Biologie Computationnelle

Dimension: px
Commencer à balayer dès la page:

Download "Biologie Computationnelle"

Transcription

1 Biologie Computationnelle Pour quoi faire? Protein family Gene sequence Structure Gene networks Gene order Non-coding regions

2 Bioinformatique Translationnelle PLOS Computational Biology A Peer-Reviewed, Open Access Journal Translational Bioinformatics : a collection of Education Articles, Terrain d'illustration de l'impact de la Biologie Computationnelle : - intégrer des quantités considérables de données moléculaires et cliniques pour une meilleure compréhension des bases moléculaires de maladies qui à son tour modifiera les pratiques cliniques et comme horizon améliorer la santé humaine. Informatics : the study of how to represent, store, search, retrieve and analyze information Imaging Informatics : focuses on images Medical Informatics : concerns medical information BioInformatics : concerns basic biological information Clinical Informatics : focuses on the clinical delivery part of medical informatics Biomedical Informatics : merges bioinformatics and medical informatics

3 Translationnelle : - Comment améliorer efficacement le diagnostic, le pronostic et le traitement des patients? Création d'appareils médicaux Diagnostic moléculaire Thérapeutique via de petites molécules Vaccins Etc. Maîtrise de l'explosion des connaissances en biologie moléculaire, génétique et génomique. Y a-t-il eu transfert de la connaissance de la structure en double hélice de l'adn vers une amélioration pratique avec un impact sur la santé humaine d'un point de vue de l'innovation technologique? Ce qui est certain, on est capable aujourd'hui de mesurer rapidement : - les séquences ADN (à l'échelle d'un génome entier!) - les séquences ARN et leur expression - les séquences protéique, leur structure, expression et modification - la structure, la présence et quantité de petits métabolites moléculaires

4 Genes ; DNA ; RNA messengers ; MicroRNAs ; Proteins Signaling molecules and cascades ; Metabolites ; Cellular communication processes ; Cellular organization PubMED : UMLS : Unified Medical Language System Molecular Informatics : concerns molecular/cellular information Genbank Gene Expression Omnibus Protein Data Bank KEGG Clinical Informatics : focuses on the clinical delivery part of medical informatics Translational Bioinformatics : the development and application of informatics methods that connect molecular entities to clininal entities : MetaCyc Impact : Médecine personnalisée? Reactome Association de génomes, fouille de marqueurs génétiques Analyse de données génomiques personnelles, fouille de données issues d'enregistrements électroniques etc.

5 4 Grands Chapitres pour cette session : - Imagerie Quantitative - Machine Learning / Data Mining - Représentation par graphes et réseaux - Représentation des connaissances : données, banque de données, ontologies Des technologies/ environnements de développement : - Java : ImageJ, Weka - Python : Biopython, Numpy, Scipy, Matplotlib, Enthought Python Distribution et Canopy - scripts : Perl, Gawk - Inkscape, ImageMagik / Sphinx / XML, SBML, BioPax, GPML, JSON, SQL, nosql, Hadoop Des softwares : - Clustal T-coffee, PathwayAPI, BioGRID, PatternHunter. Des choix, un co-design du cours...

6 Des travaux pratiques sur : - Intégration de Connaissance (Ontologies, données) - Construction de Réseaux d'interaction de gènes : R, statistiques - Visualisation de l'interactome : PPI, maladies, Cytoscape software, analyse topologique de graphes (network analyzer, arbres de Steiner trees, MST) - Assemblage de connaissance et interprétation : GSEA, GO, KEGG, BioLattice, pathology and ontology based analysis - Priorisation de gènes pathogènes : MLP, Weka - Analyse d'images : ImageJ, cellprofiler, DcellIQ, NeuronStudio, ITK - Visualisation -omiques : R, python - Algorithmes de Graphes, Complexité

7 Une perspective biologique permanente : - Gene feature recognition : TIS (Translation Initiation Site) TSS (Transcriptional Start Sites) Feature Generation Feature Selection Feature integration Gene finding - Gene expression analysis : Affymetrix Gene Chip Data Gene expression Profile Classification Gene expression Profile Clustering Gene Regulatory Circuits Reconstruction : Differentially Expressed Genes, Gene Interaction Prediction - Sequence Alignment / Comparaison / Homology : Multiple Sequence Alignment (Dynamic Programming) Function assignment to protein sequence (Guilt by Association) Discovery of Active Site or Domain of a function PPI / Proteomic Profile Analysis key mutation site identification - Phylogenetic tree : Construction Comparison -Biological Networks / Graph of Interactions : Natural pathways PPI Networks Protein Complex Prediction

8 TIS : Translation Initiation Site Recognition/Prediction Un échantillon de cdna 299 HSU CAT U27655 Homo sapiens CGTGTGTGCAGCAGCCTGCAGCTGCCCCAAGCCATGGCTGAACACTGACTCCCAGCTGTG CCCAGGGCTTCAAAGACTTCTCAGCTTCGAGCATGGCTTTTGGCTGTCAGGGCAGCTGTA GGAGGCAGATGAGAAGAGGGAGATGGCCTTGGAGGAAGGGAAGGGGCCTGGTGCCGAGGA CCTCTCCTGGCCAGGAGCTTCCTCCAGGACAAGACCTTCCACCCAACAAGGACTCCCCT......iEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE Pourquoi le second ATG est-il un TIS?

9 Gene prediction

10 T-Cell Epitopes Prediction By Artificial Neural Network Honeyman et al., Nature Biotechnology 16: , 1998

11 PAS Prediction BEGI N I ncomi ng sequences Feat ure generat i on Feat ure sel ect i on Feat ure i nt egrat i on END SVM in Weka

12 Histone Promoter Recognition Programs

13 9 Motifs Discovered by MEME algo in Histone Promoter 5 Region [250,-1] among 127 histone promoters

14 Diagnosis of Childhood Acute Lymphoblastic Leukemia (ALL) and Optimization of Risk-Benefit Ratio of Therapy Immunophenotyping

15 Affymetrix GeneChip Micro Array Analysis E2APBX1 MLL T-ALL Hyperdiploid >50 BCR-ABL Novel TEL-AML1

16 Proteomics Data : Guilt-by-Association Compare T with seqs of known function in a db Assign to T same function as homologs Discard this function as a candidate Confirm with suitable wet experiments

17 Proteomics Data: Subgraphs in Protein Interaction 318 edges 329 nodes In nucleus of S. cerevisiae Maslov & Sneppen, Science, v296, 2002 Topology of Protein Interaction Networks: Hubs, Cores, Bipartites

18 Yeast SH3 domain-domain Interaction network: 394 edges, 206 nodes Tong et al. Science, v proteins containing SH3 5 binding at least 6 of them

19 a b Configuration a is less likely than b in protein interaction networks Graph/Network Mining

20 Prognosis based on Gene Expression Profiling > a1 Decision Tree Based In-Silico Cancer Diagnosis x1 x2 x3 > a2 x4 A B B A A Root node Internal nodes B A Leaf nodes A B B A A

21 Given a test sample, at most 3 of the 4 genes expression values are needed to make a decision! Yeoh et al., Cancer Cell 1: , 2002; Differentiating MLL subtype from other subtypes of childhood leukemia Training data (14 MLL vs 201 others), Test data (6 MLL vs 106 others), Number of features: 12558

22 Discovery of Diagnostic Biomarkers for Ovarian Cancer Motivation: cure rate ~ 95% if correct diagnosis at early stage Proteomic profiling data obtained from patients serum samples The first data set by Petricoin et al was published in Lancet, 2002 Data set of June samples: 91 controls and 162 patients suffering from the disease; features (proteins, peptides, precisely, mass/charge identities) SVM: 0 errors; Naïve Bayes: 19 errors; k-nn: 15 errors.

23 Mining Errors from Bio Databases Uninformative sequences Invalid values Undersized sequences Ambiguity Example Meaningless Seqs Dubious sequences Vector contaminated sequence Crossannotation error RECORD Annotation error Among the 5,146,255 protein records queried using Entrez to the major protein or translated nucleotide databases, 3,327 protein sequences are shorter than four residues (as of Sep, 2004). In Nov 2004, the total number of undersized protein sequences increases to 3,350. Among 43,026,887 nucleotide records queried using Entrez to major nucleotide databases, 1,448 records contain sequences shorter than six bases (as of Sep, 2004). In Nov 2004, the total number of undersized nucleotide sequences increases to 1,711. Sequence structure violation Undersized protein sequences in major databases SINGLE SOURCE DATABASE Sequence redundancy Data provenance flaws Number of records DDBJ 1000 EMBL GenBank Erroneous data transformation Incompatible schema 2 Sequence Length PDB SwissProt MULTIPLE SOURCE DATABASE Undersized nucleotide sequences in major databases 3 PIR Number of records ATTRIBUTE DDBJ Sequence Length 4 GenBank PDB EMBL 5

24 Duplicates detected by association rules Rule 1. Identical sequences with the same sequence length and not originated from PDB are 99.7% likely to be duplicates. FP% and FN% Rule 2. Identical sequences with the same sequence length and of the same species are 97.1% likely to be duplicates. Rule 3. Identical sequences with the same sequence length, of the same species and not originated from PDB are 96.8% likely to be duplicates le Ru 1 le Ru 2 le Ru le Ru 4 le Ru 5 le Ru 6 le Ru Association rules FP% FN% x 1000 Rule 1 S(Seq)=1 ^ N(Seq Length)=1 ^ M(PDB)=0 (99.7%) Rule 2 S(Seq)=1 ^ M(PDB)=0 ^ M(Species)=1 (97.1%) Rule 3 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 (96.8%) Rule 4 S(Seq)=1^ M(PDB)=0 ^ M(DB)=0 (93.1%) Rule 5 S(Seq)=1 ^ M(Seq Length)=1 ^ M(PDB)=0 ^ M(DB)=0 (92.8%) Rule 6 S(Seq)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.4%) Rule 7 S(Seq)=1 ^ N(Seq Length)=1 ^ M(Species)=1 ^ M(PDB)=0 ^ M(DB)=0 (90.1%) 7

25 Phylogenetic tree construction Mbuti Pygmy Africa Europe Ethiopian Italian English Tibetan Root Asia Estimate order in which populations evolved Based on assimilated freq of many different genes But Japanese Navajo America Cherokee Indonesian Oceania Polynesian Papuan Australian Time since split Austalasia is human evolution a succession of population fissions? Is there such thing as a protoanglo-italian population which split, never to meet again, and became inhabitants of England and Italy?

26

27 Predicting interactions using phylogenetic profile Pellegrini et al. PNAS 96, (1999)

28 Comparative genomics

29 GWAS Genome Wide Association Studies

Fouille de données/machine Learning/

Fouille de données/machine Learning/ Fouille de données/machine Learning/ Big Data Qu'est-ce que c'est? Ouvrages : Bioinformatics: The Machine Learning Approach, Second Edition (Adaptive Computation and Machine Learning) 2001 par Pierre Baldi

Plus en détail

Dans la peau d'un Biologiste Computationnel?

Dans la peau d'un Biologiste Computationnel? Dans la peau d'un Biologiste Computationnel? Plusieurs casquettes : (Nature Biotechnology, Vol. 31, Number 11, Nov. 2013) «- data analyst - data curator - database developer - statistician - mathematical

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

Grégoire de Lassence. Copyright 2006, SAS Institute Inc. All rights reserved.

Grégoire de Lassence. Copyright 2006, SAS Institute Inc. All rights reserved. Grégoire de Lassence 1 Grégoire de Lassence Responsable Pédagogie et Recherche Département Académique Tel : +33 1 60 62 12 19 gregoire.delassence@fra.sas.com http://www.sas.com/france/academic SAS dans

Plus en détail

Monday, December 2 nd 2013. Formation Galaxy

Monday, December 2 nd 2013. Formation Galaxy Formation Galaxy Lundi, 10 Février 2014 This training has not for objectives to introduce every Galaxy tool individually or to build a workflow to process your own data. Objectives: To provide a first

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

Classification. Session organisée par Charles Bouveyron et Francois Caron et Marie Chavent

Classification. Session organisée par Charles Bouveyron et Francois Caron et Marie Chavent Classification Session organisée par Charles Bouveyron et Francois Caron et Marie Chavent La classification a pour objet de regrouper des données en classes possédant des caractéristiques similaires. La

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

IPv6. Internet Control Message Protocol ICMPv6. Objectif: Comparer ICMPv4 avec ICMPv6

IPv6. Internet Control Message Protocol ICMPv6. Objectif: Comparer ICMPv4 avec ICMPv6 IPv6 Internet Control Message Protocol ICMPv6 Objectif: Comparer ICMPv4 avec ICMPv6 v.1b IPv6 Théorie et Pratique & Microsoft Introduction to IPv6 1 ICMPv6 (RFC 2463) Trois fonctions déjà présentes en

Plus en détail

Exemple PLS avec SAS

Exemple PLS avec SAS Exemple PLS avec SAS This example, from Umetrics (1995), demonstrates different ways to examine a PLS model. The data come from the field of drug discovery. New drugs are developed from chemicals that

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2

Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Nouvelles classes de problèmes pour la fouille de motifs intéressants dans les bases de données 2 Lhouari Nourine 1 1 Université Blaise Pascal, CNRS, LIMOS, France SeqBio 2012 Marne la vallée, France 2.

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

MAT 2377 Solutions to the Mi-term

MAT 2377 Solutions to the Mi-term MAT 2377 Solutions to the Mi-term Tuesday June 16 15 Time: 70 minutes Student Number: Name: Professor M. Alvo This is an open book exam. Standard calculators are permitted. Answer all questions. Place

Plus en détail

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr SyMeTRIC projet régional pour le développement de la Médecine Systémique alban.gaignard@univ-nantes.fr portage scientifique : Jérémie Bourdon (LINA), Richard Redon (Inst. du Thorax) Systems Medicine Développer

Plus en détail

OECD (Q)SAR Application Toolbox: Contexte et évolution. B. Diderich Environment, Health and Safety Division OECD

OECD (Q)SAR Application Toolbox: Contexte et évolution. B. Diderich Environment, Health and Safety Division OECD OECD (Q)SAR Application Toolbox: Contexte et évolution B. Diderich Environment, Health and Safety Division OECD Philosophie Mettre en œuvre dans un programme informatique flexible le document guide de

Plus en détail

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique Banques Séquences nucléiques protéiques mixtes Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits PROSITE banque de motifs et de profils caractéristiques de domaines ou de

Plus en détail

Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg

Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg Konstantin Avrachenkov, Urtzi Ayesta, Patrick Brown and Eeva Nyberg Le présent document contient des informations qui sont la propriété de France Télécom. L'acceptation de ce document par son destinataire

Plus en détail

Intégration de données multiples générées

Intégration de données multiples générées Intégration de données multiples générées par les techniques à haut débit (séquençage, CGH, SNP, transcriptome ) Pascal Roy 1 MD-PhD, Caroline Truntzer PhD 2, Delphine Maucort-Boulch 1 MD-PhD 1 Equipe

Plus en détail

Progenesis LC-MS and Phenyx

Progenesis LC-MS and Phenyx Progenesis LC-MS and Phenyx Une combinaison unique d un logiciel d analyse différentielle en LC-MS et d une plateforme d identification et de caractérisation de protéines et peptides à partir de données

Plus en détail

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique.

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique. Atelier «BioWorkFlow» - 25/09/08 Automatisation de la plateforme MicroScope avec l API JBPM David Vallenet & Stéfan Engelen CEA/DSV/IG/Genoscope CNRS-UMR Génomique Métabolique Laboratoire (Atelier) de

Plus en détail

Méthodologie de mise en oeuvre de workflows scientifiques

Méthodologie de mise en oeuvre de workflows scientifiques Méthodologie de mise en oeuvre de workflows scientifiques Yuan Lin yuan.lin@supagro.inra.fr UMR MISTEA INRA, SupAgro, Montpellier!2 Contexte & Objectif Divers domaines scientifiques Ressources existantes

Plus en détail

OrderGeneMiner : Logiciel pour l extraction et la visualisation de motifs partiellement ordonnés à partir de puces à ADN

OrderGeneMiner : Logiciel pour l extraction et la visualisation de motifs partiellement ordonnés à partir de puces à ADN OrderGeneMiner : Logiciel pour l extraction et la visualisation de motifs partiellement ordonnés à partir de puces à ADN Mickaël Fabrègue, Agnès Braud, Sandra Bringay, Florence Le Ber, Charles Lecellier,

Plus en détail

Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil

Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil Service de biopuces Équipements Affymetrix au CRCHUM Acquisition en 2004 (FCI - Dr Hamet) Système GeneChip (Format cartouche)

Plus en détail

Web search. Course Organization. 4 July 2011. 1 / 7 Pierre Senellart Licence de droits d usage

Web search. Course Organization. 4 July 2011. 1 / 7 Pierre Senellart Licence de droits d usage Web search Course Organization 1 / 7 Pierre Senellart Course scope Introduction to the technologies of Web search engines Prerequisites: basic math and computer science Labs prerequisites: Java programming

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Boris Hejblum 1,2,3 & Rodolphe Thiébaut 1,2,3 1 Inserm, U897

Plus en détail

http://rsb.info.nih.gov/ij Adapted from : Joel B. Sheffield 2

http://rsb.info.nih.gov/ij Adapted from : Joel B. Sheffield 2 Image Analysis 1 1- Introduction to image analysis software ImageJ -development history -ImageJ vs. Fiji -installation -ImageJ website -sample images -tour of software environment 2- Basic image analysis

Plus en détail

Open Science Open Data Enjeux et stratégie pour l Inra

Open Science Open Data Enjeux et stratégie pour l Inra Open Science Open Data Enjeux et stratégie pour l Inra Séminaire méthodes et outils pour l Open data _01 Contexte international Des prises de position multiples De l Open Access à l Open Data Open access

Plus en détail

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 Les Biolangages Thierry Lecroq Université de Rouen FRANCE 2008 2009 Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 BioPerl Ensemble de modules Perl Utilise la programmation objet L objectif est de mettre

Plus en détail

Transcriptional changes associated with long-term left ventricle volume overload in rats:

Transcriptional changes associated with long-term left ventricle volume overload in rats: S1 Data supplement Transcriptional changes associated with long-term left ventricle volume overload in rats: impact on enzymes related to myocardial energy metabolism. Elise Roussel, Marie-Claude Drolet,

Plus en détail

Images & Open Science en bref A. Trubuil INRA/MaIAGE, Jouy en Josas

Images & Open Science en bref A. Trubuil INRA/MaIAGE, Jouy en Josas Images & Open Science en bref A. Trubuil INRA/MaIAGE, Jouy en Josas 1. Ressources ouvertes Données Logiciels Connaissances 2. Besoins Données Logiciels Connaissances Défis 3. Exemple 1. Ressources ouvertes

Plus en détail

Atelier Essais cliniques dans les projets santé Horizon 2020

Atelier Essais cliniques dans les projets santé Horizon 2020 Nacer Boubenna, PhD Chargé de mission Europe au siège de l Inserm Coordinateur du Point de contact national santé Atelier Essais cliniques dans les projets santé Horizon 2020 Paris 6 juin 204 Définitions

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010

NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010 NCTS INFORMATION QUANT AUX NOUVEAUTES POUR 2010 Sur pied des nouveaux articles 365, paragraphe 4 (NCTS) et 455bis, paragraphe 4 (NCTS-TIR) du Code Communautaire d'application 1, le principal obligé doit

Plus en détail

Enumeration, measurement and identification of net zooplankton samples using the ZOOSCAN digital imaging system

Enumeration, measurement and identification of net zooplankton samples using the ZOOSCAN digital imaging system Enumeration, measurement and identification of net zooplankton samples using the ZOOSCAN digital imaging sstem Philippe Grosjean, Caroline Warembourg, Marc Picheral & Gabriel Gorsk Université de Paris

Plus en détail

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr)

AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) AMESD-Puma2010-EFTS- Configuration-update-TEN (en-fr) Doc.No. : EUM/OPS/TEN/13/706466 Issue : v3 Date : 7 May 2014 WBS : EUMETSAT Eumetsat-Allee 1, D-64295 Darmstadt, Germany Tel: +49 6151 807-7 Fax: +49

Plus en détail

L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques

L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques L ouverture des données de la recherche en 2015 : définitions, enjeux, dynamiques «Re-analysis is a powerful tool in the review of important studies, and should be supported with data made available by

Plus en détail

C est quoi, Facebook?

C est quoi, Facebook? C est quoi, Facebook? Si tu as plus de 13 ans, tu fais peut-être partie des 750 millions de personnes dans le monde qui ont un compte Facebook? Et si tu es plus jeune, tu as dû entendre parler autour de

Plus en détail

L annotation des séquences en immunogénétique: la stratégie d IMGT basée sur IMGT-ONTOLOGY.

L annotation des séquences en immunogénétique: la stratégie d IMGT basée sur IMGT-ONTOLOGY. L annotation des séquences en immunogénétique: la stratégie d IMGT basée sur IMGT-ONTOLOGY. Véronique Giudicelli 1, Joumana Jabado-Michaloud 1, Denys Chaume 1 et Marie-Paule Lefranc 1,2 1 IMGT, the international

Plus en détail

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription.

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Résumé de thèse de David Kieffer Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Dans le cadre de la lutte contre le cancer, l'entreprise Genclis (Genomic

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

(Programme de formation pour les parents ~ Training program for parents)

(Programme de formation pour les parents ~ Training program for parents) PODUM-INFO-ACTION (PIA) La «carte routière» pour les parents, sur l éducation en langue française en Ontario A «road map» for parents, on French-language education in Ontario (Programme de formation pour

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

IPv6. Internet Control Message Protocol ICMPv6. Objectif: Comparer ICMPv4 avec ICMPv6

IPv6. Internet Control Message Protocol ICMPv6. Objectif: Comparer ICMPv4 avec ICMPv6 IPv6 Internet Control Message Protocol ICMPv6 Objectif: Comparer ICMPv4 avec ICMPv6 v.1c IPv6 Théorie et Pratique & Microsoft Introduction to IPv6 1 ICMPv6 (RFC 4443) Messages de service de IPv6 Trois

Plus en détail

Il y a de l'ia dans les programmes de l'agence Nationale de la Recherche Bertrand Braunschweig Responsable de programmes Paris, 3 Novembre 2006

Il y a de l'ia dans les programmes de l'agence Nationale de la Recherche Bertrand Braunschweig Responsable de programmes Paris, 3 Novembre 2006 Il y a de l'ia dans les programmes de l'agence Nationale de la Recherche Bertrand Braunschweig Responsable de programmes Paris, 3 Novembre 2006 www.agence-nationale-recherche.fr Bref historique Un objectif

Plus en détail

Cliquez pour modifier le style du titre QUELQUES EXEMPLES DE PROJETS LABELLISES ET FINANCES

Cliquez pour modifier le style du titre QUELQUES EXEMPLES DE PROJETS LABELLISES ET FINANCES Cliquez pour modifier le style du titre QUELQUES EXEMPLES DE PROJETS LABELLISES ET FINANCES 11/09/2014 Cliquez pour modifier le style du titre Projet MindYourBrain Louis Mayaud, Mensia Technologies lm@mensiatech.com

Plus en détail

Once the installation is complete, you can delete the temporary Zip files..

Once the installation is complete, you can delete the temporary Zip files.. Sommaire Installation... 2 After the download... 2 From a CD... 2 Access codes... 2 DirectX Compatibility... 2 Using the program... 2 Structure... 4 Lier une structure à une autre... 4 Personnaliser une

Plus en détail

Classification. Charles Bouveyron, Francois Caron, Marie Chavent. To cite this version: HAL Id: inria-00496744 https://hal.inria.

Classification. Charles Bouveyron, Francois Caron, Marie Chavent. To cite this version: HAL Id: inria-00496744 https://hal.inria. Classification Charles Bouveyron, Francois Caron, Marie Chavent To cite this version: Charles Bouveyron, Francois Caron, Marie Chavent. Classification. Journées MAS et Journée en l honneur de Jacques Neveu,

Plus en détail

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI ICC International Court of Arbitration Bulletin Cour internationale d arbitrage de la CCI Extract for restricted use Extrait à tirage limité International Court of Arbitration 38, Cours Albert 1er, 75008

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Registry. Pierre Le Sidaner Observatoire de Paris. Hackathon ASOV septembre 2015 1

Registry. Pierre Le Sidaner Observatoire de Paris. Hackathon ASOV septembre 2015 1 Registry Pierre Le Sidaner Observatoire de Paris Hackathon ASOV septembre 2015 1 Demain Le panorama change car l'interface des registries change. Dans le futur un nouveau service au STSCI et à l'esac mais

Plus en détail

Le contrôle qualité sur les données fastq

Le contrôle qualité sur les données fastq Le contrôle qualité sur les données fastq TP detection exome Plan Théorie 1: le format FastQ et l'encodage des qualités Session pratique 1: conversion des qualités (fichier illumina.fastq) Théorie 2: le

Plus en détail

CONTRAT D ETUDES - LEARNING AGREEMENT

CONTRAT D ETUDES - LEARNING AGREEMENT CONTRAT D ETUDES - LEARNING AGREEMENT Règles générales La présence aux séances d enseignement des modules choisis est obligatoire. Chaque module comporte des séances de travail encadrées et non encadrées

Plus en détail

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions Examen MIS M1 BMC 2012-2013 25 questions à 0,8 point chacune. NB : Les réponses sont exactes au mois de décembre 2012. Le nombre de résultats dans les bases de données bibliographiques est susceptible

Plus en détail

OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013

OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013 OPEN SCIENCE CATI CODEX MONTPELLIER 14 FÉVRIER 2013 ISABELLE BLANC 14/02/2013 Open access Déclaration de Berlin 2004 promotion du libre accès à l'information scientifique et technique: publications Voie

Plus en détail

PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF. Ianis Lallemand, 21 janvier 2013

PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF. Ianis Lallemand, 21 janvier 2013 PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF Ianis Lallemand, 21 janvier 2013 APPRENTISSAGE INTERACTIF definition Contours encore assez flous dans le champ de l apprentissage automatique. Néanmoins,

Plus en détail

Sniffing et analyse de paquets

Sniffing et analyse de paquets 1 Outils Sniffing et analyse de paquets Analyser : http://analyzer.polito.it/install/default.htm RASPPPoE : http://user.cs.tu-berlin.de/~normanb/ 2 Prérequis DSLAM (Digital Subscriber Line Multiplexer)

Plus en détail

Master de sociologie : double diplôme possible

Master de sociologie : double diplôme possible Master de sociologie : double diplôme possible Parcours du master «changements sociaux en Europe» en partenariat avec l Université de Vienne Version française Information générale Les étudiants s inscrivent

Plus en détail

Product Platform Development: A Functional Approach Considering Customer Preferences

Product Platform Development: A Functional Approach Considering Customer Preferences Product Platform Development: A Functional Approach Considering Customer Preferences THÈSE N O 4536 (2009) PRÉSENTÉE le 4 décembre 2009 À LA FACULTé SCIENCES ET TECHNIQUES DE L'INGÉNIEUR LABORATOIRE DES

Plus en détail

MOFAE Multi-objective Optimization Approach to Framework API Evolution

MOFAE Multi-objective Optimization Approach to Framework API Evolution MOFAE Multi-objective Optimization Approach to Framework API Evolution Wei Wu 1,2, Yann-Gaël Guéhéneuc 1, Giuliano Antoniol 2 Ptidej Team 1, SOCCER Lab 2 DGIGL, École Polytechnique de Montréal, Canada

Plus en détail

The impacts of m-payment on financial services Novembre 2011

The impacts of m-payment on financial services Novembre 2011 The impacts of m-payment on financial services Novembre 2011 3rd largest European postal operator by turnover The most diversified European postal operator with 3 business lines 2010 Turnover Mail 52%

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER Forum TERATEC Vincent Frouin Déluge de données S Laguitton (CATI-CEA) B damota (INRIA-CEA) 28 JUIN 202 28 JUIN 202 CEA

Plus en détail

2 players Ages 8+ Note: Please keep these instructions for future reference. WARNING. CHOKING HAZARD. Small parts. Not for children under 3 years.

2 players Ages 8+ Note: Please keep these instructions for future reference. WARNING. CHOKING HAZARD. Small parts. Not for children under 3 years. Linja Game Rules 2 players Ages 8+ Published under license from FoxMind Games NV, by: FoxMind Games BV Stadhouderskade 125hs Amsterdam, The Netherlands Distribution in North America: FoxMind USA 2710 Thomes

Plus en détail

How to Login to Career Page

How to Login to Career Page How to Login to Career Page BASF Canada July 2013 To view this instruction manual in French, please scroll down to page 16 1 Job Postings How to Login/Create your Profile/Sign Up for Job Posting Notifications

Plus en détail

Artificial Intelligence AI

Artificial Intelligence AI Pedagogical Introduction Artificial Intelligence AI Lecture 0 Karim Bouzoubaa This Lecture General Information Examples Importance At the end Intelligent Systems Course Content, Other AI courses, Learning

Plus en détail

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013 Cube de textes et opérateur d'agrégation basé sur un modèle vectoriel adapté Text Cube Model and aggregation operator based on an adapted vector space model Lamia Oukid, Ounas Asfari, Fadila Bentayeb,

Plus en détail

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013 L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS Lorène Allano 16 Avril 2013 Question? Expert Aide à la décision Expériences Digitalisation Analyse automatique Visualisation Outils adapté Données numériques

Plus en détail

Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure

Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure Keyrus 11 septembre 2014 Mot tendance pour décrire *beaucoup* de données! Buzz: Google Trends search terms volume

Plus en détail

HARMONY 950. Setup Guide Guide d installation

HARMONY 950. Setup Guide Guide d installation HARMONY 950 Setup Guide Guide d installation Languages English.................... 3 Français................... 9 3 Package contents 1 3 2 4 1. Remote 2. Charging cradle 3. USB cable 4. AC Adapter 4

Plus en détail

Data Mining et Big Data

Data Mining et Big Data Data Mining et Big Data Eric Rivals LIRMM & Inst. de Biologie Computationnelle CNRS et Univ. Montpellier 14 novembre 2015 E. Rivals (LIRMM & IBC) Big Data 14 novembre 2015 1 / 30 Introduction, contexte

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

Master 1 Biologie Santé UE Expression des génomes et transcriptomique. Sujet de : Hélène Dauchel Durée : 2h

Master 1 Biologie Santé UE Expression des génomes et transcriptomique. Sujet de : Hélène Dauchel Durée : 2h Master 1 Biologie Santé UE Expression des génomes et transcriptomique Sujet de : Hélène Dauchel Durée : 2h ****** Les trois questions sont à traitées, elles sont indépendantes : Question 1 : 4 points,

Plus en détail

Choose your language :

Choose your language : Choose your language : English : INSTRUCTIONS FOR UPDATING FOR WINDOWS 7 Français : NOTICE DE MISE À JOUR POUR WINDOWS 7 English : INSTRUCTIONS FOR UPDATING FOR WINDOWS 8 Français : NOTICE DE MISE À JOUR

Plus en détail

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences 1. Interrogation des banques via GQuerry 1.1 Rappel De manière concrère, l interrogation

Plus en détail

ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis

ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis ABL and Evivar Medical for Strategic Partnership and Alliance in HIV and Hepatitis Conférence de Presse ABL SA - Chambre de Commerce de Luxembourg - Mardi 29 Septembre 2009, 18h Annonce de Presse ABL and

Plus en détail

Fouille de données, analyse d évènements. Christophe Cérin. cerin@laria.u-picardie.fr

Fouille de données, analyse d évènements. Christophe Cérin. cerin@laria.u-picardie.fr ACI-GRID (7 novembre 2002) 1/21 Fouille de données, analyse d évènements Christophe Cérin cerin@laria.u-picardie.fr Plan 2/21 placement, ordonnancement ; Plan 3/21 Placement, ordonnancement ; Représentation

Plus en détail

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot UE1 PROGRAMMATION EN DRUG DESIGN (7 ECTS) Responsable : O. TABOUREAU EC1 -

Plus en détail

C est quoi, Facebook?

C est quoi, Facebook? C est quoi, Facebook? aujourd hui l un des sites Internet les plus visités au monde. Si tu as plus de 13 ans, tu fais peut-être partie des 750 millions de personnes dans le monde qui ont une page Facebook?

Plus en détail

Clinical Trials Regulation

Clinical Trials Regulation Clinical Trials Regulation National Implementation Cécile Delval Director of Evaluation Division French Medicines Agency (ANSM) France Ministry of Health ANSM Competent Authority Ethics Committee (EC)

Plus en détail

Présentation succincte. Jean Cavarelli. Septembre 2014

Présentation succincte. Jean Cavarelli. Septembre 2014 Master Sciences du Vivant Spécialité Biologie structurale, bioinformatique et biotechnologies Parcours Biologie structurale intégrative et bio-informatique Présentation succincte. Jean Cavarelli Septembre

Plus en détail

INSTITUT MARITIME DE PREVENTION. For improvement in health and security at work. Created in 1992 Under the aegis of State and the ENIM

INSTITUT MARITIME DE PREVENTION. For improvement in health and security at work. Created in 1992 Under the aegis of State and the ENIM INSTITUT MARITIME DE PREVENTION For improvement in health and security at work Created in 1992 Under the aegis of State and the ENIM Maritime fishing Shellfish-farming Sea transport 2005 Le pilier social

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Un logiciel libre conçu pour aider à la validation des identifications en protéomique et pour mieux exploiter les données de séquençage de novo

Un logiciel libre conçu pour aider à la validation des identifications en protéomique et pour mieux exploiter les données de séquençage de novo Un logiciel libre conçu pour aider à la validation des identifications en protéomique et pour mieux exploiter les données de séquençage de novo Hélène Rogniaux & Dominique Tessier I.N.R.A. UR1268 Biopolymères

Plus en détail

How To connect to TonVPN Max / Comment se connecter à TonVPN Max

How To connect to TonVPN Max / Comment se connecter à TonVPN Max How To connect to TonVPN Max / Comment se connecter à TonVPN Max Note : you need to run all those steps as an administrator or somebody having admin rights on the system. (most of the time root, or using

Plus en détail

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Next Generation Sequencing Bioinformatics - Biology ! Initié en 2008, le programme international ICGC a pour objectif de

Plus en détail

Extraction d information des bases de séquences biologiques avec R

Extraction d information des bases de séquences biologiques avec R Extraction d information des bases de séquences biologiques avec R 21 novembre 2006 Résumé Le module seqinr fournit des fonctions pour extraire et manipuler des séquences d intérêt (nucléotidiques et protéiques)

Plus en détail

Déterminants moléculaires et spécificité du Priming immunitaire chez le mollusque d eau douce Biomphalaria glabrata.

Déterminants moléculaires et spécificité du Priming immunitaire chez le mollusque d eau douce Biomphalaria glabrata. Délivré par UNIVERSITE DE PERPIGNAN VIA DOMITIA Préparée au sein de l école doctorale ED305 Energie et Environnement Et de l unité de recherche UMR5244 Ecologie et Evolution des Interactions Spécialité

Plus en détail

SAP SNC. Guide. Alertes/Alert - Edition 1. Direction des Achats/Ph.Longuet Date: 22/11/11

SAP SNC. Guide. Alertes/Alert - Edition 1. Direction des Achats/Ph.Longuet Date: 22/11/11 SAP SNC Guide Alertes/Alert - Edition 1 Direction des Achats/Ph.Longuet Date: 22/11/11 SAP SNC Alert on SAP SNC SAP SNC Alerts Definition An «alerts» is an event, created by SAP SNC according to the updates

Plus en détail

Data Carrier System (code 5641090)

Data Carrier System (code 5641090) Instructions for Use Instructions d utilisation 2 5 Data Carrier System (code 5641090) 5009756-E 05/2011 2 ENGLISH PARTS OF THE DATA CARRIER READ/WRITE HARDWARE The Data Carrier consists of three parts:

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...)

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...) Quelques slides sur les NGS et leur utilisation... LIFL, Université Lille 1 - INRIA Journées au vert 31 mai - 1er juin 2010 - NEWS FEATURE HUMAN GENOME AT TEN NATURE Vol 464 1 April 2010 NATURE Vol 464

Plus en détail

WEKA, un logiciel libre d apprentissage et de data mining

WEKA, un logiciel libre d apprentissage et de data mining WEKA, un logiciel libre d apprentissage et de data mining Yves Lechevallier INRIA-Rocquencourt Présentation de WEKA 3.4 Format ARFF WEKA Explorer WEKA Experiment Environment WEKA KnowledgeFlow E_mail :

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Big data / smart data: définition, quels enjeux? Méthodes épidémiologiques. Linda Wittkop Université de Bordeaux/ISPED, Inserm U897

Big data / smart data: définition, quels enjeux? Méthodes épidémiologiques. Linda Wittkop Université de Bordeaux/ISPED, Inserm U897 Big data / smart data: définition, quels enjeux? Méthodes épidémiologiques Linda Wittkop Université de Bordeaux/ISPED, Inserm U897 Cost is divided by 2 in : CPU - Moore's law : 18 months Storage - Kryder's

Plus en détail