par CFTR2 mais pas que CFTR-France (trans mut sévère) L206W : 21 CF et 31 CFTR-RD R347H : 18 CF et 10 CFTR-RD S945L : 12 CF et 5 CFTR-RD Important pour le conseil génétique

24 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% Corrélations génotype-phénotype Les associations de variants en cis Exemples : Connu : CFTR2 CFTR-France I148T ; 3199del6 8 patients S1251N ; F508C X 7 patients V754M ; CFTRdele3-10,14b-16 X 3 patients Moins connu : G622D ; G>A X 6 patients (2 ségrégations) Important pour la pratique quotidienne des laboratoires de diagnostic

25 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Non disease-causing 8% Unclassified variants 37% Disease-causing 55% 74 % de faux-sens

26 CFTR-France Les objectifs Les phénotypes Les variants L interprétation 719 variants différents variants total Occurrence des 198 faux-sens non-classés Non disease-causing 8% > 10x 6x y 10x Unclassified variants 37% Disease-causing 55% 3x y 5x 2x Difficile à interpréter 74 % de faux-sens gros travail à réaliser pour caractériser ces faux-sens! ( 7% étiquetés dans CFTR2)

27 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants?

28 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients

29 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients Juin 2013 : convention entre le Registre National et CFTR-France : échanges de données - Banque de données patients (infos cliniques +++ et mutations causales) - Données proviennent des CRCM CF +++ mais aussi DNN et quelques CFTR-RD - Dernier bilan annuel : données patients suivis MAJ annuelle / suivi du patient Erreur possible de retranscription des mutations et génotype incomplet

30 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - -

31 Collaboration CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 1 / Compléter et affiner les données cliniques des patients + CFTR-France + Registre Données cliniques précises/complètes + suivi patient Correction/complément génotype - CF : 43 % TS -F508del / I148T F508del / 3199del6;I148T - CF : 33 % PI/PS -F508del / G827X F508del / E827X - suivi NBS ( 450 enfants) -F508del / C>T F508del /? - - Données anonymisées Recherche des correspondances patients communs entre les 2 banques CF (50% des CF de CFTR-France) 121 CFTR-RD 304 NBS données cliniques du registre en attente

32 CFTR-France Les objectifs Les phénotypes Les variants L interprétation Comment faciliter l interprétation des variants? 2 / Recenser les études fonctionnelles publiées Seibert et al Sosnay et al Van Goor et al / Caractériser l impact fonctionnel de variations Prédictions bioinformatiques (198 faux-sens) Etudes in vitro Etudes ex vivo => projet collaboratif : analyse fonctionnelle 19 faux-sens (impact sur épissage prédit)

33 CFTR-France Bientôt un accès public

34 CFTR-France Bientôt un accès public Infos générales -CFTR-France - gène et protéine - variations (nomenclature HGVS, classification, ) - CFTR-opathies Moteur de recherche variant Statistiques - variations - génotypes - phénotypes

35 Merci de votre attention

E. Girodon-Boulandet Biochimie et Génétique moléculaire, Hôpital Cochin, Paris

E. Girodon-Boulandet Biochimie et Génétique moléculaire, Hôpital Cochin, Paris Génétique Génétique de de la la mucoviscidose mucoviscidose E. Girodon-Boulandet Biochimie et Génétique moléculaire, Hôpital Cochin, Paris Génétique formelle Diagnostic positif

Plus en détail

Nomenclature décryptée des mutations du gène CFTR

Nomenclature décryptée des mutations du gène CFTR Nomenclature décryptée des mutations du gène CFTR Emmanuelle Girodon Martin J Schwarz 11e Journées Scientifiques de la Société Française de la Mucoviscidose Paris, 12 Mars 2015 Introduction Rationnel Les

Plus en détail

10.25/2. Shéma du processur de fibrose kystique sur une glande

10.25/2. Shéma du processur de fibrose kystique sur une glande Thème 1-A : Expression, stabilité et variation du patrimoine génétique TP 6 : La mucoviscidose : multiples échelons d un phénotype La mucoviscidose présente des indications visibles qui constituent un

Plus en détail

Les maladies autosomiques récessives

Les maladies autosomiques récessives Les maladies autosomiques récessives Emmanuelle HAQUET (MPCG-PhD) Conseillère en génétique CHRU Arnaud de Villeneuve, Montpellier, France Définition Une maladie génétique est autosomique quand le gène

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail



Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx 1 / 35 2 / 35 Contexte 3 / 35 Risque cumulé de cancer à 70 ans Cancer du sein

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida

La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida DÉBAT POURTOUR MÉDITERRANÉEN Quels sont les partenariats existants? Quels sont les manques? La Mucoviscidose en Algérie R. Boukari Service de Pédiatrie CHU Blida Présidente de la Société Algérienne de

Plus en détail

Formes révélées à l âge adulte. Dr S. Durupt CRCM adulte Lyon

Formes révélées à l âge adulte. Dr S. Durupt CRCM adulte Lyon La Mucoviscidose Formes révélées à l âge adulte Dr S. Durupt CRCM adulte Lyon Mucoviscidose Maladie complexe touchant de multiples organes Facteur(s) génétique(s) Facteurs infectieux Facteurs nutritionnels-métaboliques

Plus en détail

Stratégies thérapeutiques dans la mucoviscidose en 2010

Stratégies thérapeutiques dans la mucoviscidose en 2010 Stratégies thérapeutiques dans la mucoviscidose en 2010 Gène anormal Protéine anormale Transport ionique altéré Mucus anormal Inflammation Infection Destruction tissulaire Thérapie génique Thérapie protéique

Plus en détail

Notice destinée au médecin : test à 139 variants de la

Notice destinée au médecin : test à 139 variants de la Notice destinée au médecin : test à 139 variants de la fibrose kystique MiSeqDx(MC) DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT Tests génétiques et fibrose kystique La fibrose kystique est une maladie chronique

Plus en détail

UE GENETIQUE D.C.E.M. 1. Génétique moléculaire :

UE GENETIQUE D.C.E.M. 1. Génétique moléculaire : Université Bordeaux Segalen UE GENETIQUE D.C.E.M. 1 Année universitaire 2011-2012 Génétique moléculaire : Identification et conséquences des mutations. Exemple de la mucoviscidose (gène CFTR) Dr Caroline

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

Albinisme oculo-cutané : un peu de chemin parcouru ensemble.

Albinisme oculo-cutané : un peu de chemin parcouru ensemble. Albinisme oculo-cutané : un peu de chemin parcouru ensemble. Benoît Arveiler Laboratoire de Génétique Moléculaire, Service de Génétique Médicale CHU de Bordeaux Laboratoire Maladies Rares: Génétique et

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES Plate forme génomique NCCR Frontiers in Genetics Université de Genève

Plus en détail

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement.

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Les gènes gouvernent la synthèse des protéines qui participent à la réalisation du phénotype mais d'autres éléments, comme

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale Martin Krahn Département de Génétique

Plus en détail

Hérédité mendélienne Autosomique récessive (AR)

Hérédité mendélienne Autosomique récessive (AR) Professeur Odile BOESPFLUG-TANGUY Service de Neurologie Pédiatrique et des Maladies Métaboliques INSERM UMR 676 Hôpital Robert Debré GENETIQUE MEDICALE Hérédité mendélienne

Plus en détail



Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Annales du contrôle national de qualité des analyses de biologie médicale

Annales du contrôle national de qualité des analyses de biologie médicale Annales du contrôle national de qualité des analyses de biologie médicale Caractéristiques génétiques à des fins médicales 11CGM1 Décembre 2011 Mucoviscidose (gène CFTR) Thrombophilies (gènes F2 et F5)

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

QCM 1. QCM génétique QCM 1 QCM 2 QCM 3 QCM 2 17/03/2010

QCM 1. QCM génétique QCM 1 QCM 2 QCM 3 QCM 2 17/03/2010 QCM 1 QCM génétique Thomas Briot Interne, Pharmacie Dans l étude d un arbre généalogique, un seul des critères suivants est spécifique de l hérédité autosomique dominante: 1. Sujets atteints à chaque génération

Plus en détail

Elucigene CF-EU2v1 Mode d emploi

Elucigene CF-EU2v1 Mode d emploi Elucigene CF-EU2v1 Mode d emploi Code cat. : CF2EUB2 50 tests CF2EUBX 10 tests Dispositif de diagnostic in vitro Fabriqué par Elucigene Diagnostics Elucigene Diagnostics Greenheys House Pencroft Way Manchester

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine Recherche et médecine personnalisée : le point de vue de l oncogénéticien Dr Dugast catherine cc Dépistage de masse K sein chez mère 60 ans, nulliparité? Antécédent de hodgkin à 15 ans???? Quel est mon

Plus en détail

Haplotype ancestral AH8.1 dans la mucoviscidose

Haplotype ancestral AH8.1 dans la mucoviscidose Haplotype ancestral AH8.1 dans la mucoviscidose Julie Beucher Directeur de thèse H. Corvol Unité INSERM U938, Hôpital St Antoine Mucoviscidose et gènes modificateurs Variabilité de la sévérité de l atteinte

Plus en détail

Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris

Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris Mucoviscidose : Explorations fonctionnelles diagnostiques Isabelle Fajac Hôpital Cochin, Paris DES, 12 Dec 2014 Mucoviscidose : historique DH Andersen P di Sant'Agnese M Knowles RC Boucher LC Tsui M Welsh

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

BONNES PRATIQUES DES ETUDES DU GENE CFTR Page : 1/33 Référence : ANPGM_ 074_3 Numéro de version : 4.0

BONNES PRATIQUES DES ETUDES DU GENE CFTR Page : 1/33 Référence : ANPGM_ 074_3 Numéro de version : 4.0 Page : 1/33 Date de la remise à jour : Septembre 2016 (version 4) Motif : actualisation Validation : Date de Création : 2004 Date de validation en assemblée plénière : Nom Hôpital Date Rédacteur(s) Dr

Plus en détail

Difficulté de la technique

Difficulté de la technique Difficulté de la technique Le tissu dans 95% des cas, tissu fixé l ADN est de mauvaise qualité (cassé, modifié chimiquement par les fixateurs) artefacts au séquençage. Si un artefact est suspecté, il faut

Plus en détail

Thème 3B: Variation génétique et Santé

Thème 3B: Variation génétique et Santé Thème 3B: Variation génétique et Santé Chapitre 1 Patrimoine génétique et santé Introduction La mucoviscidose touche en France environ 1 nouveau-né sur 4200. Quel lien peut-on établir entre anomalie génétique

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Ch5 : Variation génétique et médecine

Ch5 : Variation génétique et médecine T3 : Corps humain et santé T3/U1 : Variation génétique et santé Ch5 : Variation génétique et médecine I. Les maladies génétiques germinales A. Rappel et définitions Une maladie est dite génétique germinale

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Pancréatites génétiques

Pancréatites génétiques Pancréatites génétiques Pr Philippe RUSZNIEWSKI Fédération Médico-Chirurgicale d'hépato-gastroentérologie Hôpital Beaujon, Clichy 23èmes Journées de la FMC-HGE Paris, 2 avril 2005 Connaître les principales

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011)

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011) UP-CNV 2.0 Banque de données en ligne répertoriant les CNVs (Copy Number Variations) identifiés par CGH-array chez les patients atteints de retard mental, anomalie du développement 2.0 Projet financé par

Plus en détail

Foire Aux Questions. 2. Que signifie être homozygote/hétérozygote pour un gène?

Foire Aux Questions. 2. Que signifie être homozygote/hétérozygote pour un gène? Foire Aux Questions Orkambi : une combinaison de molécules (ivacaftor + lumacaftor) pour des patients atteints de mucoviscidose porteurs de deux copies de la mutation F508del (homozygotes) Cette FAQ n

Plus en détail

Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH

Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH Polypose-SYN-Mutation-Mutyh-CVT:4 pages 24/06/11 15:53 Page 1 Mesure 23 SOINS ET VIE DES MALADES JUIN 2011 Synthèse de l expertise sur La polypose associée aux mutations bi-alléliques du gène MUTYH COLLECTION

Plus en détail

La mucoviscidose est une maladie génétique fréquente, provoquée par la mutation d un gène qui est présent sous cette forme chez une personne sur 40.

La mucoviscidose est une maladie génétique fréquente, provoquée par la mutation d un gène qui est présent sous cette forme chez une personne sur 40. CHAPITRE 5 : Variation génétique et santé (Le patrimoine génétique et le développement d une maladie ; les variations du génome et le développement d une maladie) Introduction : Le phénotype d un individu

Plus en détail

La médecine personnalisée appliquée à la mucoviscidose

La médecine personnalisée appliquée à la mucoviscidose La médecine personnalisée appliquée à la mucoviscidose Harriet Corvol Centre de Ressources et de Compétences de la Mucoviscidose Centre de Référence des Maladies Respiratoires Rares Service de pneumologie

Plus en détail

Nouvelles mutations RAS

Nouvelles mutations RAS Nouvelles mutations RAS dans les cancers colo-rectaux Rappel RAS : interrupteur de plusieurs voies de signalisation ras MUTATION RAS /ras activé en permanence : signalisation continue de la prolifération

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Chapitre 6 L interaction des gènes

Chapitre 6 L interaction des gènes Chapitre 6 L interaction des gènes La variation dans la coloration de la coquille Saint-Jacques (Argopecten irradians) due à trois allèles d un même gène Des gènes aux phénotypes 1- La relation entre les

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE


Plus en détail


CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Une polypose peut cacher

Une polypose peut cacher Une polypose peut cacher une mucoviscidose Journées DES 6 et 7 mars 2009 E.MEZGUELDI Service de pneumologie du Pr BELLON C est l histoire d Anton, né le 18/08/1997 ATCD perso : né à 40 SA PN = 3290g taille

Plus en détail

Vaincre la Mucoviscidose. Guide de présentation

Vaincre la Mucoviscidose. Guide de présentation Vaincre la Mucoviscidose Guide de présentation Association Vaincre la Mucoviscidose 181, rue de Tolbiac ; 75013 Paris Tél. : 01 40 78 91 91 ; Fax : 01 45 80 86 44 ;

Plus en détail 1 CHAPITRE N 1 : LA MUCOVISIDOSE Correction du TP mucoviscidose 1) Les phénotypes de la mucoviscidose a) Phénotype macroscopique

Plus en détail

I. TOUITOU (Mise ligne 20/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 20/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes Incidence des lois de Mendel au conseil génétique: Calcul de risque à priori Risque pour la descendance: Suit la loi binomiale Soit une famille de 3 enfants: 1. Le père est atteint d une maladie AD Calculer

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Mucoviscidose (gène CFTR) Hémochromatose (gène HFE) Thrombophilies (gènes F2 et F5) Caractéristiques génétiques à des fins médicales

Plus en détail

Mucoviscidose. Caractéristiques cliniques de la maladie

Mucoviscidose. Caractéristiques cliniques de la maladie Mucoviscidose La mucoviscidose (MIM# 219700) est la plus fréquente des maladies héréditaires graves dans la population blanche, puisqu elle touche près de 1individu sur 2500 (toutes formes cliniques confondues).

Plus en détail

Analyses - Liste des analyses à accompagner d'une attestation de consultation

Analyses - Liste des analyses à accompagner d'une attestation de consultation Analyses - Liste des analyses à accompagner d'une attestation de consultation Libellé Document a joindre au prelevement Acétylcholinestérase - liquide amniotique attestation de consultation et consentement

Plus en détail

examen clé du diagnostic ; indication multiples 3 étapes : stimulation de la sudation recueil de la sueur dosage du chlore et / ou du sodium

examen clé du diagnostic ; indication multiples 3 étapes : stimulation de la sudation recueil de la sueur dosage du chlore et / ou du sodium LA MUCOVISCIDOSE I/ Introduction Maladie héréditaire, génétique, la plus fréquente, qui affecte essentiellement la population caucasienne ; ce sont principalement des mutations fonctionnelles ; plus de

Plus en détail

Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux. Michèle BERTHIER : SCOR GLOBAL LIFE

Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux. Michèle BERTHIER : SCOR GLOBAL LIFE Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux Michèle BERTHIER : SCOR GLOBAL LIFE Présentation faite en collaboration avec le Dr Gabriela BUFFET, Médecin-Conseil

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail


CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Formes familiales du cancer colorectal

Formes familiales du cancer colorectal Tlemcen, 05/05/06 Formes familiales du cancer colorectal Emmanuel Mitry Fédération des spécialités digestives CHU Ambroise Paré AP-HP épithélium! normal! cancer sporadique :! M1! M2! M3!... Mn! tumeur!

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Prédisposition génétique aux cancers

Prédisposition génétique aux cancers Prédisposition génétique aux cancers Plan de cours I-Introduction I-1 Fréquence des mutations I-2 Objectifs médicaux de l oncogénétique I-3 Rappels sur la prolifération cellulaire tumorale; la théorie

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

La transition. Dr Llerena pneumo-pédiatre CRCM Grenoble Véronique Vion Genovese MK CRCM Grenoble Claire Tamain maman CRCM bordeaux

La transition. Dr Llerena pneumo-pédiatre CRCM Grenoble Véronique Vion Genovese MK CRCM Grenoble Claire Tamain maman CRCM bordeaux La transition Dr Llerena pneumo-pédiatre CRCM Grenoble Véronique Vion Genovese MK CRCM Grenoble Claire Tamain maman CRCM bordeaux .. Nous ne sommes pas des psychologues.. Confidentialité Bienveillance

Plus en détail

Plateformes hospitalières de génétique moléculaire des cancers

Plateformes hospitalières de génétique moléculaire des cancers Plateformes hospitalières de génétique moléculaire des cancers Biomarqueurs et cancers o Identification d altérations génétiques au sein des cellules cancéreuses => nouveaux biomarqueurs moléculaires diagnostic

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

Singularités et surprises du diagnostic génotypique CFTR : à partir de quelques observations. Kuentz P., Rozé V.,Bresson J.L.

Singularités et surprises du diagnostic génotypique CFTR : à partir de quelques observations. Kuentz P., Rozé V.,Bresson J.L. Singularités et surprises du diagnostic génotypique CFTR : à partir de quelques observations Kuentz P., Rozé V.,Bresson J.L. CFTR : singularités Fréquence de l hétérozygotie dans la population : 1/30 CFTR

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Banque Nationale de Données Maladies Rares (BNDMR), APHP Hôpital Necker Enfants Malades, Paris, France c

Banque Nationale de Données Maladies Rares (BNDMR), APHP Hôpital Necker Enfants Malades, Paris, France c Prévalence de la cystinose en France, observance du traitement et coûts directs pour l assurance maladie : base de données de l assurance maladie (SNIIRAM) et BNDMR S. Kelley-Causeret a, A. Weill a, R.

Plus en détail

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient Laboratoires Saint Julien & Beaulieu L'attestation de consultation doit être délivrée par le prescripteur. Un formulaire de consentement est disponible au laboratoire du même type qu à la page 68 de ce

Plus en détail



Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Octobre 2014 Médecine «génomique» personnalisée La médecine «génomique» personnalisée repose sur l identification de sous-groupes de

Plus en détail

Aurora Kinase C: un marqueur moléculaire de l infertilité masculine.

Aurora Kinase C: un marqueur moléculaire de l infertilité masculine. Aurora Kinase C: un marqueur moléculaire de l infertilité masculine. N. Hamdis*, N. Boucekkine**, N. Kaci*, A. Oumeziane**, L. Siad**, M. Ouandjeli**, N. Zaabat,*** * Université USTHB, ALGER ** Centre

Plus en détail

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Métabolisme du fer : hepcidine Fer absorbé par les entérocytes des villosités duodénales : transporteur

Plus en détail

Génétique Moléculaire. Filière DéfiScience 16 janvier 2015

Génétique Moléculaire. Filière DéfiScience 16 janvier 2015 Génétique Moléculaire Filière DéfiScience 16 janvier 2015 Proposition d organisation nationale des diagnostics moléculaires de DI DI syndromiques NGS panels ciblés Variant(s) causal identifié Variant non

Plus en détail

La recherche BRAF : intérêts et limites en 2013

La recherche BRAF : intérêts et limites en 2013 La recherche BRAF : intérêts et limites en 2013 Réunion GFPC Paris, décembre 2013 Pr D Damotte Pathologie Hôpitaux universitaires paris centre BRAF: voie MEK / ERK AMM mélanome en 2011 La recherche BRAF

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Impartir la gestion du système informatisé de votre bibliothèque juridique au CAIJ, pourquoi pas?

Impartir la gestion du système informatisé de votre bibliothèque juridique au CAIJ, pourquoi pas? Impartir la gestion du système informatisé de votre bibliothèque juridique au CAIJ, pourquoi pas? Conférenciers invités: Me Marc DesRosiers Madame Sonia Loubier Leg@l.IT 3.0 21 avril 2009 Plan de la présentation

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Role du microbiota pulmonaire dans la mucoviscidose

Role du microbiota pulmonaire dans la mucoviscidose 29. März 2014 Role du microbiota pulmonaire dans la mucoviscidose Gaudenz Hafen, MD & MER1 Médecin assoicé Résponsable de l unité pneumologie et mucoviscidose pédiatrique Table des matières 1. Introduction

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Repenser le cancer de l ovaire après. Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu

Repenser le cancer de l ovaire après. Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu Repenser le cancer de l ovaire après Jérôme ALEXANDRE, Université Paris Descartes, Oncologie, GH Cochin Hôtel Dieu Objectifs Faire une recherche exhaustive des anomalies génétiques et épigénétiques des

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

Protocole d étude de l évaluation des résultats des centres de FIV 2011 1. -Activité 2011-

Protocole d étude de l évaluation des résultats des centres de FIV 2011 1. -Activité 2011- Protocole d étude Evaluation des résultats des centres de FIV -Activité 2011- Contexte Depuis 2005, l Agence de la biomédecine a pour mission de suivre et d évaluer les activités cliniques et biologiques

Plus en détail



Plus en détail

Mucoviscidose. Manifestations cliniques

Mucoviscidose. Manifestations cliniques Mucoviscidose Delphine Feldmann Laboratoire de Biochimie,Biologie Moléculaire Hôpital A Trousseau Historique : Maladie héréditaire h Modifications ioniques : Elévation du Cl et du Na sudoral (di Sant Agnese

Plus en détail