Introduc)on à Ensembl/ Biomart : Par)e pra)que

Dimension: px
Commencer à balayer dès la page:

Download "Introduc)on à Ensembl/ Biomart : Par)e pra)que"

Transcription

1 Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller

2 NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que

3 Exercice 1 1.a. Quelle est la version de l assemblage du génome humain disponible sur la dernière version du site d Ensembl? 1.b. Quelle est la taille du génome du panda? Regarder le Base Pairs Regarder le Golden Path Length 1.c. Quelle est la taille du génome humain? Regarder le Base Pairs Regarder le Golden Path Length 3 Naviga)on dans Ensembl : Pra)que

4 Réponse à la ques)on 1.a GRCh37 4

5 Réponse à la ques)on 1.b 5

6 Réponse à la ques)on 1.c Taille du génome humain 6

7 Exercice 2 Quelle est la version du génome du rat- taupe nu? (Heterocephalus glaber) Combien de gènes ont été prédits par Genscan? 7 Naviga)on dans Ensembl : Pra)que

8 Réponse à la ques)on 2 8

9 Ques)on 3 Retrouver la taille du chromosome 4 dans le génome humain assemblage hg19 9 Naviga)on dans Ensembl : Pra)que

10 Réponse 3 10

11 Exercice 4 4.a - Combien de transcrits alterna)fs possède le gène BBS5 (chez l Homme) 4.b - Combien d exons possède le transcript BBS c - Combien d exons sont codants? Remarque - Comparer les couleurs d affichages de transcrits BBS5-001 et BBS Naviga)on dans Ensembl : Pra)que

12 Réponse 4.a 7 transcrits alterna)fs 12

13 Réponse 4.b 4 exons 13

14 Réponse 4.b.c 0 exon codant 14

15 Exercice 5 Retrouver ce`e page 15 Naviga)on dans Ensembl : Pra)que

16 Réponse 5 16

17 Exercice 6 Retrouver ce`e page 17 Naviga)on dans Ensembl : Pra)que

18 Réponse 6 18

19 Exercice 7 Déterminer le nombre total de varia)ons dans le gène BRCA1 19 Naviga)on dans Ensembl : Pra)que

20 Réponse 7 20

21 Exercice 8 Afficher dans le navigateur de génome les données d expression (RNAseq) dans deux )ssus (breast, skeletal muscle) au niveau du gène BRCA1 21 Naviga)on dans Ensembl : Pra)que

22 Réponse 8 22

23 Exercice 9 Afficher les termes GO associés aux transcrits BRCA Naviga)on dans Ensembl : Pra)que

24 Réponse 9 24

25 Exercice 10 Mener l enquête pour retrouver le nouvel iden)fiant Ensembl (gène) pour le gène : ENSG

26 Réponse 10

27 Exercice 11 Visualiser le fichier unique_crn- 107.bam dans Ensembl Adresse : jp://jp- igbmc.u- strasbg.fr/pub/ slegras/dudijon/unique_crn- 107_11.bam Aller voir le gène BBS1

28 Réponse 11

29 OUTILS : PARTIE PRATIQUE

30 Exercice BLAST Quel est la localisa)on génomique de BBS1? Séquence protéique: Recherche de la séquence protéique BBS1 dans les archives du génome humain août h`p://www- bio3d- igbmc.u- strasbg.fr/~jmuller/enseignement.html h`p://www.ensembl.org/info/website/archives/index.html TBLASTN sur le génome humain

31 PlateForMe

32 Est- ce que le chromosome 9 est la bonne localisaeon?

33 Exercice BLAST

34 Exercice BLAST

35 Exercice BLAST

36 Exercice BLAST LocalisaEon sur le chromosome 11

37 Alignement vs génome Plusieurs HSP 100% ID E- value plus élevée car calculée sur le chromosome en en)er 1 ou 2 HSP >80% ID E- value plus faible car alignement en un seul bloc

38 Exercice BLAST Est- ce bien le gène BBS1?

39 Exercice BLAST

40 BIOMART : PARTIE PRATIQUE 40 Naviga)on dans Ensembl : Pra)que

41 Exercice 1 Retrouver les iden)fiants Ensembl du gène et de tous les transcrits du gène BBS1 chez l Homme En entrée : Gène BBS1 (Gene Symbol) En sor)e : Ensembl Gene ID Ensembl Transcript ID Associated Gene Name 41 BioMart

42 Réponse 1 42

43 Exercice 2 Extraire toutes les séquences de tous les exons du gène BRCA1 Dans les entêtes, il devra y avoir : Associated gene name Ensembl Transcript ID Ensembl Exon ID 43

44 Résultat 2

45 Exercice 3 Extraire les séquences codantes des transcrits du gène BRCA1 (iden)fiant Ensembl : ENSG ) Dans les entêtes, il devra y avoir : Ensembl Transcript ID Ensembl Exon ID

46 Résultat 3

47 Exercice 4 A par)r des coordonnées chromosomiques suivantes : chr chr Répondez aux ques)ons suivantes : Dans quel(s) gènes(s) se trouve- t- on? Si l on est dans un gène, récupérer les termes GO associés aux gènes Combien de variants germinaux con)ennent les régions

48 Réponse 4

49 Remarques Coordonnées commencent à 1 (a`en)on dans UCSC, les coordonnées commencent à 0) A`en)on pas de prefix chr devant les noms des chromosomes A`en)on chromosome Mitochondrial = MT dans Ensembl alors qu il est M dans UCSC Lié à Galaxy 49 Ensembl : fonc)onnement

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

La géné'que médicale et les applica'ons du séquençage à haut- débit

La géné'que médicale et les applica'ons du séquençage à haut- débit La géné'que médicale et les applica'ons du séquençage à haut- débit Dr. Marco Belfiore FAMH en énétique Médicale Division de énétique et Infertilité ML-Laboratoires Médicaux / enesupport ARL, 02.10.2014

Plus en détail

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre Introduc)on à Drupal Journées Mathrice, octobre 2010 par Kenji Lefèvre Sommaire 1. Présenta>on succincte 2. À qui s adresse Drupal? 3. Avantages et difficultés 4. Architecture, administra>on Drupal 5.

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

UTILISATION. Connecteur E-commerce

UTILISATION. Connecteur E-commerce Connecteur E-commerce UTILISATION Le connecteur E-commerce Gestimum Prestashop est une plateforme web PHP qui permet de synchroniser de manière automatique ou manuelle les données présentes sur votre ERP

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Concepon et réalisaon

Concepon et réalisaon Concepon et réalisaon Vendée Etudes & Réalisaons de Soluons Informaques 10 rue des Sables 85540 Mouers les Mauxfaits h%p://sarl-versi.fr contact@sarl-versi.fr Mainate 2 une logiciel d aide à la communicaon

Plus en détail

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris Contexte Rôle des estrogènes dans l expression sexe-dépendante

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ

LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ PARTENAIRES MOBILITE LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ PROGRAMME Le mobile B2B est un sujet extrêmement large qui recouvre de nombreux thèmes. Nous aborderons les probléma(ques liées aux offres

Plus en détail

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe GÉNÉRALITÉS. Découverte 1 A- Présentation générale 1 B- Présentation des applications Office Web Apps 1 C- Les services dédiés au partage 1 1. Espace de travail 2 A- Description de la page d accueil Administrateur

Plus en détail

Brady Mobile Application

Brady Mobile Application Brady Mobile Application Guide d utilisation 2011 Brady Corporation. Tous droits réservés. Brady Corporation 6555 West Good Hope Road P.O. Box 2131 Milwaukee, WI 53201-2131 www.bradycorp.com Assistance

Plus en détail

Documentation Analyse SEM

Documentation Analyse SEM Documentation Analyse SEM Document : Projet : Client : Documentation Analyse SEM myposeo Interne Date : 24/02/15 Version : 1 G4interactive SAS 53, rue des deux communes 93100 Montreuil, France contact@myposeo.com

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS

Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS Localisa1on et Naviga1on de Robots M2 EEAII, parcours ViRob, A.U. 2014-2015 Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS Fabio MORBIDI E-mail: fabio.morbidi@u-picardie.fr Laboratorie

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Document de formation. Français. HGC Online Portail - clients

Document de formation. Français. HGC Online Portail - clients Document de formation Français HGC Online Portail - clients 2015 Prémisse Le portail clients HGC Online est constitué des éléments suivants : Catalogue d articles Webshop Communication - Envoyer une demande

Plus en détail

Création de mises en plan

Création de mises en plan Création de mises en plan Numéro de publication spse01545 Création de mises en plan Numéro de publication spse01545 Avertissement sur les droits de propriété et les droits réservés Ce logiciel et la documentation

Plus en détail

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 Analyse de Séquences M1 BIBS 2 e partie http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 1 Les programmes Génome 2 Les programmes Génome Préhistoire Séquençage de Sanger Avant le séquençage d organismes:

Plus en détail

Tutoriel Cloud IFB - Initiation -

Tutoriel Cloud IFB - Initiation - Tutoriel Cloud IFB - Initiation - Christophe BLANCHET Institut Français de Bioinformatique - IFB French Institute of Bioinformatics - ELIXIR-FR CNRS UMS3601 - Gif-sur-Yvette - FRANCE Ecole Cumulo NumBio

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Tutoriel Cloud IFB - Initiation -

Tutoriel Cloud IFB - Initiation - Tutoriel Cloud IFB - Initiation - Christophe BLANCHET Institut Français de Bioinformatique - IFB French Institute of Bioinformatics - ELIXIR-FR CNRS UMS3601 - Gif-sur-Yvette - FRANCE Ecole Cumulo NumBio

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

BENCHMARK CONCURRENTIEL PERMANENT : PRIX, CONDITIONS, PROMOTIONS, INNOVATIONS

BENCHMARK CONCURRENTIEL PERMANENT : PRIX, CONDITIONS, PROMOTIONS, INNOVATIONS PARTENAIRES E-COMMERCE BENCHMARK CONCURRENTIEL PERMANENT : PRIX, CONDITIONS, PROMOTIONS, INNOVATIONS PROGRAMME Alors que le taux d équipement d appareils numériques explose, les consommateurs passent de

Plus en détail

D après L importance du jeu à l école maternelle IEN- limoux.ac- montpellier.fr

D après L importance du jeu à l école maternelle IEN- limoux.ac- montpellier.fr L'importance du jeu à l'école maternelle "Le jeu c est le travail de l enfant, c est son métier, c est sa vie. L enfant qui joue à l école maternelle s initie à la vie scolaire, et l on oserait dire qu

Plus en détail

1 CRÉER UN TABLEAU. IADE Outils et Méthodes de gestion de l information

1 CRÉER UN TABLEAU. IADE Outils et Méthodes de gestion de l information TP Numéro 2 CRÉER ET MANIPULER DES TABLEAUX (Mise en forme, insertion, suppression, tri...) 1 CRÉER UN TABLEAU 1.1 Présentation Pour organiser et présenter des données sous forme d un tableau, Word propose

Plus en détail

SharePoint 2013 L'environnement de travail collaboratif

SharePoint 2013 L'environnement de travail collaboratif Généralités Présentation générale 11 Prérequis matériel, logiciel et système 11 L interface utilisateur avec ou sans Silverlight 11 Accéder à la page d accueil du site 12 Afficher/modifier ses paramètres

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

IAB Atelier Automated Trading

IAB Atelier Automated Trading IAB Atelier Automated Trading Privacy & Automated Trading Jan Decorte Ann Fromont 4 décembre 2014 1. Introduc5on générale sur la Loi Vie Privée 2. Sanc5ons en cas de non- respect de la Loi Vie Privée 3.

Plus en détail

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Octobre 2011 Pour préparer une newsletter, gérer les listes de diffusion ou inscrire plusieurs personnes Codes www.agriculture-moyenne-montagne.org/newsletter/admin

Plus en détail

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière.

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. PREAMBULE Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. Vin & Société vous transmet ces quelques règles simples de «communicagon

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Philippe Bardou Sarah Maman Ibouniyamine Nabihoudine Olivier Rué 06 Novembre 2013 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- 1 Galaxy pour

Plus en détail

La nutrigénomique: l avenir en nutrition animale

La nutrigénomique: l avenir en nutrition animale La nutrigénomique: l avenir en nutrition animale Yves Tarte, dmv Vétérinaire chargé du développement vétérinaire Hill s Pet Nutrition Canada Inc A.T.S.A.Q. Février 2009 La nutrigénomique Science toute

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Styler un document sous Word 2010*

Styler un document sous Word 2010* Février 2014 Styler un document sous Word 2010* Un style est un ensemble de caractéristiques de mise en forme (police, taille, espacement, etc.) qui sert à structurer un document en l organisant de manière

Plus en détail

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION PRINCIPES DE BASE SUR LES DONNEES ET LE CALCUL HAUTE PERFORMANCE Lois de Gray sur l ingénierie des données 1 : Les calculs scientifiques traitent des volumes considérables

Plus en détail

My Poker Manager Guide Utilisateur. Guide Utilisateur

My Poker Manager Guide Utilisateur. Guide Utilisateur «My Poker Manager» Guide Utilisateur Sommaire My Poker Manager Guide Utilisateur Sommaire... 2 My Poker Manager... 3 Tous les outils... 4 1 Système d alerte... 5 2 Composant de stacking ou pile de tables...

Plus en détail

USER EXPERIENCE ET DATA : AUGMENTER LES CONVERSIONS GRÂCE À UN PARCOURS UTILISATEUR OPTIMISÉ

USER EXPERIENCE ET DATA : AUGMENTER LES CONVERSIONS GRÂCE À UN PARCOURS UTILISATEUR OPTIMISÉ PARTENAIRES : E-COMMERCE USER EXPERIENCE ET DATA : AUGMENTER LES CONVERSIONS GRÂCE À UN PARCOURS UTILISATEUR OPTIMISÉ PROGRAMME Comment améliorer le parcours des client en temps réel avec les données collectées

Plus en détail

Exemple de scénario : Simulation Jeux d entreprise. Jean Christophe Duflanc

Exemple de scénario : Simulation Jeux d entreprise. Jean Christophe Duflanc Exemple de scénario : Simulation Jeux d entreprise Jean Christophe Duflanc LA SIMULATIONS ET LES JEUX SÉRIEUX AU COEUR DES ENSEIGNEMENTS DE STMG 2 Extraits du programme de première STMG Sciences de gestion

Plus en détail

Habitez, Vivez! BAILLEURS. Votre compte web. Accessible 7 jours sur 7 24 heures sur 24. Un espace sécurisé

Habitez, Vivez! BAILLEURS. Votre compte web. Accessible 7 jours sur 7 24 heures sur 24. Un espace sécurisé BAILLEURS Votre compte web Accessible 7 jours sur 7 24 heures sur 24 Un espace sécurisé C est à dire? Nos services en ligne Ils vous permekent de : Consulter la situabon financière de votre compte Consulter

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

CMS VISUEL ET MOBILE SENSE D EMARSYS DES EMAILS 100% RESPONSIVES - SANS LES COMPLICATIONS TECHNIQUES

CMS VISUEL ET MOBILE SENSE D EMARSYS DES EMAILS 100% RESPONSIVES - SANS LES COMPLICATIONS TECHNIQUES CMS VISUEL ET MOBILE SENSE D EMARSYS DES EMAILS 100% RESPONSIVES - SANS LES COMPLICATIONS TECHNIQUES CMS visuel et Mobile Sense d Emarsys Des emails 100% responsives - sans les complications techniques.

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Créer une application de livre interactif pour tablette avec Indesign CS6 et Adobe Digital Publishing Suite

Créer une application de livre interactif pour tablette avec Indesign CS6 et Adobe Digital Publishing Suite Applications de type livre Introduction 9 Qu est-ce qu une application de type livre? 9 Découvrir DPS 11 La publication 12 Comprendre le flux de publication 12 Édition simple ou multifolio 13 Choisir l

Plus en détail

Rapports d heures web. Instructions pour collaborateurs

Rapports d heures web. Instructions pour collaborateurs Rapports d heures web Instructions pour collaborateurs Software Release 11.0 Version du 17 novembre 2014 Table des matières 1 Avantages et importantes propriétés 3 2 Inscription 4 3 Liste d aperçu 5 4

Plus en détail

GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL

GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL 1 SOMMAIRE 1 INTRODUCTION... 3 2 ENVOYER UN SMS PAR EMAIL... 4 3 ENVOYER UN SMS VIA LE CLIENT DEDIE ESMSBOX... 6 4 ENVOYER UN SMS MAILING PAR EMAIL...

Plus en détail

Sites Internet : les. tendances. Jeudi 30 janvier 2014 Bordeaux L AGENCE CONNECTÉE À L ENTREPRISE

Sites Internet : les. tendances. Jeudi 30 janvier 2014 Bordeaux L AGENCE CONNECTÉE À L ENTREPRISE Sites Internet : les tendances pour 2014 Jeudi 30 janvier 2014 Bordeaux L AGENCE CONNECTÉE À L ENTREPRISE Inaa$v, une agence de communica$on avec des spécificités CONSEiL EN COMMUNICATION FoRmatiOns WEBMARKETING

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Scénario de prise en main DataCar CRM v2.3 Gamme SFA

Scénario de prise en main DataCar CRM v2.3 Gamme SFA Scénario de prise en main DataCar CRM v2.3 Gamme SFA 1 - Présentation et Restriction Vous venez d obtenir vos accès à l application DataCar CRM. Vous trouverez dans ce document un scénario de prise en

Plus en détail

Ajouter un questionnaire

Ajouter un questionnaire Ajouter un questionnaire Contenu Survol... 2 Ajouter un questionnaire... 2 Consulter les résultats... 7 Corriger une copie de questionnaire... 9 Suivi des tentatives... 10 Réactiver une tentative d un

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

L observa*on du développement de l enfant dans ses jeux symboliques

L observa*on du développement de l enfant dans ses jeux symboliques L observa*on du développement de l enfant dans ses jeux symboliques Sarah Landry, Ph. D. Professeure- chercheuse Faculté des sciences de l éduca*on Université de Montréal Courriel: sarah.landry@umontreal.ca

Plus en détail

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS E. Desmarais J.C. Avarre, C. Breton, K. Belkhir et B. Guinand Institut des Sciences de l Evolution - Montpellier

Plus en détail

FORMATION GOOGLE ANALYTICS

FORMATION GOOGLE ANALYTICS FORMATION GOOGLE ANALYTICS L OBJECTIF DE LA FORMATION : Paramétrer par rapport à ses objec0fs, lire les performances de son site, gérer et op0miser ses sources de trafic Comprendre les fondamentaux de

Plus en détail

Contenu de l'emballage. Fonctions et spécifications

Contenu de l'emballage. Fonctions et spécifications Contenu de l'emballage (1) Unité d'enregistrement A AVerDigi EB1304NET SATA B AVerDigi EB1304NET SATA (2) Télécommande avec batteries (3) Guide d'installation rapide (4) Cordon d'alimentation (5) Adaptateur

Plus en détail

Corrigé du TP Carte SIM

Corrigé du TP Carte SIM Corrigé du TP Carte SIM Outil GScriptor Il faut d abord télécharger GScriptor : http://www.springcard.com/download/find.php?file=gscriptor et l installer sous Windows. Depuis Windows 7, il n est pas nécessaire

Plus en détail

LE SUPPLIER RELATIONSHIP MANAGEMENT EN PRATIQUE

LE SUPPLIER RELATIONSHIP MANAGEMENT EN PRATIQUE PARTENAIRES ACHATS LE SUPPLIER RELATIONSHIP MANAGEMENT EN PRATIQUE PROGRAMME La geson de la relaon fournisseur Supplier Relaonship Management est au centre de l aenon de toutes les foncons Achats. Les

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Comment créer Une landing page?

Comment créer Une landing page? Comment créer Une landing page? MAI 2015 Sommaire 3. 4. 5. 6. 7-8. 9. 10. 11. 12. 13. Introduc)on / principe Choisissez votre type de campagne Choisissez un canal de publica)on Ajoutez une so< gate L apparence

Plus en détail

CQP 112 Introduc/on à la programma/on. Thème 2 : Architecture d un système informa/que. Département d informa/que

CQP 112 Introduc/on à la programma/on. Thème 2 : Architecture d un système informa/que. Département d informa/que CQP 112 Introduc/on à la programma/on Thème 2 : Architecture d un système informa/que Département d informa/que CQP 112 : Introduc/on à la programma/on Plan 1. Historique des ordinateurs 2. Composants

Plus en détail

Pe#t déjeuner Prévention des risques professionnels dans la Mutualité

Pe#t déjeuner Prévention des risques professionnels dans la Mutualité Pe#t déjeuner Prévention des risques professionnels dans la Mutualité 15 mai 2014 Intervenantes: Emmanuelle Paradis, Chef de projet Préven#on et santé au travail CHORUM - CIDES Carole Hazé, Responsable

Plus en détail

Guide de l utilisateur : Etat du dossier au Service Client (EMEA)

Guide de l utilisateur : Etat du dossier au Service Client (EMEA) E -Support Guide de l utilisateur : Etat du dossier au Service Client (EMEA) Pour la consultation en ligne support.euro.dell.com E-Support EMEA Etat du dossier au Service Client Dell Contenu 1.1.Qu est

Plus en détail

TABLE DES MATIÈRES PARTIE 1 - IPHOTO 09... 7 INTRODUCTION... 1. Chapitre 1 Choisir et utiliser un appareil photo numérique.. 9

TABLE DES MATIÈRES PARTIE 1 - IPHOTO 09... 7 INTRODUCTION... 1. Chapitre 1 Choisir et utiliser un appareil photo numérique.. 9 III TABLE DES MATIÈRES INTRODUCTION.......................... 1 Accéder aux programmes de la suite................. 2 Configuration requise pour ilife................... 2 Installer ilife............................

Plus en détail

SOLUTION ONLINE DE GESTION

SOLUTION ONLINE DE GESTION SOLUTION ONLINE DE GESTION POUR LES SPECIALISTES DU TOURISME SUR MESURE www.toogonet.fr imaginez un système... sans installation * tout se passe sur le navigateur internet classique * pas de mise à jour,

Plus en détail

Guide de Démarrage Desktop. 2014 Release 1 Xojo, Inc.

Guide de Démarrage Desktop. 2014 Release 1 Xojo, Inc. Guide de Démarrage Desktop 2014 Release 1 Xojo, Inc. Chapitre 1 Introduction Bienvenue dans Xojo, le moyen le plus facile de créer des applications desktop and web multiplateformes. Section 1 À propos

Plus en détail

Prise en main rapide

Prise en main rapide Prise en main rapide 4 Dans cette leçon, vous découvrirez les fonctionnalités de création de page web de Dreamweaver et apprendrez à les utiliser dans l espace de travail. Vous apprendrez à : définir un

Plus en détail

L ou%l téléphone dans votre stratégie de marke%ng direct

L ou%l téléphone dans votre stratégie de marke%ng direct L ou%l téléphone dans votre stratégie de marke%ng direct «Allo, vous n avez pas de stratégie téléphone?» Alain Pierre La Chaîne de l Espoir Pascal Fréneaux ADM VALUE Présenta%on de La Chaîne de l Espoir

Plus en détail

Gestion des communautés Mode d emploi des outils animateurs

Gestion des communautés Mode d emploi des outils animateurs Gestion des communautés Mode d emploi des outils animateurs CONNEXION AU SITE http://www.neoma-alumni.com Utilisez vos identifiants personnels pour vous connecter à votre compte sur le site. En cas de

Plus en détail

MTI820 Entrepôts de données et intelligence d affaires. Intégra*on des données et ETL

MTI820 Entrepôts de données et intelligence d affaires. Intégra*on des données et ETL MTI820 Entrepôts de données et intelligence d affaires Intégra*on des données et ETL Département de génie logiciel et des TI MTI820 Hiver 2011 S. ChaEi, C. Desrosiers 1 Le cycle de vie d un projet en BI

Plus en détail

Paiement sécurisé sur Internet. Tableau de bord Commerçant

Paiement sécurisé sur Internet. Tableau de bord Commerçant Paiement sécurisé sur Internet Tableau de bord Commerçant SOMMAIRE 1 Principe 4 1.1 Principe général 4 1.2 Environnement de validation 4 1.3 Environnement de Production 4 2 Accès au tableau de bord 5 2.1

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Introduction à MATLAB R

Introduction à MATLAB R Introduction à MATLAB R Romain Tavenard 10 septembre 2009 MATLAB R est un environnement de calcul numérique propriétaire orienté vers le calcul matriciel. Il se compose d un langage de programmation, d

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Swisscom Webmail - mode d emploi

Swisscom Webmail - mode d emploi Swisscom Webmail - mode d emploi Introduction Login Sélectionnez l onglet «E-mail + SMS». Vous êtes invité à vous connecter si vous ne l avez pas encore fait. Déconnexion Afin de vous déconnecter correctement

Plus en détail

1 OpenOffice.org 3.0... 15

1 OpenOffice.org 3.0... 15 1 OpenOffice.org 3.0... 15 1.1. Lancer l application générale... 16 1.2. Démarrer une application spécifique d OpenOffice.org... 19 Créer un raccourci sur le Bureau... 20 1.3. Les barres principales...

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

IPv6. Lab 6: Déploiement. Objectif: Communication IPv6 entre noeuds dans des sites différents au travers d'internet (IPv4)

IPv6. Lab 6: Déploiement. Objectif: Communication IPv6 entre noeuds dans des sites différents au travers d'internet (IPv4) IPv6 Lab 6: Déploiement Objectif: Communication IPv6 entre noeuds dans des sites différents au travers d'internet (IPv4) v.1a E. Berera 1 Communication sites IPv6 par Internet (IPv4) Wi-Fi SSID:groupe1

Plus en détail

Wordpress Manuel utilisateur. Manuel utilisateur

Wordpress Manuel utilisateur. Manuel utilisateur Wordpress Manuel utilisateur Projet : WORDPRESS Auteur : Référence : Version : ALEOS2i Date de dernière modification : 13 septembre 2013 2.0 Objet : Manuel utilisateur Table des matières Connexion au BackOffice...3

Plus en détail

École d'été en architecture de l'informa3on: bilan d'une première édi3on

École d'été en architecture de l'informa3on: bilan d'une première édi3on École d'été en architecture de l'informa3on: bilan d'une première édi3on Vincent Aude:e- Chapdelaine, Espaces Temps Yves Marcoux, EBSI 2011-12- 01 Congrès des milieux documentaires 2011 1 Plan Qu est-

Plus en détail