Introduc)on à Ensembl/ Biomart : Par)e pra)que

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Introduc)on à Ensembl/ Biomart : Par)e pra)que"

Transcription

1 Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller

2 NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que

3 Exercice 1 1.a. Quelle est la version de l assemblage du génome humain disponible sur la dernière version du site d Ensembl? 1.b. Quelle est la taille du génome du panda? Regarder le Base Pairs Regarder le Golden Path Length 1.c. Quelle est la taille du génome humain? Regarder le Base Pairs Regarder le Golden Path Length 3 Naviga)on dans Ensembl : Pra)que

4 Réponse à la ques)on 1.a GRCh37 4

5 Réponse à la ques)on 1.b 5

6 Réponse à la ques)on 1.c Taille du génome humain 6

7 Exercice 2 Quelle est la version du génome du rat- taupe nu? (Heterocephalus glaber) Combien de gènes ont été prédits par Genscan? 7 Naviga)on dans Ensembl : Pra)que

8 Réponse à la ques)on 2 8

9 Ques)on 3 Retrouver la taille du chromosome 4 dans le génome humain assemblage hg19 9 Naviga)on dans Ensembl : Pra)que

10 Réponse 3 10

11 Exercice 4 4.a - Combien de transcrits alterna)fs possède le gène BBS5 (chez l Homme) 4.b - Combien d exons possède le transcript BBS c - Combien d exons sont codants? Remarque - Comparer les couleurs d affichages de transcrits BBS5-001 et BBS Naviga)on dans Ensembl : Pra)que

12 Réponse 4.a 7 transcrits alterna)fs 12

13 Réponse 4.b 4 exons 13

14 Réponse 4.b.c 0 exon codant 14

15 Exercice 5 Retrouver ce`e page 15 Naviga)on dans Ensembl : Pra)que

16 Réponse 5 16

17 Exercice 6 Retrouver ce`e page 17 Naviga)on dans Ensembl : Pra)que

18 Réponse 6 18

19 Exercice 7 Déterminer le nombre total de varia)ons dans le gène BRCA1 19 Naviga)on dans Ensembl : Pra)que

20 Réponse 7 20

21 Exercice 8 Afficher dans le navigateur de génome les données d expression (RNAseq) dans deux )ssus (breast, skeletal muscle) au niveau du gène BRCA1 21 Naviga)on dans Ensembl : Pra)que

22 Réponse 8 22

23 Exercice 9 Afficher les termes GO associés aux transcrits BRCA Naviga)on dans Ensembl : Pra)que

24 Réponse 9 24

25 Exercice 10 Mener l enquête pour retrouver le nouvel iden)fiant Ensembl (gène) pour le gène : ENSG

26 Réponse 10

27 Exercice 11 Visualiser le fichier unique_crn- 107.bam dans Ensembl Adresse : jp://jp- igbmc.u- strasbg.fr/pub/ slegras/dudijon/unique_crn- 107_11.bam Aller voir le gène BBS1

28 Réponse 11

29 OUTILS : PARTIE PRATIQUE

30 Exercice BLAST Quel est la localisa)on génomique de BBS1? Séquence protéique: Recherche de la séquence protéique BBS1 dans les archives du génome humain août h`p://www- bio3d- igbmc.u- strasbg.fr/~jmuller/enseignement.html h`p://www.ensembl.org/info/website/archives/index.html TBLASTN sur le génome humain

31 PlateForMe

32 Est- ce que le chromosome 9 est la bonne localisaeon?

33 Exercice BLAST

34 Exercice BLAST

35 Exercice BLAST

36 Exercice BLAST LocalisaEon sur le chromosome 11

37 Alignement vs génome Plusieurs HSP 100% ID E- value plus élevée car calculée sur le chromosome en en)er 1 ou 2 HSP >80% ID E- value plus faible car alignement en un seul bloc

38 Exercice BLAST Est- ce bien le gène BBS1?

39 Exercice BLAST

40 BIOMART : PARTIE PRATIQUE 40 Naviga)on dans Ensembl : Pra)que

41 Exercice 1 Retrouver les iden)fiants Ensembl du gène et de tous les transcrits du gène BBS1 chez l Homme En entrée : Gène BBS1 (Gene Symbol) En sor)e : Ensembl Gene ID Ensembl Transcript ID Associated Gene Name 41 BioMart

42 Réponse 1 42

43 Exercice 2 Extraire toutes les séquences de tous les exons du gène BRCA1 Dans les entêtes, il devra y avoir : Associated gene name Ensembl Transcript ID Ensembl Exon ID 43

44 Résultat 2

45 Exercice 3 Extraire les séquences codantes des transcrits du gène BRCA1 (iden)fiant Ensembl : ENSG ) Dans les entêtes, il devra y avoir : Ensembl Transcript ID Ensembl Exon ID

46 Résultat 3

47 Exercice 4 A par)r des coordonnées chromosomiques suivantes : chr chr Répondez aux ques)ons suivantes : Dans quel(s) gènes(s) se trouve- t- on? Si l on est dans un gène, récupérer les termes GO associés aux gènes Combien de variants germinaux con)ennent les régions

48 Réponse 4

49 Remarques Coordonnées commencent à 1 (a`en)on dans UCSC, les coordonnées commencent à 0) A`en)on pas de prefix chr devant les noms des chromosomes A`en)on chromosome Mitochondrial = MT dans Ensembl alors qu il est M dans UCSC Lié à Galaxy 49 Ensembl : fonc)onnement

MODULE 4 Introduction à IGV

MODULE 4 Introduction à IGV MODULE 4 Introduction à IGV Jean-Baptiste Rivière jean-baptiste.riviere@u-bourgogne.fr 22/01/2014 Integrative Genomics Viewer (IGV) Logiciel de visualisation de données génomiques (NGS, microarray, annotations

Plus en détail

Manuel Surintendant. Journal de chantier. Proposé par la CEGQ Copyright 2014 Tous droits réservés

Manuel Surintendant. Journal de chantier. Proposé par la CEGQ Copyright 2014 Tous droits réservés Manuel Surintendant Journal de chantier Proposé par la CEGQ Copyright 2014 Tous droits réservés Présentation du service L application «journal de chantier» est un outil offert gratuitement par la CEGQ

Plus en détail

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA

Guide d u(lisa(on de la base de données Odyssea. Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Guide d u(lisa(on de la base de données Odyssea 1 Réalisa'on : GROUPEMENT EUROPÉEN ODYSSEA GEC ODYSSEA Lexique - Marker: POI (Point Of Interest) - URL: Uniform ressource Locator, c est une adresse web

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe

Office 365 et SharePoint Configuration de l'espace de travail collaboratif et gestion du site d'équipe GÉNÉRALITÉS. Découverte 1 A- Présentation générale 1 B- Présentation des applications Office Web Apps 1 C- Les services dédiés au partage 1 1. Espace de travail 2 A- Description de la page d accueil Administrateur

Plus en détail

MEMENTO. Interface d administration du site www.ville-joigny.fr. I. Identification :... 2. II. Présentation de l interface :... 3

MEMENTO. Interface d administration du site www.ville-joigny.fr. I. Identification :... 2. II. Présentation de l interface :... 3 MEMENTO Interface d administration du site www.ville-joigny.fr I. Identification :... 2 II. Présentation de l interface :... 3 III. Modification des pages du site :... 5 A. Chaque paragraphe comporte un

Plus en détail

Interface Homme- Machine. Interface pour le web

Interface Homme- Machine. Interface pour le web Interface Homme- Machine Interface pour le web Ergonomie du web : Importance Web U7lisateurs novices et nomades (accès libre) Ergonomie des interfaces Web 62% des acheteurs en ligne abandonnent au moins

Plus en détail

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document.

Writer. Le logiciel se présente directement avec une page vierge, prête à l emploi pour créer votre nouveau document. Writer Attention : Les documents faits avec Writer ne pourront être lu qu avec Writer, sauf manipulation permettant l échange avec d autres logiciels. Le logiciel se présente directement avec une page

Plus en détail

QU EST-CE QU UN BLOGUE

QU EST-CE QU UN BLOGUE Conception Mathieu Brisson Pour plus d information Séverine Parent Conseillère pédagogique TIC - Q3076 - poste 6121 severine.parent@climoilou.qc.ca QU EST-CE QU UN BLOGUE Le blogue est un site web personnel,

Plus en détail

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Présentation de l outil de visualisation cartographique

Présentation de l outil de visualisation cartographique Présentation de l outil de visualisation cartographique L outil de visualisation cartographique permet : - D afficher les stations de mesure du bassin Artois-Picardie - De sélectionner les stations d intérêt

Plus en détail

MEMENTO Gestion du Site Commanderie

MEMENTO Gestion du Site Commanderie MEMENTO Gestion du Site Commanderie Bienvenue dans votre site web Commanderie Pour accéder à votre site Commanderie : http://nom.anysetiers.org Naviguer dans les Pages de votre site : Accueil Calendrier

Plus en détail

Sites web propriétaires

Sites web propriétaires Ce document est disponible à : C:\Users\pc_samba\Documents\Doc sites prop.docx Sommaire 1 Introduction... 3 2 Création du mini-site... 4 2.1 Autorisation de création... 4 2.2 Création de votre site Web...

Plus en détail

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000)

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) II) Annotation de gènes codant des protéines 1) Objectif du TD L objectif du

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

AIDE EN LIGNE. Espace Récep0f

AIDE EN LIGNE. Espace Récep0f AIDE EN LIGNE Espace Récep0f 1 2 3 4 5 Page d authen,fica,on Votre nouvel espace récep,f Mode recherche de produits Explorez votre catalogue produits Modifica,on d un produit La créa,on de nouveaux produits

Plus en détail

MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA

MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA MAÎTRISE DE L ENVIRONNEMENT WINDOWS VISTA OBJECTIFS : manipuler les fenêtres et l environnement Windows, gérer ses fichiers et dossiers, lancer les applications bureautiques présentes sur son poste. PUBLIC

Plus en détail

2) Combien de tableaux apparents ont été tracés dans le site et de combien de cellules?

2) Combien de tableaux apparents ont été tracés dans le site et de combien de cellules? Travail dirigé : éléments de correction Item B53 du C2I Lycée M. Ponty II- Travail d analyse technique d un site Afin de vous proposez une présentation cohérente, votre entreprise à mis en ligne une illustration

Plus en détail

UTILISATION. Connecteur E-commerce

UTILISATION. Connecteur E-commerce Connecteur E-commerce UTILISATION Le connecteur E-commerce Gestimum Prestashop est une plateforme web PHP qui permet de synchroniser de manière automatique ou manuelle les données présentes sur votre ERP

Plus en détail

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière.

PREAMBULE. Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. PREAMBULE Les réseaux sociaux offrent un espace de prise de parole formidable pour toutes les entreprises qui composent notre filière. Vin & Société vous transmet ces quelques règles simples de «communicagon

Plus en détail

Centres d accès communautaire Internet des Îles OUTLOOK

Centres d accès communautaire Internet des Îles OUTLOOK Centres d accès communautaire Internet des Îles MICROSOFT OUTLOOK INTRODUCTION Tables des matières Introduction 1 - Inscription à Outlook 2 - Fonction de base 2.1. Lire un courriel 2 2 min 2.2. Écrire

Plus en détail

Plateforme de bioinformatique

Plateforme de bioinformatique Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1%

Plus en détail

Composeur. Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers. 88 Séminaire utilisateurs QGIS

Composeur. Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers. 88 Séminaire utilisateurs QGIS Composeur Fonctionnalités : Onglet éléments Légende Images et pages Web Tableaux Grilles Miniatures Divers 88 Séminaire utilisateurs QGIS Composeur de cartes 89 Séminaire utilisateurs QGIS Création d une

Plus en détail

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne

Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Système de gestion des newsletters de Agriculture Durable de Moyenne Montagne Octobre 2011 Pour préparer une newsletter, gérer les listes de diffusion ou inscrire plusieurs personnes Codes www.agriculture-moyenne-montagne.org/newsletter/admin

Plus en détail

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8.

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8. PROCEDURES TAKE FIVE SOMMAIRE 1. Paramétrage 2. Page d accueil 3. Clients 4. Catalogue 5. Ventes 6. Statistiques 7. Agenda 8. Taches 9. Bloc-notes 10. Procédure(s) automatisée(s) 11. Sauvegarde 1. Paramétrage

Plus en détail

Documentation Askfornet v1.7

Documentation Askfornet v1.7 Documentation Askfornet v1.7 - Page 1 sur 6 Documentation Askfornet v1.7 I. Menu principal Permet de créer un nouveau Permet de gérer vos s Permet de modifier les informations de votre société Permet de

Plus en détail

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre

Introduc)on à Drupal. Journées Mathrice, octobre 2010 par Kenji Lefèvre Introduc)on à Drupal Journées Mathrice, octobre 2010 par Kenji Lefèvre Sommaire 1. Présenta>on succincte 2. À qui s adresse Drupal? 3. Avantages et difficultés 4. Architecture, administra>on Drupal 5.

Plus en détail

Manuel des répondants de CaRMS en ligne

Manuel des répondants de CaRMS en ligne Manuel des répondants de CaRMS en ligne Veuillez noter que nous vous suggérons d utiliser un navigateur Web recommandé avant d accéder pour la première fois à la plateforme CaRMS en ligne. CaRMS recommande

Plus en détail

Tutoriel Technique. Plateforme de suivi des usages des ressources. Version 2 Date de conception : 03/2014 Auteur : Équipe UVED

Tutoriel Technique. Plateforme de suivi des usages des ressources. Version 2 Date de conception : 03/2014 Auteur : Équipe UVED Tutoriel Technique Plateforme de suivi des usages des ressources Version 2 Date de conception : 03/2014 Auteur : Équipe UVED 1. Connexion à la plateforme de suivi des usages Pour accéder à la plateforme

Plus en détail

Aide sur l interface www.icasprint.com

Aide sur l interface www.icasprint.com Sommaire 1. Présentation des pages a. La page d accueil b. Gérer mon compte c. Commander un produit d. Personnaliser un modèle e. Voir le panier f. Suivi des demandes 2. Commander un produit 3. Personnaliser

Plus en détail

Guide d utilisation de votre site de gestion de contenu CMS Made Simple

Guide d utilisation de votre site de gestion de contenu CMS Made Simple Guide d utilisation de votre site de gestion de contenu CMS Made Simple Version 2.0 Table des matières Présentation... 3 Se connecter à l administration de votre site... 3 Retrouvez son mot de passe....

Plus en détail

Commandes de Word 2011 (menus, barres d outils, ruban) 1

Commandes de Word 2011 (menus, barres d outils, ruban) 1 Activer le mode plein Menu affichage > Activer le mode écran écran plein écran adresses de s (ignorer les adresses Internet et les adresses de s) orthographe> case à cocher ignorer les adresses Internet

Plus en détail

Introduction à Expression Web 2

Introduction à Expression Web 2 Introduction à Expression Web 2 Définitions Expression Web 2 est l éditeur HTML de Microsoft qui répond aux standard dew3c. Lorsque vous démarrez le logiciel Expression Web 2, vous avez le choix de créer

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Guide d utilisation de la plateforme Multiaccès

Guide d utilisation de la plateforme Multiaccès Guide d utilisation de la plateforme Multiaccès Qu est-ce que la plateforme Multiaccès? La plateforme régionale de formation en ligne Multiaccès permet à tout le personnel du CHU de Québec, du travail

Plus en détail

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr

Web HTML. Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr Web HTML Arnaud Sallaberry arnaud.sallaberry@univ- montp3.fr 1 Plan Fonc-onnement du web Le langage HTML 2 Web : Introduc;on Réseau : mise en commun de ressources (données, imprimantes, ) Internet : Interconnexion

Plus en détail

Guide d utilisation - Modifications portfolio des artisans

Guide d utilisation - Modifications portfolio des artisans Accéder au tableau de bord Pour entrer dans l espace d administration, allez à l adresse suivante : www.metiersdartbsl.com Cliquez ensuite sur l icône CONNEXION dans le haut à droite de la page. Une fenêtre

Plus en détail

RECUPERATION DES ADRESSES MAIL PARENTS DANS OUTLOOK

RECUPERATION DES ADRESSES MAIL PARENTS DANS OUTLOOK EXTRACTION DES ADRESSES MAIL PARENTS DU LOGICIEL ELEVES Lancez le programme Elèves. Cliquez sur le menu Import/Export, Extraction fichier texte 1 Cliquez sur Mode Expert 2 Cliquez dans la 1 ère colonne

Plus en détail

Aide et procédures du backoffice

Aide et procédures du backoffice Aide et procédures du backoffice 1. Accès au back office 1.1 Connection au backoffice 1.2 Renouvellement du mot de passe 2. Gestion de l arborescence 2.1 Gestion des sous-rubriques 2.1.1 Ajouter une sous-rubrique

Plus en détail

Comment utiliser Votre site web» Table des matières Tableau de bord de Votre site web»...2 Ajouter un fichier média : Images»...6 Guide de démarrage

Comment utiliser Votre site web» Table des matières Tableau de bord de Votre site web»...2 Ajouter un fichier média : Images»...6 Guide de démarrage Comment utiliser Votre site web» Table des matières Tableau de bord de Votre site web»...2 Ajouter un fichier média : Images»...6 Guide de démarrage rapide. Rédiger une page ou un article,»...3 Ajouter

Plus en détail

Portail des communes Guide Référent ville

Portail des communes Guide Référent ville Portail des communes Guide Référent ville Services aux communes Introduction Vous êtes Référent pour votre commune et venez de recevoir vos identifiants de connexion à l ENT école. Ce document va vous

Plus en détail

Créer un formulaire (une enquête) en ligne sur Google

Créer un formulaire (une enquête) en ligne sur Google Créer un formulaire (une enquête) en ligne sur Google Google vous permet de réaliser différents travaux en ligne, notamment des formulaires que vous pouvez ensuite envoyer via votre boîte Gmail et dont

Plus en détail

note de procédure CONFIGURATION DES AGENTS ET SUPERVISEURS DES CALL CENTER Objet Destinataire(s) : Copie(s) : Page 1 / 18 Cf INTRANET DOCUMENTAIRE

note de procédure CONFIGURATION DES AGENTS ET SUPERVISEURS DES CALL CENTER Objet Destinataire(s) : Copie(s) : Page 1 / 18 Cf INTRANET DOCUMENTAIRE Créé le 14/03/2014 Version 2 Révisé le : 14/10/2008 Emetteur : Etat : DOP Production Système Infra IP Michel GRILLIET Destinataire(s) : Cf INTRANET DOCUMENTAIRE Copie(s) : Cf INTRANET DOCUMENTAIRE note

Plus en détail

Initiation à Open Office Writer (logiciel libre/gratuit)

Initiation à Open Office Writer (logiciel libre/gratuit) Initiation à Open Office Writer (logiciel libre/gratuit) I/ Téléchargement et Installation Lancez votre navigateur Internet Tapez Open Office dans Google. Cliquez sur le lien : fr: OpenOffice.org Cliquez

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

IFT1148 Développement

IFT1148 Développement IFT1148 Développement Michael Blondin Direction de l enseignement de service en informatique Université de Montréal Hiver 2011 1 / 33 ASP.NET ASP.NET est un ensemble de technologies développé par Microsoft

Plus en détail

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet

Serveur WEB AUTOMGEN. Pour la réalisation d un superviseur accessible à partir d un navigateur Internet Serveur WEB AUTOMGEN Pour la réalisation d un superviseur accessible à partir d un navigateur Internet 1 Introduction Le serveur WEB d AUTOMGEN permet de réaliser des applications de supervision accessibles

Plus en détail

GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS

GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS Table des matières Présentation de la plateforme d envoi de courriels... 4 1- Gestion des contacts... 5 1.1. Base de données... 5 1.1.1- Création

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

INTRODUCTION A LA BIOINFORMATIQUE

INTRODUCTION A LA BIOINFORMATIQUE INTRODUCTION A LA BIOINFORMATIQUE Yvan Le Bras @Yvan2935 Yvan.le_bras@irisa.fr CNRS IRISA INRIA Plateforme GenOuest 20 avril 2016 Olivier Collin (https://www.e-biogenouest.org/resources/527) BANQUES Bases

Plus en détail

Comment créer une Battle?

Comment créer une Battle? Comment créer une Battle? Mai 2015 Sommaire 3. 4. 5. 6. 7-8. 9. 10. 11. 12. 13-14. 15. 16. 17. 18. 19. Fonc%onnement Choisissez votre type de campagne Choisissez un canal de publica%on Ajoutez une so;

Plus en détail

Portail Client Sigma Informatique

Portail Client Sigma Informatique Portail Client Sigma Informatique Edité le 19 févr. 2013 Sommaire Présentation du portail client 3 La page d accueil 8 Vie d une demande (Création et suivi) 11 La consultation d une demande. 18 La gestion

Plus en détail

Gestion des communautés Mode d emploi des outils animateurs

Gestion des communautés Mode d emploi des outils animateurs Gestion des communautés Mode d emploi des outils animateurs CONNEXION AU SITE http://www.neoma-alumni.com Utilisez vos identifiants personnels pour vous connecter à votre compte sur le site. En cas de

Plus en détail

DÉMATÉRIALISATION DES MARCHÉS

DÉMATÉRIALISATION DES MARCHÉS DÉMATÉRIALISATION DES MARCHÉS MODE OPERATOIRE : CONSULTATION DES MARCHES SIGNES Innovation-Développement Table des matières 1 NOTIFICATION DE LA MISE A DISPOSITION DES DOCUMENTS... 1 2 CONNEXION AUX PLATES-FORMES

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes.

Comment personnaliser son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. son modèle? Voici un petit guide pour réaliser votre modèle en 4 étapes. Choisissez votre modèle Parmi la sélection proposée en ligne. Comment Choisir son modèle en fonction de ses besoins? Niveau Débutant

Plus en détail

Mode d emploi : Mise en page d un article de blog ou d un article d accueil

Mode d emploi : Mise en page d un article de blog ou d un article d accueil Mode d emploi : Mise en page d un article de blog ou d un article d accueil Décembre 2011 Pour mettre en page un article de blog ou un article éditable : utilisation de l éditeur de contenu. Editeur de

Plus en détail

Introduction à Moodle

Introduction à Moodle Introduction à Moodle Lors de cette formation d introduction à la plateforme Moodle, nous expérimentons les outils de base pour ajouter du contenu en ligne, les paramètres, les fonctions de mise en page,

Plus en détail

Poitou-Charentes. Qu est-ce qu une carte dynamique? Quels outils autour de la carte dynamique? Consulter une carte dynamique

Poitou-Charentes. Qu est-ce qu une carte dynamique? Quels outils autour de la carte dynamique? Consulter une carte dynamique A la source de l information géographique Consulter une carte dynamique Pour les conseils et astuces : Suivez le guide Qu est-ce qu une carte dynamique? C est un module cartographique qui permet de visualiser

Plus en détail

MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE)

MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE) MODE OPERATOIRE CONCERNANT LES BONS DE COMMANDE SUR MARCHE ET LA NOUVELLE PLATEFORME EFOLIA (ENTREPRISE) 1) Quelques définitions... 3 2) Inscription sur le portail Efolia... 3 3) Récupération de la clé

Plus en détail

-Le traitement de texte. -Le courrier électronique

-Le traitement de texte. -Le courrier électronique 1/17 SOMMAIRE : -Windows -Le traitement de texte -Internet -Le courrier électronique 2/17 WINDOWS PRISE EN MAIN DE WINDOWS Lorsque vous démarrez votre ordinateur vous devez voir arriver un écran qui ressemble

Plus en détail

DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22

DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22 Manuel Utilisateur DATAFIRST 117, rue Bataille 69372 Lyon cedex 08 Tel : 04-78-78-11-12 Fax : 04-78-78-11-22 1. SOMMAIRE Datacar Admin 1. SOMMAIRE...2 2. DESCRIPTION...5 3. DEMARRAGE DE DATACAR ADMIN...6

Plus en détail

Optimiser moteur recherche

Optimiser moteur recherche Optimiser moteur recherche Vous apprennez à inscrire vos sites dans les moteurs de recherche et les optimiser, déjà à la construction Worldsoft SA Inscription de sites Web dans les moteurs de recherche

Plus en détail

Mode d emploi SPIP 2.0 pour rédacteur

Mode d emploi SPIP 2.0 pour rédacteur Mode d emploi SPIP 2.0 pour rédacteur L objectif de ce document est d apprendre à utiliser le logiciel SPIP en tant que rédacteur. Ce cours ne requiert aucune connaissance informatique préalable à part

Plus en détail

Administration du module Gestion Accueil

Administration du module Gestion Accueil Administration du module Gestion Accueil 1 1. Administration : administration accueil 1.1. Affichage demande 4 1.2. Définition d une recherche pour le formulaire 6 1.3. Formulaire de recherche 8 1.4. Configuration

Plus en détail

Exercice 4.1 Gestion des rapports

Exercice 4.1 Gestion des rapports Exercice 4.1 Gestion des rapports Déplacer un document vers un autre dossier Copier un document vers un autre dossier Renommer un document Supprimer un document Dupliquer un rapport Renommer un rapport

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Présentation L ÉDITEUR D ÉTAT SUR PÉRICLÈS 5

Présentation L ÉDITEUR D ÉTAT SUR PÉRICLÈS 5 Présentation L ÉDITEUR D ÉTAT SUR PÉRICLÈS 5 Sommaire Questions fréquentes (Cliquez sur la question pour accéder directement à la réponse.) - Introduction... 3 - Présentation de la barre d outils... 4

Plus en détail

Traitement de texte et publipostage

Traitement de texte et publipostage Outils Informatiques Mias 1 TP 3 Traitement de texte et publipostage Première partie : principes du traitement de texte Cette séance de travaux pratiques va commencer par quelques manipulations de l éditeur

Plus en détail

Utilisation du rapport de statistique des absences (Cognos)

Utilisation du rapport de statistique des absences (Cognos) Utilisation du rapport de statistique des absences (Cognos) Table des matières Description... 2 Source... 2 Fréquence... 2 Méthode de calcul... 3 Temps de réponse... 3 Accès aux rapports... 3 Rapports

Plus en détail

BASE DE DONNEES SOUS ACCESS «Gestion de contacts commerciaux»

BASE DE DONNEES SOUS ACCESS «Gestion de contacts commerciaux» BASE DE DONNEES SOUS ACCESS «Gestion de contacts commerciaux» Contenu 1 - Description de la base de données... 1 2 - Interface d Access :... 3 3 Création des tables (structure)... 5 4 - Relations entre

Plus en détail

educanet² Nouveautés Novembre 2007

educanet² Nouveautés Novembre 2007 educanet² Nouveautés Novembre 2007 Notre plate-forme s enrichit de quelques fonctionnalités bien utiles. Modération de groupes Logos Le logo d une classe ou d un groupe peut maintenant s afficher sur toutes

Plus en détail

Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8

Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8 Tsoft et Groupe Eyrolles, 2004, ISBN : 2-212-11416-8 3 - FONCTIONS PROPRES AUX DOCUMENTS LONGS HOMOGÉNÉISER LES MISES EN FORME Quand vous mettez en forme du texte, Word mémorise ces mises en forme et les

Plus en détail

Guide de l Etudiant pour Moodle. S inscrire dans un cours et déposer un devoir

Guide de l Etudiant pour Moodle. S inscrire dans un cours et déposer un devoir Guide de l Etudiant pour Moodle S inscrire dans un cours et déposer un devoir Sommaire 1. Connexion à la plate-forme...3 2. Inscription dans un cours...5 2.1. Inscription individuelle...5 2.2. Inscription

Plus en détail

Styler un document sous Word 2010*

Styler un document sous Word 2010* Février 2014 Styler un document sous Word 2010* Un style est un ensemble de caractéristiques de mise en forme (police, taille, espacement, etc.) qui sert à structurer un document en l organisant de manière

Plus en détail

Guide d utilisation de la plate-forme EAD-COMETE. Interface étudiant

Guide d utilisation de la plate-forme EAD-COMETE. Interface étudiant Guide d utilisation de la plate-forme EAD-COMETE Interface étudiant I Ouverture d un compte utilisateur... 2 I.1 Procédure d obtention d un compte mail à Paris X... 2 I.2 Ouverture de compte sur ead-comete...

Plus en détail

Envoyer un e-mailing personnalisé

Envoyer un e-mailing personnalisé Envoyer un e-mailing personnalisé Créer sa liste de contacts Avec Excel, vous pouvez créer facilement la liste des personnes à qui vous souhaitez envoyer votre e-mailing personnalisé. 1. Dans Excel, créez

Plus en détail

Créer un calendrier de l Avent

Créer un calendrier de l Avent Créer un calendrier de l Avent Mai 2015 Sommaire 3. 4. 5. 6. 7. 8-9. 10. 11-12. 13. 14. 15. 16. Introduc)on / principe Choisissez votre type de campagne Choisissez un canal de publica)on Choisissez les

Plus en détail

Espace Numérique Régional de Santé Formation Agora Project

Espace Numérique Régional de Santé Formation Agora Project Espace Numérique Régional de Santé Formation Agora Project Sommaire 1. Introduction 2. Se connecter 3. Présentation Générale 4. Paramétrage de l espace 5. Utilisateur de l espace 6. Gestionnaire de fichier

Plus en détail

Tramway version 3.0. Trucs et astuces

Tramway version 3.0. Trucs et astuces Tramway version 3.0 Trucs et astuces Astuce #1 : Se brancher dans Tramway pour la première fois But : Démontrer les étapes nécessaires au branchement dans Tramway Outil nécessaire : fureteur Internet 1.

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

Traitement des images par les applications Web PL/SQL. Groupe d intérêt Designer Vendredi 18 février 2005

Traitement des images par les applications Web PL/SQL. Groupe d intérêt Designer Vendredi 18 février 2005 Traitement des images par les applications Web PL/SQL Groupe d intérêt Designer Vendredi 18 février 2005 Plan 1. Introduction 2. Images stockées sur le serveur d application 3. Images stockées comme fichiers

Plus en détail

Créer son mini-site sur la plateforme Mécatronique LR

Créer son mini-site sur la plateforme Mécatronique LR Créer son mini-site sur la plateforme Mécatronique LR 1 Sommaire Accéder à l interphase de création.....3 Préambule d ergonomie...4 Ajouter votre logo.....5 Transférer des fichiers sur le serveur.6 Remplir

Plus en détail

Livraison en magasin. Liste des fichiers. Installation via FTP

Livraison en magasin. Liste des fichiers. Installation via FTP Livraison en magasin Liste des fichiers StoreDeliveryConfig.php StoreDelivery.php Entry.php EntryDB.php directory_entry_summary_store.html point_storedelivery.html storedelivery.html storedelivery.js styles.css

Plus en détail

SOLUTIONS & SERVICES OPEN SOURCE. Messagerie Zimbra. Prise en main

SOLUTIONS & SERVICES OPEN SOURCE. Messagerie Zimbra. Prise en main SOLUTIONS & SERVICES OPEN SOURCE Messagerie Zimbra Prise en main 23 juin 2010 Sommaire 1. CONNEXION A LA MESSAGERIE ZIMBRA... 4 1.1. Ecran de connexion à la messagerie... 4 2. PRESENTATION GENERALE DE

Plus en détail

Le WEB : HTML. Formation Systèmes d'information et numérique. Exercices en HTML

Le WEB : HTML. Formation Systèmes d'information et numérique. Exercices en HTML 1 ère STI2D TD V1.0 Le WEB : HTML Formation Systèmes d'information et numérique 1) Exercice 1 : Texte simple : Exercices en HTML A l aide de Notepad++, créez une page web Ex1.html qui contient «Hello World!»

Plus en détail

TP JAVASCRIPT OMI4 TP5 SRC1 2011-2012

TP JAVASCRIPT OMI4 TP5 SRC1 2011-2012 TP JAVASCRIPT OMI4 TP5 SRC1 2011-2012 FORMULAIRE DE CONTACT POUR PORTFOLIO PRINCIPE GENERAL Nous souhaitons réaliser un formulaire de contact comprenant les champs suivants : NOM PRENOM ADRESSE MAIL MESSAGE

Plus en détail

Publier dans la Base Documentaire

Publier dans la Base Documentaire Site Web de l association des ingénieurs INSA de Lyon Publier dans la Base Documentaire Remarque : la suppression des contributions n est pas possible depuis le Front-Office. lbuisset Page 1 18/09/2008

Plus en détail

Présentation de la plateforme WINDCHILL. Invitation à rejoindre la plateforme

Présentation de la plateforme WINDCHILL. Invitation à rejoindre la plateforme Présentation de la plateforme WINDCHILL WINDCHILL est une plateforme de travail collaboratif qui vous permettra, entre autres, de partager des documents et de gérer votre projet. L interface est 100% web

Plus en détail

Concevoir un tableau de bord en ligne

Concevoir un tableau de bord en ligne Concevoir un tableau de bord en ligne Principe Les tableaux de bord en ligne permettent de publier les résultats d une enquête en organisant le contenu dans différentes pages. Ce contenu est actualisé

Plus en détail

N IMPRIMER PAS CE DOCUMENT, VOUS POURREZ LE CONSULTER DURANT L INSTALLATION

N IMPRIMER PAS CE DOCUMENT, VOUS POURREZ LE CONSULTER DURANT L INSTALLATION N IMPRIMER PAS CE DOCUMENT, VOUS POURREZ LE CONSULTER DURANT L INSTALLATION EN FIN D INSTALLATION, LISEZ BIEN LA DERNIERE PAGE DE CE DOCUMENT ET CONSERVEZ-EN UNE COPIE. La procédure qui suit est valable

Plus en détail

Guide d utilisation. de la plateforme du CNEPD. Cher Apprenant. Un apprenant qui travaille sur la plate-forme de télé-enseignement pourra:

Guide d utilisation. de la plateforme du CNEPD. Cher Apprenant. Un apprenant qui travaille sur la plate-forme de télé-enseignement pourra: Un apprenant qui travaille sur la plate-forme de télé-enseignement pourra: Guide d utilisation de la plateforme du CNEPD Accéder à ses cours Utiliser les outils de communication mis à sa disposition Consulter

Plus en détail

MANUEL OPEN PRO MEUBLE

MANUEL OPEN PRO MEUBLE MANUEL OPEN PRO MEUBLE Identification Pour lancer l application, connectez-vous à internet et ouvrez l adresse suivante www.open-pro.fr dans la fenêtre de votre navigateur. Saisissez l E-mail (login) et

Plus en détail

LOTUS NOTES 8 TABLE DES MATIERES

LOTUS NOTES 8 TABLE DES MATIERES ENVIRONNEMENT... 8 Démarrer Lotus Notes... 9 Quitter Lotus Notes... 9 L écran... 11 La page d accueil... 13 Modifier la présentation... 13 La liste Ouvrir... 17 Le bouton Ouvrir... 17 Personnaliser la

Plus en détail

Développement d une architecture de type GRID pour l analyse des données d expression biologiques

Développement d une architecture de type GRID pour l analyse des données d expression biologiques Développement d une architecture de type GRID pour l analyse des données d expression biologiques O. Delemar, T. Vermat, F. Paillier & M. Deleeuw GENOME express FuturVIEW 2 ntexte biologique : nome et

Plus en détail

Guide d utilisation pour W.access - Client

Guide d utilisation pour W.access - Client 1. Inscription en ligne : Guide d utilisation pour W.access - Client Aller à l adresse suivante : http://www.micasf.com; Cliquer sur «Zone Clients» en haut à droite de la page, ensuite sur «OUVREZ VOTRE

Plus en détail

2- Le système affiche l ensemble des pages avec l ensemble des opérations qui peuvent être effectuées.

2- Le système affiche l ensemble des pages avec l ensemble des opérations qui peuvent être effectuées. 1-Diagramme d activité : 1.1-Mettre à jour page : 1.1.1-Description textuelle : Nom : Mettre à jour pages Objectif : Ce cas d utilisation vise à décrire toutes les étapes relatives à la mise à jour des

Plus en détail