Introduc)on à Ensembl/ Biomart : Par)e pra)que

Dimension: px
Commencer à balayer dès la page:

Download "Introduc)on à Ensembl/ Biomart : Par)e pra)que"

Transcription

1 Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller

2 NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que

3 Exercice 1 1.a. Quelle est la version de l assemblage du génome humain disponible sur la dernière version du site d Ensembl? 1.b. Quelle est la taille du génome du panda? Regarder le Base Pairs Regarder le Golden Path Length 1.c. Quelle est la taille du génome humain? Regarder le Base Pairs Regarder le Golden Path Length 3 Naviga)on dans Ensembl : Pra)que

4 Réponse à la ques)on 1.a GRCh37 4

5 Réponse à la ques)on 1.b 5

6 Réponse à la ques)on 1.c Taille du génome humain 6

7 Exercice 2 Quelle est la version du génome du rat- taupe nu? (Heterocephalus glaber) Combien de gènes ont été prédits par Genscan? 7 Naviga)on dans Ensembl : Pra)que

8 Réponse à la ques)on 2 8

9 Ques)on 3 Retrouver la taille du chromosome 4 dans le génome humain assemblage hg19 9 Naviga)on dans Ensembl : Pra)que

10 Réponse 3 10

11 Exercice 4 4.a - Combien de transcrits alterna)fs possède le gène BBS5 (chez l Homme) 4.b - Combien d exons possède le transcript BBS c - Combien d exons sont codants? Remarque - Comparer les couleurs d affichages de transcrits BBS5-001 et BBS Naviga)on dans Ensembl : Pra)que

12 Réponse 4.a 7 transcrits alterna)fs 12

13 Réponse 4.b 4 exons 13

14 Réponse 4.b.c 0 exon codant 14

15 Exercice 5 Retrouver ce`e page 15 Naviga)on dans Ensembl : Pra)que

16 Réponse 5 16

17 Exercice 6 Retrouver ce`e page 17 Naviga)on dans Ensembl : Pra)que

18 Réponse 6 18

19 Exercice 7 Déterminer le nombre total de varia)ons dans le gène BRCA1 19 Naviga)on dans Ensembl : Pra)que

20 Réponse 7 20

21 Exercice 8 Afficher dans le navigateur de génome les données d expression (RNAseq) dans deux )ssus (breast, skeletal muscle) au niveau du gène BRCA1 21 Naviga)on dans Ensembl : Pra)que

22 Réponse 8 22

23 Exercice 9 Afficher les termes GO associés aux transcrits BRCA Naviga)on dans Ensembl : Pra)que

24 Réponse 9 24

25 Exercice 10 Mener l enquête pour retrouver le nouvel iden)fiant Ensembl (gène) pour le gène : ENSG

26 Réponse 10

27 Exercice 11 Visualiser le fichier unique_crn- 107.bam dans Ensembl Adresse : jp://jp- igbmc.u- strasbg.fr/pub/ slegras/dudijon/unique_crn- 107_11.bam Aller voir le gène BBS1

28 Réponse 11

29 OUTILS : PARTIE PRATIQUE

30 Exercice BLAST Quel est la localisa)on génomique de BBS1? Séquence protéique: Recherche de la séquence protéique BBS1 dans les archives du génome humain août h`p://www- bio3d- igbmc.u- strasbg.fr/~jmuller/enseignement.html h`p://www.ensembl.org/info/website/archives/index.html TBLASTN sur le génome humain

31 PlateForMe

32 Est- ce que le chromosome 9 est la bonne localisaeon?

33 Exercice BLAST

34 Exercice BLAST

35 Exercice BLAST

36 Exercice BLAST LocalisaEon sur le chromosome 11

37 Alignement vs génome Plusieurs HSP 100% ID E- value plus élevée car calculée sur le chromosome en en)er 1 ou 2 HSP >80% ID E- value plus faible car alignement en un seul bloc

38 Exercice BLAST Est- ce bien le gène BBS1?

39 Exercice BLAST

40 BIOMART : PARTIE PRATIQUE 40 Naviga)on dans Ensembl : Pra)que

41 Exercice 1 Retrouver les iden)fiants Ensembl du gène et de tous les transcrits du gène BBS1 chez l Homme En entrée : Gène BBS1 (Gene Symbol) En sor)e : Ensembl Gene ID Ensembl Transcript ID Associated Gene Name 41 BioMart

42 Réponse 1 42

43 Exercice 2 Extraire toutes les séquences de tous les exons du gène BRCA1 Dans les entêtes, il devra y avoir : Associated gene name Ensembl Transcript ID Ensembl Exon ID 43

44 Résultat 2

45 Exercice 3 Extraire les séquences codantes des transcrits du gène BRCA1 (iden)fiant Ensembl : ENSG ) Dans les entêtes, il devra y avoir : Ensembl Transcript ID Ensembl Exon ID

46 Résultat 3

47 Exercice 4 A par)r des coordonnées chromosomiques suivantes : chr chr Répondez aux ques)ons suivantes : Dans quel(s) gènes(s) se trouve- t- on? Si l on est dans un gène, récupérer les termes GO associés aux gènes Combien de variants germinaux con)ennent les régions

48 Réponse 4

49 Remarques Coordonnées commencent à 1 (a`en)on dans UCSC, les coordonnées commencent à 0) A`en)on pas de prefix chr devant les noms des chromosomes A`en)on chromosome Mitochondrial = MT dans Ensembl alors qu il est M dans UCSC Lié à Galaxy 49 Ensembl : fonc)onnement

MODULE 4 Introduction à IGV

MODULE 4 Introduction à IGV MODULE 4 Introduction à IGV Jean-Baptiste Rivière jean-baptiste.riviere@u-bourgogne.fr 22/01/2014 Integrative Genomics Viewer (IGV) Logiciel de visualisation de données génomiques (NGS, microarray, annotations

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Interface Homme- Machine. Interface pour le web

Interface Homme- Machine. Interface pour le web Interface Homme- Machine Interface pour le web Ergonomie du web : Importance Web U7lisateurs novices et nomades (accès libre) Ergonomie des interfaces Web 62% des acheteurs en ligne abandonnent au moins

Plus en détail

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Guide d u(lisa(on de la base de données Odyssea 1 Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Lexique - Marker: POI (Point Of Interest) - URL: Uniform ressource Locator, c est une adresse web

Plus en détail

Présentation de l outil de visualisation cartographique

Présentation de l outil de visualisation cartographique Présentation de l outil de visualisation cartographique L outil de visualisation cartographique permet : - D afficher les stations de mesure du bassin Artois-Picardie - De sélectionner les stations d intérêt

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000)

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) II) Annotation de gènes codant des protéines 1) Objectif du TD L objectif du

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Plateforme de bioinformatique

Plateforme de bioinformatique Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1%

Plus en détail

MEMENTO Gestion du Site Commanderie

MEMENTO Gestion du Site Commanderie MEMENTO Gestion du Site Commanderie Bienvenue dans votre site web Commanderie Pour accéder à votre site Commanderie : http://nom.anysetiers.org Naviguer dans les Pages de votre site : Accueil Calendrier

Plus en détail

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document.

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document. Writer Attention : Les documents faits avec Writer ne pourront être lu qu avec Writer, sauf manipulation permettant l échange avec d autres logiciels. Le logiciel se présente directement avec une page

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

Documentation Askfornet v1.7

Documentation Askfornet v1.7 Documentation Askfornet v1.7 - Page 1 sur 6 Documentation Askfornet v1.7 I. Menu principal Permet de créer un nouveau Permet de gérer vos s Permet de modifier les informations de votre société Permet de

Plus en détail

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe GÉNÉRALITÉS. Découverte 1 A- Présentation générale 1 B- Présentation des applications Office Web Apps 1 C- Les services dédiés au partage 1 1. Espace de travail 2 A- Description de la page d accueil Administrateur

Plus en détail

Sites web propriétaires

Sites web propriétaires Ce document est disponible à : C:\Users\pc_samba\Documents\Doc sites prop.docx Sommaire 1 Introduction... 3 2 Création du mini-site... 4 2.1 Autorisation de création... 4 2.2 Création de votre site Web...

Plus en détail

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail

Développement d une architecture de type GRID pour l analyse des données d expression biologiques

Développement d une architecture de type GRID pour l analyse des données d expression biologiques Développement d une architecture de type GRID pour l analyse des données d expression biologiques O. Delemar, T. Vermat, F. Paillier & M. Deleeuw GENOME express FuturVIEW 2 ntexte biologique : nome et

Plus en détail

Manuel Surintendant. Journal de chantier. Proposé par la CEGQ Copyright 2014 Tous droits réservés

Manuel Surintendant. Journal de chantier. Proposé par la CEGQ Copyright 2014 Tous droits réservés Manuel Surintendant Journal de chantier Proposé par la CEGQ Copyright 2014 Tous droits réservés Présentation du service L application «journal de chantier» est un outil offert gratuitement par la CEGQ

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

AIDE EN LIGNE. Espace Récep0f

AIDE EN LIGNE. Espace Récep0f AIDE EN LIGNE Espace Récep0f 1 2 3 4 5 Page d authen,fica,on Votre nouvel espace récep,f Mode recherche de produits Explorez votre catalogue produits Modifica,on d un produit La créa,on de nouveaux produits

Plus en détail

MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA

MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA OBJECTIFS : manipuler les fenêtres et l environnement Windows, gérer ses fichiers et dossiers, lancer les applications bureautiques présentes sur son poste. PUBLIC

Plus en détail

Exercice 4.1 Gestion des rapports

Exercice 4.1 Gestion des rapports Exercice 4.1 Gestion des rapports Déplacer un document vers un autre dossier Copier un document vers un autre dossier Renommer un document Supprimer un document Dupliquer un rapport Renommer un rapport

Plus en détail

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Octobre 2011 Pour préparer une newsletter, gérer les listes de diffusion ou inscrire plusieurs personnes Codes www.agriculture-moyenne-montagne.org/newsletter/admin

Plus en détail

MEMENTO. Interface d administration du site www.ville-joigny.fr. I. Identification :... 2. II. Présentation de l interface :... 3

MEMENTO. Interface d administration du site www.ville-joigny.fr. I. Identification :... 2. II. Présentation de l interface :... 3 MEMENTO Interface d administration du site www.ville-joigny.fr I. Identification :... 2 II. Présentation de l interface :... 3 III. Modification des pages du site :... 5 A. Chaque paragraphe comporte un

Plus en détail

Commandes de Word 2011 (menus, barres d outils, ruban) 1

Commandes de Word 2011 (menus, barres d outils, ruban) 1 Activer le mode plein Menu affichage > Activer le mode écran écran plein écran adresses de s (ignorer les adresses Internet et les adresses de s) orthographe> case à cocher ignorer les adresses Internet

Plus en détail

Composeur. Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers. 88 Séminaire utilisateurs QGIS

Composeur. Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers. 88 Séminaire utilisateurs QGIS Composeur Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers 88 Séminaire utilisateurs QGIS Composeur de cartes 89 Séminaire utilisateurs QGIS Création d une

Plus en détail

Comment créer une Battle?

Comment créer une Battle? Comment créer une Battle? Mai 2015 Sommaire 3. 4. 5. 6. 7-8. 9. 10. 11. 12. 13-14. 15. 16. 17. 18. 19. Fonc%onnement Choisissez votre type de campagne Choisissez un canal de publica%on Ajoutez une so;

Plus en détail

Concevoir un tableau de bord en ligne

Concevoir un tableau de bord en ligne Concevoir un tableau de bord en ligne Principe Les tableaux de bord en ligne permettent de publier les résultats d une enquête en organisant le contenu dans différentes pages. Ce contenu est actualisé

Plus en détail

WEBSEMINAIRE MES ARTICLES ET MES RUBRIQUES

WEBSEMINAIRE MES ARTICLES ET MES RUBRIQUES WEBSEMINAIRE MES ARTICLES ET MES RUBRIQUES PRESENTATION Cms One2/ 20 04 2015 1 Programme q Introduction Présentation du CMS'One2 q Le module «Mes articles» 1- Nouvelle Saisie de note 2- Insertion de médias

Plus en détail

Rappel : accès aux commandes dans l Explorateur Windows

Rappel : accès aux commandes dans l Explorateur Windows Windows 7 Gestion des fichiers et dossiers Aller plus loin 1 Rappel : accès aux commandes dans l Explorateur Windows Menu contextuel (clic droit souris) Windows traite les lecteurs, dossiers, fichiers,

Plus en détail

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet Serveur WEB AUTOMGEN Pour la réalisation d un superviseur accessible à partir d un navigateur Internet 1 Introduction Le serveur WEB d AUTOMGEN permet de réaliser des applications de supervision accessibles

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes.

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. Choisissez votre modèle Parmi la sélection proposée en ligne. Comment Choisir son modèle en fonction de ses besoins? Niveau Débutant

Plus en détail

Traitement des images par les applications Web PL/SQL. Groupe d intérêt Designer Vendredi 18 février 2005

Traitement des images par les applications Web PL/SQL. Groupe d intérêt Designer Vendredi 18 février 2005 Traitement des images par les applications Web PL/SQL Groupe d intérêt Designer Vendredi 18 février 2005 Plan 1. Introduction 2. Images stockées sur le serveur d application 3. Images stockées comme fichiers

Plus en détail

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014)

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014) Prédiction de gènes Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes Equipe Bonsai (2014) La localisation des gènes C'est la première étape pour interpréter

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

Découvrez la nouvelle solution de cartographie du module de reporting Version du 24 mai 2016

Découvrez la nouvelle solution de cartographie du module de reporting Version du 24 mai 2016 Découvrez la nouvelle solution de cartographie du module de reporting Version du 24 mai 2016 1 Le nouveau module de cartographie Dynamisez vos analyses avec des représentations cartographiques + Les bénéfices

Plus en détail

IFT1148 Développement

IFT1148 Développement IFT1148 Développement Michael Blondin Direction de l enseignement de service en informatique Université de Montréal Hiver 2011 1 / 33 ASP.NET ASP.NET est un ensemble de technologies développé par Microsoft

Plus en détail

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre Introduc)on à Drupal Journées Mathrice, octobre 2010 par Kenji Lefèvre Sommaire 1. Présenta>on succincte 2. À qui s adresse Drupal? 3. Avantages et difficultés 4. Architecture, administra>on Drupal 5.

Plus en détail

Une interface moderne et multi devices avec Drupal Focus sur Omega

Une interface moderne et multi devices avec Drupal Focus sur Omega Une interface moderne et multi devices avec Drupal Focus sur Omega Romain Jarraud Formateur / consultant Drupal Anne- Sophie Picot Chef de projets Publier du contenu aujourd hui > Plateformes de consultation

Plus en détail

2) Combien de tableaux apparents ont été tracés dans le site et de combien de cellules?

2) Combien de tableaux apparents ont été tracés dans le site et de combien de cellules? Travail dirigé : éléments de correction Item B53 du C2I Lycée M. Ponty II- Travail d analyse technique d un site Afin de vous proposez une présentation cohérente, votre entreprise à mis en ligne une illustration

Plus en détail

Le WEB : HTML. Formation Systèmes d'information et numérique. Exercices en HTML

Le WEB : HTML. Formation Systèmes d'information et numérique. Exercices en HTML 1 ère STI2D TD V1.0 Le WEB : HTML Formation Systèmes d'information et numérique 1) Exercice 1 : Texte simple : Exercices en HTML A l aide de Notepad++, créez une page web Ex1.html qui contient «Hello World!»

Plus en détail

Introduction à Expression Web 2

Introduction à Expression Web 2 Introduction à Expression Web 2 Définitions Expression Web 2 est l éditeur HTML de Microsoft qui répond aux standard dew3c. Lorsque vous démarrez le logiciel Expression Web 2, vous avez le choix de créer

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

Tutoriel Technique. Plateforme de suivi des usages des ressources. Version 2 Date de conception : 03/2014 Auteur : Équipe UVED

Tutoriel Technique. Plateforme de suivi des usages des ressources. Version 2 Date de conception : 03/2014 Auteur : Équipe UVED Tutoriel Technique Plateforme de suivi des usages des ressources Version 2 Date de conception : 03/2014 Auteur : Équipe UVED 1. Connexion à la plateforme de suivi des usages Pour accéder à la plateforme

Plus en détail

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr Web HTML Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr 1 Plan Fonc-onnement du web Le langage HTML 2 Web : Introduc;on Réseau : mise en commun de ressources (données, imprimantes, ) Internet : Interconnexion

Plus en détail

Créer un calendrier de l Avent

Créer un calendrier de l Avent Créer un calendrier de l Avent Mai 2015 Sommaire 3. 4. 5. 6. 7. 8-9. 10. 11-12. 13. 14. 15. 16. Introduc)on / principe Choisissez votre type de campagne Choisissez un canal de publica)on Choisissez les

Plus en détail

MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE)

MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE) MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE) 1) Quelques définitions... 3 2) Inscription sur le portail Efolia... 3 3) Récupération de la clé

Plus en détail

La gestion des exceptions

La gestion des exceptions La gestion des exceptions Même lorsqu un programme est au point, certaines circonstances exceptionnelles peuvent compromettre la poursuite de son exécution ; il peut s agir par exemple de données incorrectes

Plus en détail

DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22

DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22 Manuel Utilisateur DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22 1. SOMMAIRE Datacar Admin 1. SOMMAIRE...2 2. DESCRIPTION...5 3. DEMARRAGE DE DATACAR ADMIN...6

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

QU EST-CE QU UN BLOGUE

QU EST-CE QU UN BLOGUE Conception Mathieu Brisson Pour plus d information Séverine Parent Conseillère pédagogique TIC - Q3076 - poste 6121 severine.parent@climoilou.qc.ca QU EST-CE QU UN BLOGUE Le blogue est un site web personnel,

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Portail des communes Guide Référent ville

Portail des communes Guide Référent ville Portail des communes Guide Référent ville Services aux communes Introduction Vous êtes Référent pour votre commune et venez de recevoir vos identifiants de connexion à l ENT école. Ce document va vous

Plus en détail

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière.

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. PREAMBULE Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. Vin & Société vous transmet ces quelques règles simples de «communicagon

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

RAPPEL La commande man [commande] donne une aide pour chaque commande QUELQUES RACCOURCIS CLAVIER BIEN PRATIQUES

RAPPEL La commande man [commande] donne une aide pour chaque commande QUELQUES RACCOURCIS CLAVIER BIEN PRATIQUES Exercices LINUX TP1 RAPPEL La commande man [commande] donne une aide pour chaque commande QUELQUES RACCOURCIS CLAVIER BIEN PRATIQUES Linux a comme d'autres systèmes une gestion de raccourcis clavier. Voici

Plus en détail

Réalisation d une Interface Utilisateur

Réalisation d une Interface Utilisateur Réalisation d une Interface Utilisateur Pour manipuler facilement les données enregistrées dans une base de données, il est nécessaire de cacher leur implantation technique dans les tables et d offrir

Plus en détail

Manuel Utilisateur Actualités

Manuel Utilisateur Actualités Manuel Utilisateur Actualités Auteur : Logica Version : 1.14 Droit d auteur Ce texte est disponible sous contrat Creative Commons Paternité - Pas d'utilisation Commerciale - Partage des Conditions Initiales

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

HAL-Pasteur. La plate-forme d archive ouverte de l Institut Pasteur. Formation au dépôt d articles. http://hal-pasteur.archives-ouvertes.

HAL-Pasteur. La plate-forme d archive ouverte de l Institut Pasteur. Formation au dépôt d articles. http://hal-pasteur.archives-ouvertes. HAL-Pasteur La plate-forme d archive ouverte de l Institut Pasteur Formation au dépôt d articles http://hal-pasteur.archives-ouvertes.fr hal-pasteur@pasteur.fr HAL-Pasteur L équipe HAL Pasteur est à votre

Plus en détail

Styler un document sous Word 2010*

Styler un document sous Word 2010* Février 2014 Styler un document sous Word 2010* Un style est un ensemble de caractéristiques de mise en forme (police, taille, espacement, etc.) qui sert à structurer un document en l organisant de manière

Plus en détail

Créer un formulaire (une enquête) en ligne sur Google

Créer un formulaire (une enquête) en ligne sur Google Créer un formulaire (une enquête) en ligne sur Google Google vous permet de réaliser différents travaux en ligne, notamment des formulaires que vous pouvez ensuite envoyer via votre boîte Gmail et dont

Plus en détail

Aide à l utilisation du logiciel IziSpot.Mobi

Aide à l utilisation du logiciel IziSpot.Mobi 1 Sommaire 1. Description logiciel (explication des menus)... 3 1.1. Description de la barre de menu... 3 2. Onglet configuration... 4 2.1. Gestion du logo... 4 2.1.1. Affichage du zoom... 4 2.1.2. Disposition

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

TP Introduction à l'analyse de données NGS (des données brutes au mapping)

TP Introduction à l'analyse de données NGS (des données brutes au mapping) TP Introduction à l'analyse de données NGS (des données brutes au mapping) INTRODUCTION Les précédents exercices ont permis : - d introduire les commandes de base pour se déplacer dans l arborescence et

Plus en détail

Poitou-Charentes. Qu est-ce qu une carte dynamique? Quels outils autour de la carte dynamique? Consulter une carte dynamique

Poitou-Charentes. Qu est-ce qu une carte dynamique? Quels outils autour de la carte dynamique? Consulter une carte dynamique A la source de l information géographique Consulter une carte dynamique Pour les conseils et astuces : Suivez le guide Qu est-ce qu une carte dynamique? C est un module cartographique qui permet de visualiser

Plus en détail

Java & Algorithme Corrigé du test final

Java & Algorithme Corrigé du test final Java & Algorithme Corrigé du test final 1 QUESTIONS EN JAVA Chaque question est sur un point, sauf certaines sur deux points. En tout, le QCM est noté sur 24 : la note est divisée par 6 pour revenir entre

Plus en détail

Formation: Pack office Word, Excel Publisher Perfectionnement

Formation: Pack office Word, Excel Publisher Perfectionnement Marjorie LABERTRANDE Formatrice Indépendante Tel : 06.17.91.68.18 - e. mail : mlformation.var@free.fr Formation: Pack office Word, Excel Publisher Perfectionnement Durée : 5 jours (35 heures) N SIRET :

Plus en détail

Guide de formation avec exercices et cas pratiques. Excel 2013. initiation. Philippe Moreau. TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5

Guide de formation avec exercices et cas pratiques. Excel 2013. initiation. Philippe Moreau. TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5 Guide de formation avec exercices et cas pratiques Excel 2013 initiation Philippe Moreau TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5 LES DONNÉES LES CALCULS LE RÉSULTAT Tsoft/Eyrolles Excel

Plus en détail

note de procédure CONFIGURATION DES AGENTS ET SUPERVISEURS DES CALL CENTER Objet Destinataire(s) : Copie(s) : Page 1 / 18 Cf INTRANET DOCUMENTAIRE

note de procédure CONFIGURATION DES AGENTS ET SUPERVISEURS DES CALL CENTER Objet Destinataire(s) : Copie(s) : Page 1 / 18 Cf INTRANET DOCUMENTAIRE Créé le 14/03/2014 Version 2 Révisé le : 14/10/2008 Emetteur : Etat : DOP Production Système Infra IP Michel GRILLIET Destinataire(s) : Cf INTRANET DOCUMENTAIRE Copie(s) : Cf INTRANET DOCUMENTAIRE note

Plus en détail

Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8

Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8 Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8 3 - FONCTIONS PROPRES AUX DOCUMENTS LONGS HOMOGÉNÉISER LES MISES EN FORME Quand vous mettez en forme du texte, Word mémorise ces mises en forme et les

Plus en détail

Soumission de données brutes de séquences à SRA. Novembre 2013

Soumission de données brutes de séquences à SRA. Novembre 2013 Soumission de données brutes de séquences à SRA Novembre 2013 1 Objectif Soumettre les données brutes issues du séquençage haut débit aux banques publiques d archivage Données : séquences brutes (reads)

Plus en détail

Espace Numérique Régional de Santé Formation Agora Project

Espace Numérique Régional de Santé Formation Agora Project Espace Numérique Régional de Santé Formation Agora Project Sommaire 1. Introduction 2. Se connecter 3. Présentation Générale 4. Paramétrage de l espace 5. Utilisateur de l espace 6. Gestionnaire de fichier

Plus en détail

MO-Call pour les Ordinateurs. Guide de l utilisateur

MO-Call pour les Ordinateurs. Guide de l utilisateur MO-Call pour les Ordinateurs Guide de l utilisateur Sommaire MO-CALL POUR ORDINATEURS...1 GUIDE DE L UTILISATEUR...1 SOMMAIRE...2 BIENVENUE CHEZ MO-CALL...4 MISE EN ROUTE...5 CONNEXION...5 APPELS...7 COMPOSITION

Plus en détail

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Comment créer un Test de personnalité?

Comment créer un Test de personnalité? Comment créer un Test de personnalité? Mai 2015 Sommaire 3. 4. 5. 6 7. 8. 9-10. 11. 12. 13. 14. 15. 16. 17. 18. 19, Choisissez votre type de campagne Choisissez un canal de publica7on Ajoutez une so:gate

Plus en détail

Guide d utilisation - Modifications portfolio des artisans

Guide d utilisation - Modifications portfolio des artisans Accéder au tableau de bord Pour entrer dans l espace d administration, allez à l adresse suivante : www.metiersdartbsl.com Cliquez ensuite sur l icône CONNEXION dans le haut à droite de la page. Une fenêtre

Plus en détail

Troisième projet Scribus

Troisième projet Scribus Sommaire 1. Réponse à la question du deuxième projet... 2 2. Présentation du projet... 2 2.1. Organiser son travail... 2 3. Réalisation... 2 3.1. Préparation du texte... 2 3.1.1. Les styles «Dys»... 3

Plus en détail

Episciences Documentation Webmestre

Episciences Documentation Webmestre 1 Episciences Documentation Webmestre Prérequis: Pour pouvoir effectuer les actions décrites ci-dessous, vous devez posséder un compte dans Episciences avec les droits webmaster. Pour que votre compte

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Introduction à Moodle

Introduction à Moodle Introduction à Moodle Lors de cette formation d introduction à la plateforme Moodle, nous expérimentons les outils de base pour ajouter du contenu en ligne, les paramètres, les fonctions de mise en page,

Plus en détail

Forma&on à la prise en main du service galaxy.prabi.fr

Forma&on à la prise en main du service galaxy.prabi.fr Forma&on à la prise en main du service galaxy.prabi.fr Vincent Navra,l Dominique Guyot Chris,ne Oger Jean- François Taly Clothilde Deschamps Amandine Fournier 10/03/2015 Plan de la forma&on 14h- 14h30:

Plus en détail

TRAITEMENT D IMAGES: mise en route

TRAITEMENT D IMAGES: mise en route TRAITEMENT D IMAGES: mise en route Voici quelques indications et conseils (non exhaustifs...) pour mettre en route les travaux pratiques de traitement d image. Mise à jour par B. Sicardy: 27 mai 2007.

Plus en détail

Dreamweaver CS6 pour PC/Mac Pour des sites full CSS conformes aux standards du W3C

Dreamweaver CS6 pour PC/Mac Pour des sites full CSS conformes aux standards du W3C Introduction L'Internet aujourd'hui 7 Le World Wide Web Consortium et les standards 7 Les logiciels de conception de sites web 7 L'objectif du livre 8 Interface de conception L'environnement système 9

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

L histoire-géographie et sa contribu4on à la construc4on du socle commun de connaissances, de compétences et de culture

L histoire-géographie et sa contribu4on à la construc4on du socle commun de connaissances, de compétences et de culture L histoire-géographie et sa contribu4on à la construc4on du socle commun de connaissances, de compétences et de culture Académie de Nantes, Inspec4on pédagogique régionale d histoiregéographie, mise en

Plus en détail

Monday, December 2 nd 2013. Formation Galaxy

Monday, December 2 nd 2013. Formation Galaxy Formation Galaxy Lundi, 10 Février 2014 This training has not for objectives to introduce every Galaxy tool individually or to build a workflow to process your own data. Objectives: To provide a first

Plus en détail

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8.

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8. PROCEDURES TAKE FIVE SOMMAIRE 1. Paramétrage 2. Page d accueil 3. Clients 4. Catalogue 5. Ventes 6. Statistiques 7. Agenda 8. Taches 9. Bloc-notes 10. Procédure(s) automatisée(s) 11. Sauvegarde 1. Paramétrage

Plus en détail

Programmer avec Xcas : version 0.8.6 et 0.9

Programmer avec Xcas : version 0.8.6 et 0.9 Programmer avec Xcas : version 0.8.6 et 0.9 I. L environnement de travail de Xcas Xcas permet d écrire des programmes, comme n importe quel langage de programmation. C est un langage fonctionnel. L argument

Plus en détail

Introduction à MATLAB R

Introduction à MATLAB R Introduction à MATLAB R Romain Tavenard 10 septembre 2009 MATLAB R est un environnement de calcul numérique propriétaire orienté vers le calcul matriciel. Il se compose d un langage de programmation, d

Plus en détail

POWERGES. La Facturation

POWERGES. La Facturation La Facturation 1. Préparation et configuration générale du programme des FACTURES Avant toute chose, il est nécessaire de configurer l environnement que vous voudriez utiliser. Pour ce faire, il faut rentrer

Plus en détail