Biologie Computationnelle

Dimension: px
Commencer à balayer dès la page:

Download "Biologie Computationnelle"

Transcription

1 Biologie Computationnelle Pour quoi faire? Protein family Gene sequence Structure Gene networks Gene order Non-coding regions

2 Bioinformatique Translationnelle PLOS Computational Biology A Peer-Reviewed, Open Access Journal Translational Bioinformatics : a collection of Education Articles, Terrain d'illustration de l'impact de la Biologie Computationnelle : - intégrer des quantités considérables de données moléculaires et cliniques pour une meilleure compréhension des bases moléculaires de maladies qui à son tour modifiera les pratiques cliniques et comme horizon améliorer la santé humaine. Informatics : the study of how to represent, store, search, retrieve and analyze information Imaging Informatics : focuses on images Medical Informatics : concerns medical information BioInformatics : concerns basic biological information Clinical Informatics : focuses on the clinical delivery part of medical informatics Biomedical Informatics : merges bioinformatics and medical informatics

3 Translationnelle : - Comment améliorer efficacement le diagnostic, le pronostic et le traitement des patients? Création d'appareils médicaux Diagnostic moléculaire Thérapeutique via de petites molécules Vaccins Etc. Maîtrise de l'explosion des connaissances en biologie moléculaire, génétique et génomique. Y a-t-il eu transfert de la connaissance de la structure en double hélice de l'adn vers une amélioration pratique avec un impact sur la santé humaine d'un point de vue de l'innovation technologique? Ce qui est certain, on est capable aujourd'hui de mesurer rapidement : - les séquences ADN (à l'échelle d'un génome entier!) - les séquences ARN et leur expression - les séquences protéique, leur structure, expression et modification - la structure, la présence et quantité de petits métabolites moléculaires

4 Genes ; DNA ; RNA messengers ; MicroRNAs ; Proteins Signaling molecules and cascades ; Metabolites ; Cellular communication processes ; Cellular organization PubMED : UMLS : Unified Medical Language System Molecular Informatics : concerns molecular/cellular information Genbank Gene Expression Omnibus Protein Data Bank KEGG Clinical Informatics : focuses on the clinical delivery part of medical informatics Translational Bioinformatics : the development and application of informatics methods that connect molecular entities to clininal entities : MetaCyc Impact : Médecine personnalisée? Reactome Association de génomes, fouille de marqueurs génétiques Analyse de données génomiques personnelles, fouille de données issues d'enregistrements électroniques etc.

5 4 Grands Chapitres pour cette session : - Imagerie Quantitative - Machine Learning / Data Mining - Représentation par graphes et réseaux - Représentation des connaissances : données, banque de données, ontologies Des technologies/ environnements de développement : - Java : ImageJ, Weka - Python : Biopython, Numpy, Scipy, Matplotlib, Enthought Python Distribution et Canopy - scripts : Perl, Gawk - Inkscape, ImageMagik / Sphinx / XML, SBML, BioPax, GPML, JSON, SQL, nosql, Hadoop Des softwares : - Clustal T-coffee, PathwayAPI, BioGRID, PatternHunter. Des choix, un co-design du cours...

6 Des travaux pratiques sur : - Intégration de Connaissance (Ontologies, données) - Construction de Réseaux d'interaction de gènes : R, statistiques - Visualisation de l'interactome : PPI, maladies, Cytoscape software, analyse topologique de graphes (network analyzer, arbres de Steiner trees, MST) - Assemblage de connaissance et interprétation : GSEA, GO, KEGG, BioLattice, pathology and ontology based analysis - Priorisation de gènes pathogènes : MLP, Weka - Analyse d'images : ImageJ, cellprofiler, DcellIQ, NeuronStudio, ITK - Visualisation -omiques : R, python - Algorithmes de Graphes, Complexité

7 Une perspective biologique permanente : - Gene feature recognition : TIS (Translation Initiation Site) TSS (Transcriptional Start Sites) Feature Generation Feature Selection Feature integration Gene finding - Gene expression analysis : Affymetrix Gene Chip Data Gene expression Profile Classification Gene expression Profile Clustering Gene Regulatory Circuits Reconstruction : Differentially Expressed Genes, Gene Interaction Prediction - Sequence Alignment / Comparaison / Homology : Multiple Sequence Alignment (Dynamic Programming) Function assignment to protein sequence (Guilt by Association) Discovery of Active Site or Domain of a function PPI / Proteomic Profile Analysis key mutation site identification - Phylogenetic tree : Construction Comparison -Biological Networks / Graph of Interactions : Natural pathways PPI Networks Protein Complex Prediction

8 TIS : Translation Initiation Site Recognition/Prediction Un échantillon de cdna 299 HSU CAT U27655 Homo sapiens CGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT......iEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE Pourquoi le second ATG est-il un TIS?

9 Gene prediction

10 T-Cell Epitopes Prediction By Artificial Neural Network Honeyman et al., Nature Biotechnology 16: , 1998

11 PAS Prediction BEGI N I ncomi ng sequences Feat ure generat i on Feat ure sel ect i on Feat ure i nt egrat i on END SVM in Weka

12 Histone Promoter Recognition Programs

13 9 Motifs Discovered by MEME algo in Histone Promoter 5 Region [250,-1] among 127 histone promoters

14 Diagnosis of Childhood Acute Lymphoblastic Leukemia (ALL) and Optimization of Risk-Benefit Ratio of Therapy Immunophenotyping

15 Affymetrix GeneChip Micro Array Analysis E2APBX1 MLL T-ALL Hyperdiploid >50 BCR-ABL Novel TEL-AML1

16 Proteomics Data : Guilt-by-Association Compare T with seqs of known function in a db Assign to T same function as homologs Discard this function as a candidate Confirm with suitable wet experiments

17 Proteomics Data: Subgraphs in Protein Interaction 318 edges 329 nodes In nucleus of S. cerevisiae Maslov & Sneppen, Science, v296, 2002 Topology of Protein Interaction Networks: Hubs, Cores, Bipartites

18 Yeast SH3 domain-domain Interaction network: 394 edges, 206 nodes Tong et al. Science, v proteins containing SH3 5 binding at least 6 of them

19 a b Configuration a is less likely than b in protein interaction networks Graph/Network Mining

20 Prognosis based on Gene Expression Profiling > a1 Decision Tree Based In-Silico Cancer Diagnosis x1 x2 x3 > a2 x4 A B B A A Root node Internal nodes B A Leaf nodes A B B A A

21 Given a test sample, at most 3 of the 4 genes expression values are needed to make a decision! Yeoh et al., Cancer Cell 1: , 2002; Differentiating MLL subtype from other subtypes of childhood leukemia Training data (14 MLL vs 201 others), Test data (6 MLL vs 106 others), Number of features: 12558

22 Discovery of Diagnostic Biomarkers for Ovarian Cancer Motivation: cure rate ~ 95% if correct diagnosis at early stage Proteomic profiling data obtained from patients serum samples The first data set by Petricoin et al was published in Lancet, 2002 Data set of June samples: 91 controls and 162 patients suffering from the disease; features (proteins, peptides, precisely, mass/charge identities) SVM: 0 errors; Naïve Bayes: 19 errors; k-nn: 15 errors.

23 Mining Errors from Bio Databases Uninformative sequences Invalid values Undersized sequences Ambiguity Example Meaningless Seqs Dubious sequences Vector contaminated sequence Crossannotation error RECORD Annotation error Among the 5,146,255 protein records queried using Entrez to the major protein or translated nucleotide databases, 3,327 protein sequences are shorter than four residues (as of Sep, 2004). In Nov 2004, the total number of undersized protein sequences increases to 3,350. Among 43,026,887 nucleotide records queried using Entrez to major nucleotide databases, 1,448 records contain sequences shorter than six bases (as of Sep, 2004). In Nov 2004, the total number of undersized nucleotide sequences increases to 1,711. Sequence structure violation Undersized protein sequences in major databases SINGLE SOURCE DATABASE Sequence redundancy Data provenance flaws Number of records DDBJ 1000 EMBL GenBank Erroneous data transformation Incompatible schema 2 Sequence Length PDB SwissProt MULTIPLE SOURCE DATABASE Undersized nucleotide sequences in major databases 3 PIR Number of records ATTRIBUTE DDBJ Sequence Length 4 GenBank PDB EMBL 5

24 Duplicates detected by association rules Rule 1. Identical sequences with the same sequence length and not originated from PDB are 99.7% likely to be duplicates. FP% and FN% Rule 2. Identical sequences with the same sequence length and of the same species are 97.1% likely to be duplicates. Rule 3. Identical sequences with the same sequence length, of the same species and not originated from PDB are 96.8% likely to be duplicates le Ru 1 le Ru 2 le Ru le Ru 4 le Ru 5 le Ru 6 le Ru Association rules FP% FN% x 1000 Rule 1 S(Seq)=1 ^ N(Seq Length)=1 ^ M(PDB)=0 (99.7%) Rule 2 S(Seq)=1 ^ M(PDB)=0 ^ M(Species)=1 (97.1%) Rule 3 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 (96.8%) Rule 4 S(Seq)=1^ M(PDB)=0 ^ M(DB)=0 (93.1%) Rule 5 S(Seq)=1 ^ M(Seq Length)=1 ^ M(PDB)=0 ^ M(DB)=0 (92.8%) Rule 6 S(Seq)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.4%) Rule 7 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.1%) 7

25 Phylogenetic tree construction Mbuti Pygmy Africa Europe Ethiopian Italian English Tibetan Root Asia Estimate order in which populations evolved Based on assimilated freq of many different genes But Japanese Navajo America Cherokee Indonesian Oceania Polynesian Papuan Australian Time since split Austalasia is human evolution a succession of population fissions? Is there such thing as a protoanglo-italian population which split, never to meet again, and became inhabitants of England and Italy?

26

27 Predicting interactions using phylogenetic profile Pellegrini et al. PNAS 96, (1999)

28 Comparative genomics

29 GWAS Genome Wide Association Studies

Fouille de données/machine Learning/

Fouille de données/machine Learning/ Fouille de données/machine Learning/ Big Data Qu'est-ce que c'est? Ouvrages : Bioinformatics: The Machine Learning Approach, Second Edition (Adaptive Computation and Machine Learning) 2001 par Pierre Baldi

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Grégoire de Lassence. Copyright 2006, SAS Institute Inc. All rights reserved.

Grégoire de Lassence. Copyright 2006, SAS Institute Inc. All rights reserved. Grégoire de Lassence 1 Grégoire de Lassence Responsable Pédagogie et Recherche Département Académique Tel : +33 1 60 62 12 19 gregoire.delassence@fra.sas.com http://www.sas.com/france/academic SAS dans

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

Exemple PLS avec SAS

Exemple PLS avec SAS Exemple PLS avec SAS This example, from Umetrics (1995), demonstrates different ways to examine a PLS model. The data come from the field of drug discovery. New drugs are developed from chemicals that

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

MAT 2377 Solutions to the Mi-term

MAT 2377 Solutions to the Mi-term MAT 2377 Solutions to the Mi-term Tuesday June 16 15 Time: 70 minutes Student Number: Name: Professor M. Alvo This is an open book exam. Standard calculators are permitted. Answer all questions. Place

Plus en détail

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Lhouari Nourine 1 1 Université Blaise Pascal, CNRS, LIMOS, France SeqBio 2012 Marne la vallée, France 2.

Plus en détail

Intégration de données multiples générées

Intégration de données multiples générées Intégration de données multiples générées par les techniques à haut débit (séquençage, CGH, SNP, transcriptome ) Pascal Roy 1 MD-PhD, Caroline Truntzer PhD 2, Delphine Maucort-Boulch 1 MD-PhD 1 Equipe

Plus en détail

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique.

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique. Atelier «BioWorkFlow» - 25/09/08 Automatisation de la plateforme MicroScope avec l API JBPM David Vallenet & Stéfan Engelen CEA/DSV/IG/Genoscope CNRS-UMR Génomique Métabolique Laboratoire (Atelier) de

Plus en détail

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr SyMeTRIC projet régional pour le développement de la Médecine Systémique alban.gaignard@univ-nantes.fr portage scientifique : Jérémie Bourdon (LINA), Richard Redon (Inst. du Thorax) Systems Medicine Développer

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Boris Hejblum 1,2,3 & Rodolphe Thiébaut 1,2,3 1 Inserm, U897

Plus en détail

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 Les Biolangages Thierry Lecroq Université de Rouen FRANCE 2008 2009 Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 BioPerl Ensemble de modules Perl Utilise la programmation objet L objectif est de mettre

Plus en détail

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions Examen MIS M1 BMC 2012-2013 25 questions à 0,8 point chacune. NB : Les réponses sont exactes au mois de décembre 2012. Le nombre de résultats dans les bases de données bibliographiques est susceptible

Plus en détail

NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010

NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010 NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010 Sur pied des nouveaux articles 365, paragraphe 4 (NCTS) et 455bis, paragraphe 4 (NCTS-TIR) du Code Communautaire d'application 1, le principal obligé doit

Plus en détail

L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques

L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques «Re-analysis is a powerful tool in the review of important studies, and should be supported with data made available by

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013 Cube de textes et opérateur d'agrégation basé sur un modèle vectoriel adapté Text Cube Model and aggregation operator based on an adapted vector space model Lamia Oukid, Ounas Asfari, Fadila Bentayeb,

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

How to Login to Career Page

How to Login to Career Page How to Login to Career Page BASF Canada July 2013 To view this instruction manual in French, please scroll down to page 16 1 Job Postings How to Login/Create your Profile/Sign Up for Job Posting Notifications

Plus en détail

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Next Generation Sequencing Bioinformatics - Biology ! Initié en 2008, le programme international ICGC a pour objectif de

Plus en détail

Extraction d information des bases de séquences biologiques avec R

Extraction d information des bases de séquences biologiques avec R Extraction d information des bases de séquences biologiques avec R 21 novembre 2006 Résumé Le module seqinr fournit des fonctions pour extraire et manipuler des séquences d intérêt (nucléotidiques et protéiques)

Plus en détail

The impacts of m-payment on financial services Novembre 2011

The impacts of m-payment on financial services Novembre 2011 The impacts of m-payment on financial services Novembre 2011 3rd largest European postal operator by turnover The most diversified European postal operator with 3 business lines 2010 Turnover Mail 52%

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...)

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...) Quelques slides sur les NGS et leur utilisation... LIFL, Université Lille 1 - INRIA Journées au vert 31 mai - 1er juin 2010 - NEWS FEATURE HUMAN GENOME AT TEN NATURE Vol 464 1 April 2010 NATURE Vol 464

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

C est quoi, Facebook?

C est quoi, Facebook? C est quoi, Facebook? aujourd hui l un des sites Internet les plus visités au monde. Si tu as plus de 13 ans, tu fais peut-être partie des 750 millions de personnes dans le monde qui ont une page Facebook?

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

INSTITUT MARITIME DE PREVENTION. For improvement in health and security at work. Created in 1992 Under the aegis of State and the ENIM

INSTITUT MARITIME DE PREVENTION. For improvement in health and security at work. Created in 1992 Under the aegis of State and the ENIM INSTITUT MARITIME DE PREVENTION For improvement in health and security at work Created in 1992 Under the aegis of State and the ENIM Maritime fishing Shellfish-farming Sea transport 2005 Le pilier social

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

Anticiper et prédire les sinistres avec une approche Big Data

Anticiper et prédire les sinistres avec une approche Big Data Anticiper et prédire les sinistres avec une approche Big Data Julien Cabot Directeur Big Data Analytics OCTO jcabot@octo.com @julien_cabot OCTO 2013 50, avenue des Champs-Elysées 75008 Paris - FRANCE Tél

Plus en détail

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr)

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) Doc.No. : EUM/OPS/TEN/13/706466 Issue : v3 Date : 7 May 2014 WBS : EUMETSAT Eumetsat-Allee 1, D-64295 Darmstadt, Germany Tel: +49 6151 807-7 Fax: +49

Plus en détail

Eléments de statistique

Eléments de statistique Eléments de statistique L. Wehenkel Cours du 9/12/2014 Méthodes multivariées; applications & recherche Quelques méthodes d analyse multivariée NB: illustration sur base de la BD résultats de probas en

Plus en détail

Once the installation is complete, you can delete the temporary Zip files..

Once the installation is complete, you can delete the temporary Zip files.. Sommaire Installation... 2 After the download... 2 From a CD... 2 Access codes... 2 DirectX Compatibility... 2 Using the program... 2 Structure... 4 Lier une structure à une autre... 4 Personnaliser une

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013

OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013 OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013 ISABELLE BLANC 14/02/2013 Open access Déclaration de Berlin 2004 promotion du libre accès à l'information scientifique et technique: publications Voie

Plus en détail

Application Form/ Formulaire de demande

Application Form/ Formulaire de demande Application Form/ Formulaire de demande Ecosystem Approaches to Health: Summer Workshop and Field school Approches écosystémiques de la santé: Atelier intensif et stage d été Please submit your application

Plus en détail

Artificial Intelligence AI

Artificial Intelligence AI Pedagogical Introduction Artificial Intelligence AI Lecture 0 Karim Bouzoubaa This Lecture General Information Examples Importance At the end Intelligent Systems Course Content, Other AI courses, Learning

Plus en détail

ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis

ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis Conférence de Presse ABL SA - Chambre de Commerce de Luxembourg - Mardi 29 Septembre 2009, 18h Annonce de Presse ABL and

Plus en détail

Net-université 2008-1-IS1-LEO05-00110. http://www.adam-europe.eu/adam/project/view.htm?prj=5095

Net-université 2008-1-IS1-LEO05-00110. http://www.adam-europe.eu/adam/project/view.htm?prj=5095 Net-université 2008-1-IS1-LEO05-00110 1 Information sur le projet Titre: Code Projet: Année: 2008 Type de Projet: Statut: Accroche marketing: Net-université 2008-1-IS1-LEO05-00110 Projets de transfert

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Completed Projects / Projets terminés

Completed Projects / Projets terminés Completed Projects / Projets terminés Nouvelles normes Nouvelles éditions Publications spéciales publiées en français CAN/CSA-ISO/CEI 10164-9-97 (C2001), 1 re édition Technologies de l information Interconnexion

Plus en détail

SERVEUR DÉDIÉ DOCUMENTATION

SERVEUR DÉDIÉ DOCUMENTATION SERVEUR DÉDIÉ DOCUMENTATION Release 5.0.6.0 19 Juillet 2013 Copyright 2013 GIANTS Software GmbH, All Rights Reserved. 1/9 CHANGE LOG Correction de bug divers (5.0.6.0) Ajout d une option de relance automatique

Plus en détail

Nos Métiers. Historique. Notre Vision. Notre Mission

Nos Métiers. Historique. Notre Vision. Notre Mission Historique 1958 : Création de la SMMO : Minoterie de blé tendre à Oujda. Première minoterie cotée en bourse entre 1972 et 1980. 1989 : Création de la société COPATES ; première unité industrielle de production

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Nouvelle approche de validation Novo Nordisk

Nouvelle approche de validation Novo Nordisk 44 ème Congrès International SFSTP 6 et 7 juin 2012 LA CONNAISSANCE SCIENTIFIQUE AU SERVICE DE LA QUALITE PRODUIT Apports du «Quality by Design» et retours d expd expériences Nouvelle approche de validation

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

SCHOLARSHIP ANSTO FRENCH EMBASSY (SAFE) PROGRAM 2015-2 APPLICATION FORM

SCHOLARSHIP ANSTO FRENCH EMBASSY (SAFE) PROGRAM 2015-2 APPLICATION FORM SCHOLARSHIP ANSTO FRENCH EMBASSY (SAFE) PROGRAM 2015-2 APPLICATION FORM APPLICATION FORM / FORMULAIRE DE CANDIDATURE Note: If there is insufficient space to answer a question, please attach additional

Plus en détail

Projet ANR SAMOGWAS. Specific Advanced MOdels for Genome-wide Association Studies. Journée de lancement officielle. Nantes - vendredi 11 octobre 2013

Projet ANR SAMOGWAS. Specific Advanced MOdels for Genome-wide Association Studies. Journée de lancement officielle. Nantes - vendredi 11 octobre 2013 Projet ANR SAMOGWAS Specific Advanced MOdels for Genome-wide Association Studies Journée de lancement officielle Nantes - vendredi 11 octobre 2013 1 Les partenaires LINA Nantes GIGA-R Liège INSERM Nantes

Plus en détail

Data Mining. Exposés logiciels, systèmes et réseaux. Damien Jubeau IR3 Lundi 19 novembre 2012

Data Mining. Exposés logiciels, systèmes et réseaux. Damien Jubeau IR3 Lundi 19 novembre 2012 Data Mining Exposés logiciels, systèmes et réseaux. Damien Jubeau IR3 Lundi 19 novembre 2012 2 Plan Data mining : définition, utilisations et concepts Wolfram Alpha : extraction de données d'un compte

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

Forthcoming Database

Forthcoming Database DISS.ETH NO. 15802 Forthcoming Database A Framework Approach for Data Visualization Applications A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree of Doctor of

Plus en détail

How To connect to TonVPN Max / Comment se connecter à TonVPN Max

How To connect to TonVPN Max / Comment se connecter à TonVPN Max How To connect to TonVPN Max / Comment se connecter à TonVPN Max Note : you need to run all those steps as an administrator or somebody having admin rights on the system. (most of the time root, or using

Plus en détail

Utiliser une WebCam. Micro-ordinateurs, informations, idées, trucs et astuces

Utiliser une WebCam. Micro-ordinateurs, informations, idées, trucs et astuces Micro-ordinateurs, informations, idées, trucs et astuces Utiliser une WebCam Auteur : François CHAUSSON Date : 8 février 2008 Référence : utiliser une WebCam.doc Préambule Voici quelques informations utiles

Plus en détail

Formation en conduite et gestion de projets. Renforcer les capacités des syndicats en Europe

Formation en conduite et gestion de projets. Renforcer les capacités des syndicats en Europe Formation en conduite et gestion de projets Renforcer les capacités des syndicats en Europe Pourquoi la gestion de projets? Le département Formation de l Institut syndical européen (ETUI, European Trade

Plus en détail

TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes

TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes Mohamed Moussaoui,Wajdi Dhifli,Sami Zghal,Engelbert Mephu Nguifo FSJEG, Université de Jendouba,

Plus en détail

The UNITECH Advantage. Copyright UNITECH International Society 2011. All rights reserved. Page 1

The UNITECH Advantage. Copyright UNITECH International Society 2011. All rights reserved. Page 1 The UNITECH Advantage Copyright UNITECH International Society 2011. All rights reserved. Page 1 Two key aspects of UNITECH Distinctive by being selective Standing out while fitting in The Wide and Varied

Plus en détail

Cytoscape pour la visualisation et le traitement de grands graphes

Cytoscape pour la visualisation et le traitement de grands graphes Cytoscape pour la visualisation et le traitement de grands graphes Laurent Risser CNRS, Institut de Mathématiques de Toulouse 01/16 1) Principaux logiciels Outils libres pour la visualisation et traitement

Plus en détail

EN UNE PAGE PLAN STRATÉGIQUE

EN UNE PAGE PLAN STRATÉGIQUE EN UNE PAGE PLAN STRATÉGIQUE PLAN STRATÉGIQUE EN UNE PAGE Nom de l entreprise Votre nom Date VALEUR PRINCIPALES/CROYANCES (Devrait/Devrait pas) RAISON (Pourquoi) OBJECTIFS (- AN) (Où) BUT ( AN) (Quoi)

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

DOCUMENTATION MODULE BLOCKCATEGORIESCUSTOM Module crée par Prestacrea - Version : 2.0

DOCUMENTATION MODULE BLOCKCATEGORIESCUSTOM Module crée par Prestacrea - Version : 2.0 DOCUMENTATION MODULE BLOCKCATEGORIESCUSTOM Module crée par Prestacrea - Version : 2.0 INDEX : DOCUMENTATION - FRANCAIS... 2 1. INSTALLATION... 2 2. CONFIGURATION... 2 3. LICENCE ET COPYRIGHT... 3 4. MISES

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

First Nations Assessment Inspection Regulations. Règlement sur l inspection aux fins d évaluation foncière des premières nations CONSOLIDATION

First Nations Assessment Inspection Regulations. Règlement sur l inspection aux fins d évaluation foncière des premières nations CONSOLIDATION CANADA CONSOLIDATION CODIFICATION First Nations Assessment Inspection Regulations Règlement sur l inspection aux fins d évaluation foncière des premières nations SOR/2007-242 DORS/2007-242 Current to September

Plus en détail

Quick start. Pulsar ellipse 300/500/650/800/1200. Pulsar ellipse premium 500/650/800/1200

Quick start. Pulsar ellipse 300/500/650/800/1200. Pulsar ellipse premium 500/650/800/1200 Quick start Pulsar ellipse 300/500/650/800/1200 Pulsar ellipse premium 500/650/800/1200 Using the additional functions available on your Pulsar ellipse Utilisation des fonctions additionnelles de votre

Plus en détail

Imagerie Quantitative en Biologie

Imagerie Quantitative en Biologie Imagerie Quantitative en Biologie Plusieurs casquettes pour le biologiste computationnel : (Nature Biotechnology, Vol. 31, Number 11, Nov. 2013) «- data analyst - data curator - database developer - statistician

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique,

Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique, Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique, et 1 Niveau d analyse en biologie Interactions Cellule/Cellule TB Génome Transcriptome Voies

Plus en détail

THÈSE. présentée à TÉLÉCOM PARISTECH. pour obtenir le grade de. DOCTEUR de TÉLÉCOM PARISTECH. Mention Informatique et Réseaux. par.

THÈSE. présentée à TÉLÉCOM PARISTECH. pour obtenir le grade de. DOCTEUR de TÉLÉCOM PARISTECH. Mention Informatique et Réseaux. par. École Doctorale d Informatique, Télécommunications et Électronique de Paris THÈSE présentée à TÉLÉCOM PARISTECH pour obtenir le grade de DOCTEUR de TÉLÉCOM PARISTECH Mention Informatique et Réseaux par

Plus en détail

ONTARIO Court File Number. Form 17E: Trial Management Conference Brief. Date of trial management conference. Name of party filing this brief

ONTARIO Court File Number. Form 17E: Trial Management Conference Brief. Date of trial management conference. Name of party filing this brief ONTARIO Court File Number at (Name of court) Court office address Form 17E: Trial Management Conference Brief Name of party filing this brief Date of trial management conference Applicant(s) Full legal

Plus en détail

Master Développement Durable et Organisations Master s degree in Sustainable Development and Organizations Dossier de candidature Application Form

Master Développement Durable et Organisations Master s degree in Sustainable Development and Organizations Dossier de candidature Application Form Master Développement Durable et Organisations Master s degree in Sustainable Development and Organizations Dossier de candidature Application Form M / Mr Mme / Mrs Nom Last name... Nom de jeune fille Birth

Plus en détail

CONFLICTS OF INTERESTS FOR MARKETING AUTHORIZATION OF A MEDICINE

CONFLICTS OF INTERESTS FOR MARKETING AUTHORIZATION OF A MEDICINE CONFLICTS OF INTERESTS FOR MARKETING AUTHORIZATION OF A MEDICINE NECESSITY OF A NEW JURISDICTION G Delépine, NDelépine Hôpital Raayond Poincarré Garches France The scandal of the VIOXX Illustrates the

Plus en détail

Soutenance de mi-stage

Soutenance de mi-stage Supervisée par : Mireille RÉGNIER & Yann PONTY 30 juin 2015 1/29 1 Structure 3D de l ARN et objectifs Notions sur la structure 3D de l ARN Intérêts de la comparaison de structures 3D Qu est ce que la comparaison

Plus en détail

Génération de code binaire pour application multimedia : une approche au vol

Génération de code binaire pour application multimedia : une approche au vol Génération de binaire pour application multimedia : une approche au vol http://hpbcg.org/ Henri-Pierre Charles Université de Versailles Saint-Quentin en Yvelines 3 Octobre 2009 Présentation Présentation

Plus en détail

Les marchés Security La méthode The markets The approach

Les marchés Security La méthode The markets The approach Security Le Pôle italien de la sécurité Elsag Datamat, une société du Groupe Finmeccanica, représente le centre d excellence national pour la sécurité physique, logique et des réseaux de télécommunication.

Plus en détail

Stylo Espion MODE D EMPLOI FR/EN REF : INOPEN2207

Stylo Espion MODE D EMPLOI FR/EN REF : INOPEN2207 Stylo Espion MODE D EMPLOI FR/EN REF : INOPEN2207 Model: INOPEN2207 Lisez les instructions avant d utiliser le produit et gardez le comme future référence. Read the instructions before using the product

Plus en détail

Performances. Gestion des serveurs (2/2) Clustering. Grid Computing

Performances. Gestion des serveurs (2/2) Clustering. Grid Computing Présentation d Oracle 10g Chapitre VII Présentation d ORACLE 10g 7.1 Nouvelles fonctionnalités 7.2 Architecture d Oracle 10g 7.3 Outils annexes 7.4 Conclusions 7.1 Nouvelles fonctionnalités Gestion des

Plus en détail

2 èmes Rencontres Networking Medicen Paris Region / Alsace BioValley sur l'innovation en imagerie médicale

2 èmes Rencontres Networking Medicen Paris Region / Alsace BioValley sur l'innovation en imagerie médicale 2 èmes Rencontres Networking Medicen Paris Region / Alsace BioValley sur l'innovation en imagerie médicale 19 Mai 2015 ICM (Paris) Appel à Manifestation d Intérêt Offre de services Françoise Soussaline,

Plus en détail

ShortestPath PlugIn for JUMP V 0.1

ShortestPath PlugIn for JUMP V 0.1 V 0.1 Abstract Michaël MICHAUD Copyright 2006 en. This article is about ShortestPath PlugIn for JUMP. It makes it possible to compute the shortest path between two nodes of a graph created from a linear

Plus en détail

8. Cours virtuel Enjeux nordiques / Online Class Northern Issues Formulaire de demande de bourse / Fellowship Application Form

8. Cours virtuel Enjeux nordiques / Online Class Northern Issues Formulaire de demande de bourse / Fellowship Application Form F-8a-v1 1 / 7 8. Cours virtuel Enjeux nordiques / Online Class Northern Issues Formulaire de demande de bourse / Fellowship Application Form Nom de famille du candidat Langue de correspondance Français

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Présentation d EUPATI

Présentation d EUPATI The project is supported by the Innovative Medicines Initiative Joint Undertaking under grant agreement n 115334, resources of which are composed of financial contribution from the European Union's Seventh

Plus en détail

Comprendre l impact de l utilisation des réseaux sociaux en entreprise SYNTHESE DES RESULTATS : EUROPE ET FRANCE

Comprendre l impact de l utilisation des réseaux sociaux en entreprise SYNTHESE DES RESULTATS : EUROPE ET FRANCE Comprendre l impact de l utilisation des réseaux sociaux en entreprise SYNTHESE DES RESULTATS : EUROPE ET FRANCE 1 Objectifs de l étude Comprendre l impact des réseaux sociaux externes ( Facebook, LinkedIn,

Plus en détail

GISAfrica First phase closure meeting East African Pole. SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est

GISAfrica First phase closure meeting East African Pole. SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est GISAfrica First phase closure meeting East African Pole SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est Ethiopia MAURITANIE MALI Kenya SENEGAL GUINEE Ouagadougou BURKINA FASO NIGER

Plus en détail

Archived Content. Contenu archivé

Archived Content. Contenu archivé ARCHIVED - Archiving Content ARCHIVÉE - Contenu archivé Archived Content Contenu archivé Information identified as archived is provided for reference, research or recordkeeping purposes. It is not subject

Plus en détail

A partir de ces différents matériels, l administrateur a déterminé huit configurations différentes. Il vous demande de les compléter.

A partir de ces différents matériels, l administrateur a déterminé huit configurations différentes. Il vous demande de les compléter. Exonet - Ressources mutualisées en réseau Description du thème Propriétés Intitulé long Formation concernée Présentation Modules Activités Compétences ; Savoir-faire Description Ressources mutualisées

Plus en détail

Exercices sur SQL server 2000

Exercices sur SQL server 2000 Exercices sur SQL server 2000 La diagramme de classe : Exercices sur SQL server 2000 Le modèle relationnel correspondant : 1 Créer les tables Clic-droit on Tables et choisir «New Table» Créer la table

Plus en détail

WEB page builder and server for SCADA applications usable from a WEB navigator

WEB page builder and server for SCADA applications usable from a WEB navigator Générateur de pages WEB et serveur pour supervision accessible à partir d un navigateur WEB WEB page builder and server for SCADA applications usable from a WEB navigator opyright 2007 IRAI Manual Manuel

Plus en détail

Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien)

Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien) Finance des matières premières (6b) De la formation des prix sur les marchés financiers à la possibilité d un équilibre (non walrasien) Alain Bretto & Joël Priolon - 25 mars 2013 Question Dans un équilibre

Plus en détail

F-7a-v3 1 / 5. 7. Bourses de mobilité / Mobility Fellowships Formulaire de demande de bourse / Fellowship Application Form

F-7a-v3 1 / 5. 7. Bourses de mobilité / Mobility Fellowships Formulaire de demande de bourse / Fellowship Application Form F-7a-v3 1 / 5 7. Bourses de mobilité / Mobility Fellowships Formulaire de demande de bourse / Fellowship Application Form Nom de famille du candidat Langue de correspondance Français Family name of participant

Plus en détail

LA GÉNOMIQUE ET LE HPC : L EXPÉRIENCE ET LA VISION DE L INSTITUT DE GÉNOMIQUE. François Artiguenave, PhD, emba DSV/IG/CNG PAGE 1

LA GÉNOMIQUE ET LE HPC : L EXPÉRIENCE ET LA VISION DE L INSTITUT DE GÉNOMIQUE. François Artiguenave, PhD, emba DSV/IG/CNG PAGE 1 LA GÉNOMIQUE ET LE HPC : L EXPÉRIENCE ET LA VISION DE L INSTITUT DE GÉNOMIQUE François Artiguenave, PhD, emba DSV/IG/CNG PAGE 1 OUTLINE Presentation Perspectives: Personalized Bioinformatics Data Production

Plus en détail

Université de XY University of XY. Faculté XY Faculty of XY

Université de XY University of XY. Faculté XY Faculty of XY Université de XY University of XY Faculté XY Faculty of XY Le présent supplément au diplôme suit le modèle élaboré par la Commission européenne, le Conseil d'europe et l'unesco/cepes. Le supplément vise

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

NOTICE D UTILISATION Option USB 2-Ports USB FRANCAIS

NOTICE D UTILISATION Option USB 2-Ports USB FRANCAIS NOTICE D UTILISATION Option USB 2-Ports USB FRANCAIS Introduction Ce supplément vous informe de l utilisation de la fonction USB qui a été installée sur votre table de mixage. Disponible avec 2 ports USB

Plus en détail

Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00

Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00 Instructions pour mettre à jour un HFFv2 v1.x.yy v2.0.00 HFFv2 1. OBJET L accroissement de la taille de code sur la version 2.0.00 a nécessité une évolution du mapping de la flash. La conséquence de ce

Plus en détail

1 Modélisation d être mauvais payeur

1 Modélisation d être mauvais payeur 1 Modélisation d être mauvais payeur 1.1 Description Cet exercice est très largement inspiré d un document que M. Grégoire de Lassence de la société SAS m a transmis. Il est intitulé Guide de démarrage

Plus en détail

BNP Paribas Personal Finance

BNP Paribas Personal Finance BNP Paribas Personal Finance Financially fragile loan holder prevention program CUSTOMERS IN DIFFICULTY: QUICKER IDENTIFICATION MEANS BETTER SUPPORT Brussels, December 12th 2014 Why BNPP PF has developed

Plus en détail