Introduc)on à Ensembl/ Biomart : Par)e pra)que

Dimension: px
Commencer à balayer dès la page:

Download "Introduc)on à Ensembl/ Biomart : Par)e pra)que"

Transcription

1 Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller

2 NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que

3 Exercice 1 1.a. Quelle est la version de l assemblage du génome humain disponible sur la dernière version du site d Ensembl? 1.b. Quelle est la taille du génome du panda? Regarder le Base Pairs Regarder le Golden Path Length 1.c. Quelle est la taille du génome humain? Regarder le Base Pairs Regarder le Golden Path Length 3 Naviga)on dans Ensembl : Pra)que

4 Réponse à la ques)on 1.a GRCh37 4

5 Réponse à la ques)on 1.b 5

6 Réponse à la ques)on 1.c Taille du génome humain 6

7 Exercice 2 Quelle est la version du génome du rat- taupe nu? (Heterocephalus glaber) Combien de gènes ont été prédits par Genscan? 7 Naviga)on dans Ensembl : Pra)que

8 Réponse à la ques)on 2 8

9 Ques)on 3 Retrouver la taille du chromosome 4 dans le génome humain assemblage hg19 9 Naviga)on dans Ensembl : Pra)que

10 Réponse 3 10

11 Exercice 4 4.a - Combien de transcrits alterna)fs possède le gène BBS5 (chez l Homme) 4.b - Combien d exons possède le transcript BBS c - Combien d exons sont codants? Remarque - Comparer les couleurs d affichages de transcrits BBS5-001 et BBS Naviga)on dans Ensembl : Pra)que

12 Réponse 4.a 7 transcrits alterna)fs 12

13 Réponse 4.b 4 exons 13

14 Réponse 4.b.c 0 exon codant 14

15 Exercice 5 Retrouver ce`e page 15 Naviga)on dans Ensembl : Pra)que

16 Réponse 5 16

17 Exercice 6 Retrouver ce`e page 17 Naviga)on dans Ensembl : Pra)que

18 Réponse 6 18

19 Exercice 7 Déterminer le nombre total de varia)ons dans le gène BRCA1 19 Naviga)on dans Ensembl : Pra)que

20 Réponse 7 20

21 Exercice 8 Afficher dans le navigateur de génome les données d expression (RNAseq) dans deux )ssus (breast, skeletal muscle) au niveau du gène BRCA1 21 Naviga)on dans Ensembl : Pra)que

22 Réponse 8 22

23 Exercice 9 Afficher les termes GO associés aux transcrits BRCA Naviga)on dans Ensembl : Pra)que

24 Réponse 9 24

25 Exercice 10 Mener l enquête pour retrouver le nouvel iden)fiant Ensembl (gène) pour le gène : ENSG

26 Réponse 10

27 Exercice 11 Visualiser le fichier unique_crn- 107.bam dans Ensembl Adresse : jp://jp- igbmc.u- strasbg.fr/pub/ slegras/dudijon/unique_crn- 107_11.bam Aller voir le gène BBS1

28 Réponse 11

29 OUTILS : PARTIE PRATIQUE

30 Exercice BLAST Quel est la localisa)on génomique de BBS1? Séquence protéique: Recherche de la séquence protéique BBS1 dans les archives du génome humain août h`p://www- bio3d- igbmc.u- strasbg.fr/~jmuller/enseignement.html h`p://www.ensembl.org/info/website/archives/index.html TBLASTN sur le génome humain

31 PlateForMe

32 Est- ce que le chromosome 9 est la bonne localisaeon?

33 Exercice BLAST

34 Exercice BLAST

35 Exercice BLAST

36 Exercice BLAST LocalisaEon sur le chromosome 11

37 Alignement vs génome Plusieurs HSP 100% ID E- value plus élevée car calculée sur le chromosome en en)er 1 ou 2 HSP >80% ID E- value plus faible car alignement en un seul bloc

38 Exercice BLAST Est- ce bien le gène BBS1?

39 Exercice BLAST

40 BIOMART : PARTIE PRATIQUE 40 Naviga)on dans Ensembl : Pra)que

41 Exercice 1 Retrouver les iden)fiants Ensembl du gène et de tous les transcrits du gène BBS1 chez l Homme En entrée : Gène BBS1 (Gene Symbol) En sor)e : Ensembl Gene ID Ensembl Transcript ID Associated Gene Name 41 BioMart

42 Réponse 1 42

43 Exercice 2 Extraire toutes les séquences de tous les exons du gène BRCA1 Dans les entêtes, il devra y avoir : Associated gene name Ensembl Transcript ID Ensembl Exon ID 43

44 Résultat 2

45 Exercice 3 Extraire les séquences codantes des transcrits du gène BRCA1 (iden)fiant Ensembl : ENSG ) Dans les entêtes, il devra y avoir : Ensembl Transcript ID Ensembl Exon ID

46 Résultat 3

47 Exercice 4 A par)r des coordonnées chromosomiques suivantes : chr chr Répondez aux ques)ons suivantes : Dans quel(s) gènes(s) se trouve- t- on? Si l on est dans un gène, récupérer les termes GO associés aux gènes Combien de variants germinaux con)ennent les régions

48 Réponse 4

49 Remarques Coordonnées commencent à 1 (a`en)on dans UCSC, les coordonnées commencent à 0) A`en)on pas de prefix chr devant les noms des chromosomes A`en)on chromosome Mitochondrial = MT dans Ensembl alors qu il est M dans UCSC Lié à Galaxy 49 Ensembl : fonc)onnement

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000)

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) II) Annotation de gènes codant des protéines 1) Objectif du TD L objectif du

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Guide d u(lisa(on de la base de données Odyssea 1 Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Lexique - Marker: POI (Point Of Interest) - URL: Uniform ressource Locator, c est une adresse web

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

Interface Homme- Machine. Interface pour le web

Interface Homme- Machine. Interface pour le web Interface Homme- Machine Interface pour le web Ergonomie du web : Importance Web U7lisateurs novices et nomades (accès libre) Ergonomie des interfaces Web 62% des acheteurs en ligne abandonnent au moins

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

UTILISATION. Connecteur E-commerce

UTILISATION. Connecteur E-commerce Connecteur E-commerce UTILISATION Le connecteur E-commerce Gestimum Prestashop est une plateforme web PHP qui permet de synchroniser de manière automatique ou manuelle les données présentes sur votre ERP

Plus en détail

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014)

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014) Prédiction de gènes Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes Equipe Bonsai (2014) La localisation des gènes C'est la première étape pour interpréter

Plus en détail

Forma&on à la prise en main du service galaxy.prabi.fr

Forma&on à la prise en main du service galaxy.prabi.fr Forma&on à la prise en main du service galaxy.prabi.fr Vincent Navra,l Dominique Guyot Chris,ne Oger Jean- François Taly Clothilde Deschamps Amandine Fournier 10/03/2015 Plan de la forma&on 14h- 14h30:

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre Introduc)on à Drupal Journées Mathrice, octobre 2010 par Kenji Lefèvre Sommaire 1. Présenta>on succincte 2. À qui s adresse Drupal? 3. Avantages et difficultés 4. Architecture, administra>on Drupal 5.

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Maria Bernard Laurent Cauquil - Sarah Maman Ibouniyamine Nabihoudine 5 Février 2014 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- Galaxy pour

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS

GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS Table des matières Présentation de la plateforme d envoi de courriels... 4 1- Gestion des contacts... 5 1.1. Base de données... 5 1.1.1- Création

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Développement d une architecture de type GRID pour l analyse des données d expression biologiques

Développement d une architecture de type GRID pour l analyse des données d expression biologiques Développement d une architecture de type GRID pour l analyse des données d expression biologiques O. Delemar, T. Vermat, F. Paillier & M. Deleeuw GENOME express FuturVIEW 2 ntexte biologique : nome et

Plus en détail

Ray : un logiciel parallèle performant pour le séquençage

Ray : un logiciel parallèle performant pour le séquençage Ray : un logiciel parallèle performant pour le séquençage Sébastien Boisvert, Université Laval @sebhtml http://boisvert.info 2014-01-31 10h30-10h50 amphithéâtre (1035) du pavillon JA Bombardier, Université

Plus en détail

Soumission de données brutes de séquences à SRA. Novembre 2013

Soumission de données brutes de séquences à SRA. Novembre 2013 Soumission de données brutes de séquences à SRA Novembre 2013 1 Objectif Soumettre les données brutes issues du séquençage haut débit aux banques publiques d archivage Données : séquences brutes (reads)

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

MEMENTO Gestion du Site Commanderie

MEMENTO Gestion du Site Commanderie MEMENTO Gestion du Site Commanderie Bienvenue dans votre site web Commanderie Pour accéder à votre site Commanderie : http://nom.anysetiers.org Naviguer dans les Pages de votre site : Accueil Calendrier

Plus en détail

Création de mises en plan

Création de mises en plan Création de mises en plan Numéro de publication spse01545 Création de mises en plan Numéro de publication spse01545 Avertissement sur les droits de propriété et les droits réservés Ce logiciel et la documentation

Plus en détail

SharePoint 2013 L'environnement de travail collaboratif

SharePoint 2013 L'environnement de travail collaboratif Généralités Présentation générale 11 Prérequis matériel, logiciel et système 11 L interface utilisateur avec ou sans Silverlight 11 Accéder à la page d accueil du site 12 Afficher/modifier ses paramètres

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

MA MOBILITE PROFESSIONNELLE & MOI. Résultats de notre enquête 2014/5 en partenariat avec Ithaque Coaching

MA MOBILITE PROFESSIONNELLE & MOI. Résultats de notre enquête 2014/5 en partenariat avec Ithaque Coaching + MA MOBILITE PROFESSIONNELLE & MOI Résultats de notre enquête 2014/5 en partenariat avec Ithaque Coaching Sommaire 2 Objec-fs de l enquête.p. 3 Méthodologie p. 4 Résultats Mobilité professionnelle Une

Plus en détail

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Yvan Le Bras, Projet e-biogenouest, CNRS UMR 6074 IRISA-INRIA, Rennes I. Informations globales

Plus en détail

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet Serveur WEB AUTOMGEN Pour la réalisation d un superviseur accessible à partir d un navigateur Internet 1 Introduction Le serveur WEB d AUTOMGEN permet de réaliser des applications de supervision accessibles

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe GÉNÉRALITÉS. Découverte 1 A- Présentation générale 1 B- Présentation des applications Office Web Apps 1 C- Les services dédiés au partage 1 1. Espace de travail 2 A- Description de la page d accueil Administrateur

Plus en détail

Réunion d orienta.on. II Choisir un domaine. Introduc)on I Choisir une voie I Choisir une voie

Réunion d orienta.on. II Choisir un domaine. Introduc)on I Choisir une voie I Choisir une voie Réunion d orienta.on 3è Introduc)on I Choisir une voie I Choisir une voie II Choisir un domaine III Le II 2de Choisir Générale un et domaine technologique III IV La Le 2de 2de Générale Générale et technologique

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Philippe Bardou Sarah Maman Ibouniyamine Nabihoudine Olivier Rué 06 Novembre 2013 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- 1 Galaxy pour

Plus en détail

La géné'que médicale et les applica'ons du séquençage à haut- débit

La géné'que médicale et les applica'ons du séquençage à haut- débit La géné'que médicale et les applica'ons du séquençage à haut- débit Dr. Marco Belfiore FAMH en énétique Médicale Division de énétique et Infertilité ML-Laboratoires Médicaux / enesupport ARL, 02.10.2014

Plus en détail

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture La localisation des gènes Prédiction de gènes Crs de présentation des tils bio-informatiques pr la localisation puis l'étude des gènes C'est la première étape pr interpréter un génome Distinction entre

Plus en détail

Concepon et réalisaon

Concepon et réalisaon Concepon et réalisaon Vendée Etudes & Réalisaons de Soluons Informaques 10 rue des Sables 85540 Mouers les Mauxfaits h%p://sarl-versi.fr contact@sarl-versi.fr Mainate 2 une logiciel d aide à la communicaon

Plus en détail

Une fois la page chargée, vous devriez vous trouvez sur cette interface :

Une fois la page chargée, vous devriez vous trouvez sur cette interface : 1. Introduction Moodle est une plate-forme d enseignement collaborative en ligne déployée à l Université de Biskra. Elle permet de créer des espaces de cours accessibles depuis Internet où l enseignant

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Tutoriel Cloud IFB - Initiation -

Tutoriel Cloud IFB - Initiation - Tutoriel Cloud IFB - Initiation - Christophe BLANCHET Institut Français de Bioinformatique - IFB French Institute of Bioinformatics - ELIXIR-FR CNRS UMS3601 - Gif-sur-Yvette - FRANCE Ecole Cumulo NumBio

Plus en détail

PLATEFORME DE GESTION DE CONGRÈS SCIENTIFIQUES. h"p://www.sciencesconf.org

PLATEFORME DE GESTION DE CONGRÈS SCIENTIFIQUES. hp://www.sciencesconf.org PLATEFORME DE GESTION DE CONGRÈS SCIENTIFIQUES h"p://www.sciencesconf.org ! Sommaire Introduc9on Le portail Sciencesconf.org L espace conférence Site web Inscrip9on Ges9on scien9fique Soumission Sélec9on

Plus en détail

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr Web HTML Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr 1 Plan Fonc-onnement du web Le langage HTML 2 Web : Introduc;on Réseau : mise en commun de ressources (données, imprimantes, ) Internet : Interconnexion

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Monday, December 2 nd 2013. Formation Galaxy

Monday, December 2 nd 2013. Formation Galaxy Formation Galaxy Lundi, 10 Février 2014 This training has not for objectives to introduce every Galaxy tool individually or to build a workflow to process your own data. Objectives: To provide a first

Plus en détail

Tutoriel Cloud IFB - Initiation -

Tutoriel Cloud IFB - Initiation - Tutoriel Cloud IFB - Initiation - Christophe BLANCHET Institut Français de Bioinformatique - IFB French Institute of Bioinformatics - ELIXIR-FR CNRS UMS3601 - Gif-sur-Yvette - FRANCE Ecole Cumulo NumBio

Plus en détail

Document de formation. Français. HGC Online Portail - clients

Document de formation. Français. HGC Online Portail - clients Document de formation Français HGC Online Portail - clients 2015 Prémisse Le portail clients HGC Online est constitué des éléments suivants : Catalogue d articles Webshop Communication - Envoyer une demande

Plus en détail

Pipeline d'annotation des variants

Pipeline d'annotation des variants Pipeline d'annotation des variants École Bioinformatique AVIESAN 2015 Maria Bernard Rachel Legendre Sabrina Rodriguez 30/09/2015 Pourquoi et comment analyser les variants? Quelques définitions. Variation

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

Brady Mobile Application

Brady Mobile Application Brady Mobile Application Guide d utilisation 2011 Brady Corporation. Tous droits réservés. Brady Corporation 6555 West Good Hope Road P.O. Box 2131 Milwaukee, WI 53201-2131 www.bradycorp.com Assistance

Plus en détail

Exercices LINUX TP2 INTRODUCTION. Les précédents exercices ont permis :

Exercices LINUX TP2 INTRODUCTION. Les précédents exercices ont permis : Exercices LINUX TP2 INTRODUCTION Les précédents exercices ont permis : - d introduire les commandes de base pour se déplacer dans l arborescence et la modifier - - de manipuler les fichiers de données,

Plus en détail

Contrôle des connaissances QCM Sujet de l'examen

Contrôle des connaissances QCM Sujet de l'examen Contrôle des connaissances QCM Sujet de l'examen Remarques Durée : 2 heures. Une seule bonne réponse par question. 0,5 point par bonne réponse, 0 point par réponse indéterminée ou fausse. Noter les réponses

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS

Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS Localisa1on et Naviga1on de Robots M2 EEAII, parcours ViRob, A.U. 2014-2015 Présenta)on des ac)vités de recherche de l équipe PR du laboratorie MIS Fabio MORBIDI E-mail: fabio.morbidi@u-picardie.fr Laboratorie

Plus en détail

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris Contexte Rôle des estrogènes dans l expression sexe-dépendante

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Travaux Pratiques de Métagénomique

Travaux Pratiques de Métagénomique Travaux Pratiques de Métagénomique Comparaison des métagénomes intestinaux de patients en rémission d infection chroniques de l intestin et d individus sains 1 Introduction Bérénice Batut berenice.batut@udamail.fr

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Sélec&on des qualités physiologiques entraînables Par$e II Conversion des objec.fs d entraînement en qualités physiologiques entraînables

Sélec&on des qualités physiologiques entraînables Par$e II Conversion des objec.fs d entraînement en qualités physiologiques entraînables Sélec&on des qualités physiologiques entraînables Par$e II Conversion des objec.fs d entraînement en qualités physiologiques entraînables Maxime St-Onge, PhD Les étapes Par?e I Par?e II 1) SANTÉ & CONSENTEMENT

Plus en détail

Commandes de Word 2011 (menus, barres d outils, ruban) 1

Commandes de Word 2011 (menus, barres d outils, ruban) 1 Activer le mode plein Menu affichage > Activer le mode écran écran plein écran adresses de s (ignorer les adresses Internet et les adresses de s) orthographe> case à cocher ignorer les adresses Internet

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

Créer son mini-site sur la plateforme Mécatronique LR

Créer son mini-site sur la plateforme Mécatronique LR Créer son mini-site sur la plateforme Mécatronique LR 1 Sommaire Accéder à l interphase de création.....3 Préambule d ergonomie...4 Ajouter votre logo.....5 Transférer des fichiers sur le serveur.6 Remplir

Plus en détail

GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL

GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL GUIDE UTILISATEUR ENVOYEZ ET RECEVEZ VOS SMS PAR EMAIL 1 SOMMAIRE 1 INTRODUCTION... 3 2 ENVOYER UN SMS PAR EMAIL... 4 3 ENVOYER UN SMS VIA LE CLIENT DEDIE ESMSBOX... 6 4 ENVOYER UN SMS MAILING PAR EMAIL...

Plus en détail

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière.

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. PREAMBULE Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. Vin & Société vous transmet ces quelques règles simples de «communicagon

Plus en détail

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD Magistère Biotechnologies Analyse in silico de génomes, protéomes et transcriptomes «Génomique comparative» V.2012.1 Protocole TD Notes : Scripts et données sur : http://rna.igmors.u-psud.fr/gautheret/cours/analinsilico

Plus en détail

INFOCENTRE GUIDE UTILISATEUR IN «SAISIE AGREGEE» CE GUIDE EST DESTINÉ AUX COLLECTIVITÉS DE PLUS DE 50 AGENTS QUI EFFECTUENT LA SAISIE DITE «AGRÉGÉE».

INFOCENTRE GUIDE UTILISATEUR IN «SAISIE AGREGEE» CE GUIDE EST DESTINÉ AUX COLLECTIVITÉS DE PLUS DE 50 AGENTS QUI EFFECTUENT LA SAISIE DITE «AGRÉGÉE». GUIDE UTILISATEUR IN INFOCENTRE «SAISIE AGREGEE» RÉALISEZ VOTRE BILAN SOCIAL VIA LA SAISIE DITE «AGRÉGÉE» COLLECTE DES DONNÉES DE 2013 CE GUIDE EST DESTINÉ AUX COLLECTIVITÉS DE PLUS DE 50 AGENTS QUI EFFECTUENT

Plus en détail

Récupérer la base de données jusqu'à un point dans le temps (Récupération incomplète)

Récupérer la base de données jusqu'à un point dans le temps (Récupération incomplète) Récupérer la base de données jusqu'à un point dans le temps (Récupération incomplète) Wissem EL KHLIFI Aperçu 1. Introduction 2. Besoins 3. Mettre la base de données en mode de sauvegarde à chaud. 4. Copie

Plus en détail

/ Op%misa%on du référencement. Optimiser le référencement de son site web. Emmanuel Winstein ewinstein@lacouleurduzebre.com www.lacouleurduzebre.

/ Op%misa%on du référencement. Optimiser le référencement de son site web. Emmanuel Winstein ewinstein@lacouleurduzebre.com www.lacouleurduzebre. Optimiser le référencement de son site web Emmanuel Winstein ewinstein@lacouleurduzebre.com www.lacouleurduzebre.com Introduc%on Défini%on des termes u%lisés dans le référencement No%ons d'html et présenta%on

Plus en détail

Sommaire. 1 ) Qu'est ce que WordPress. 2 ) Pourquoi WordPress. 3 ) Les sites statiques et les sites dynamiques. 4 ) Les parties de WordPress

Sommaire. 1 ) Qu'est ce que WordPress. 2 ) Pourquoi WordPress. 3 ) Les sites statiques et les sites dynamiques. 4 ) Les parties de WordPress Sommaire 1 ) Qu'est ce que WordPress 2 ) Pourquoi WordPress 3 ) Les sites statiques et les sites dynamiques 4 ) Les parties de WordPress 5 ) Les éléments de WordPress 6 ) Les avantages 1 ) Qu'est ce que

Plus en détail

L ou7l professionnel de BMD pour l audit. Lausanne, le 14 septembre 2015

L ou7l professionnel de BMD pour l audit. Lausanne, le 14 septembre 2015 L ou7l professionnel de BMD pour l audit Lausanne, le 14 septembre 2015 Agenda 1. Introduc7on par EXPERTsuisse 2. Présenta7on de BMD, société de services informa7ques 3. Développement commercial en Suisse

Plus en détail

Guide de Démarrage Desktop. 2014 Release 1 Xojo, Inc.

Guide de Démarrage Desktop. 2014 Release 1 Xojo, Inc. Guide de Démarrage Desktop 2014 Release 1 Xojo, Inc. Chapitre 1 Introduction Bienvenue dans Xojo, le moyen le plus facile de créer des applications desktop and web multiplateformes. Section 1 À propos

Plus en détail

Création de mises en plan

Création de mises en plan Création de mises en plan Numéro de publication spse01545 Création de mises en plan Numéro de publication spse01545 Avertissement sur les droits de propriété et les droits réservés Ce logiciel et la documentation

Plus en détail

POWERGES. La gestion des devis

POWERGES. La gestion des devis 1. Préparation et configuration générale du programme des DEVIS Avant toute chose, il est nécessaire de configurer l environnement que vous voudriez utiliser. Pour ce faire, il faut rentrer dans le menu

Plus en détail

L Auto-Entrepreneur sur PIXI

L Auto-Entrepreneur sur PIXI L Auto-Entrepreneur sur PIXI Les formalités qui dépendent du Registre de Commerce et des Sociétés sont établies auprès de : - l URSSAF - du CFE Concernant les CFE des Chambres de Commerce et d Industrie

Plus en détail

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes.

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. Choisissez votre modèle Parmi la sélection proposée en ligne. Comment Choisir son modèle en fonction de ses besoins? Niveau Débutant

Plus en détail

Atelier de l innovation

Atelier de l innovation Atelier de l innovation BUSINESS POUR L ÉCONOMIE CIRCULAIRE Chaire Economie de l innovation - Mourad Zeroukhi Centre de Recherche en Économie et Management Université de Chaire Economie de l innovation

Plus en détail

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Octobre 2011 Pour préparer une newsletter, gérer les listes de diffusion ou inscrire plusieurs personnes Codes www.agriculture-moyenne-montagne.org/newsletter/admin

Plus en détail

UTILISATION DE WETRANSFER

UTILISATION DE WETRANSFER UTILISATION DE WETRANSFER Fiche d utilisation de l application en ligne WeTransfer Débuter WeTransfer est une application en ligne d hébergement temporaire de fichiers. Vous envoyez vos fichiers sur cette

Plus en détail

Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»).

Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»). Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»). http://galaxy-workbench.toulouse.inra.fr/ Quelque soit

Plus en détail

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document.

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document. Writer Attention : Les documents faits avec Writer ne pourront être lu qu avec Writer, sauf manipulation permettant l échange avec d autres logiciels. Le logiciel se présente directement avec une page

Plus en détail

Présentation des modules Dessin 2D Architecture/Présentation Modeleur 3D C3 ingénierie

Présentation des modules Dessin 2D Architecture/Présentation Modeleur 3D C3 ingénierie CAO / DAO AllPlan - Initiation...2 Allplan - Perfectionnement...2 ArchiCAD - Initiation...3 ArchiCAD - Perfectionnement...3 Artlantis Render - Initiation...4 AutoCAD - Initiation...4 AutoCAD - Initiation...5

Plus en détail

Utilisation de la Galerie photo http://scalp77.fr/photo/

Utilisation de la Galerie photo http://scalp77.fr/photo/ Utilisation de la Galerie photo http://scalp77.fr/photo/ 1- a) navigation page Accueil Là, vous avez toutes les ctaégories (répertoires) de photos. Vous y accédez soit en cliquant sur la catégorie, soit

Plus en détail

ENVIRONNEMENT PLATEFORME INTERNET

ENVIRONNEMENT PLATEFORME INTERNET ENVIRONNEMENT PLATEFORME INTERNET Fichiers -> Environnement Web 1/ Gabarit de la plateforme L ensemble des boutons, fond d écran, fond de fenêtre sont paramétrables 2/ Textes sous spectacle Texte présent

Plus en détail

LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ

LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ PARTENAIRES MOBILITE LE MOBILE B2B : UN LEVIER BUSINESS INSOUPÇONNÉ PROGRAMME Le mobile B2B est un sujet extrêmement large qui recouvre de nombreux thèmes. Nous aborderons les probléma(ques liées aux offres

Plus en détail

Guide de formation avec exercices et cas pratiques. Excel 2013. initiation. Philippe Moreau. TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5

Guide de formation avec exercices et cas pratiques. Excel 2013. initiation. Philippe Moreau. TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5 Guide de formation avec exercices et cas pratiques Excel 2013 initiation Philippe Moreau TSoft et Groupe Eyrolles, 2013, ISBN : 978-2-212-13811-5 LES DONNÉES LES CALCULS LE RÉSULTAT Tsoft/Eyrolles Excel

Plus en détail

Tutoriel Cloud IFB. IBI - 1 Utilisation de base du Cloud IFB

Tutoriel Cloud IFB. IBI - 1 Utilisation de base du Cloud IFB Tutoriel Cloud IFB IBI - 1 Utilisation de base du Cloud IFB Sommaire I. Créer un compte sur le cloud IFB II. Instancier une VM III. Echanger les données IV. Gérer les disques virtuels V. Utiliser un bureau

Plus en détail