Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Dimension: px
Commencer à balayer dès la page:

Download "Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire"

Transcription

1 Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée à des milliers ou des millions de séquences par comparaison 2 à 2 Utilisation d heuristiques Principaux programmes Fasta Blast Blat 1

2 Méthodes heuristiques Identification de régions ( mots ) fortement conservées => limiter le nombre de solutions à explorer L N A K S I M W Q A T R C I S V Y C W Q A T D S G l alignement est rapide recherche de similarité la solution proposée n est pas obligatoirement optimale FASTA Reférence Pearson and Lipman. Improved tools for biological sequence comparison. PNAS 85(8): (1988) Versions La version actuelle est fasta3. Accessibilité Disponible par FTP Intégré dans la plupart des «packages» bioinformatiques ex : GCG Nombreux serveurs Web : EBI : disponible sur les serveurs SRS 2

3 L algorithme de FASTA 1 ère étape : mots identiques Séquence B Par défaut : k=2 pour les séquences protéiques k=6 pour les séquences nucléiques k (ktup) peut être modifié par l utilisateur. Si k augmente : -gain en rapidité - perte en sensibilité L algorithme de FASTA 2 ème étape : segments conservés Séquence B Les mots situés - sur une même diagonale - à une distance inférieure à une valeur seuil sont réunis ainsi que la région qui les sépare. segments denses en identité absence de gaps dans ces segments Dist < 16 3

4 L algorithme de FASTA 2 ème étape : segments conservés (score init1) Séquence B Les 10 régions les plus denses en identité sont retenues. Calcul des scores initiaux utilisation des matrices de scores (prise en compte des substitutions) * Le meilleur des scores initiaux est appelé init1 et sera fourni à l utilisateur. * init1 L algorithme de FASTA 3 ème étape : calcul du score initn Séquence B Introduction de gaps * Réunions des segments proches si: scores initiaux pénalité de jonction > à un des scores initiaux Le meilleur de ces nouveaux scores est appelé score initn. Les segments dont le score est inférieur à une valeur seuil sont éliminés. * init1 4

5 L algorithme de FASTA 4 ème étape : alignement optimal limité Séquence B Alignement optimal (Smith & Waterman) dans une fenêtre entourant la région de similarité ayant obtenu le score init1. * On calcule alors un nouveau score sur cet alignement optimal : le score opt. * init1 Dans certains cas, construction d un alignement optimal Smith & Waterman «normal» pour les séquences ayant obtenu les meilleurs scores L algorithme de FASTA alignement optimal limité Y C W Q A T D S G L N A K S I M W Q A T R C I S V 5

6 Comparer les scores! Init1 = score du meilleur segment initial Initn = score du meilleur alignement initial (après ajout de gaps) initn it init1it1 Opt = score de l alignement optimal sur un fenêtre autour d init1 Si opt < initn : problème!!! Région de forte similarité ignorée dans l alignement Séquence B initn B A init1 B A Expect Expect : nombre attendu d alignements avec un score S Plus l expect est proche de 0, plus le score est significatif E = Kmn e - S K constante de Karlin m longueur de la séquence requête n longueur de la banque λ dépend du système de score employé FASTA : calcul des paramètres à partir de l ensemble des scores trouvés lors de la recherche dans la banque (sauf les scores les plus extrêmes). BLAST2 : détermination empirique à partir de séquences modèles pour chaque type de matrice et de pénalité de gap 6

7 Histogramme Colonne 1: intervalle de valeurs des scores Colonne 2 (opt): Nombre de séquences ayant obtenu un score opt compris dans l intervalle donné Colonne 3 (E) : Nombre attendu de séquences avec un score compris dans l intervalle donné = distribution observée * distribution théorique Fasta 7

8 Fasta Séquences ayant obtenu les meilleurs scores Fasta 8

9 Alignements Séquence requête (query) Séquence de la banque : identité. Score 0 Alignements Biais en composition 9

10 Blast BLAST : Basic Local Alignment Search Tool Références Altschul et al. Basic local alignment search tool. J Mol Biol Oct 5;215(3): Altschul et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: Accessibilité ftp, packages (dont GCG) Nombreux serveurs Web - Au NCBI : -.. Algorithme de blast Construction de la liste des mots similaires aux mots de la query Séquence requête (query) tous les mots de longueur w Pour les protéines : w= 3 par défaut Pour l ADN : w = 11 par défaut Mot 1 Parmi tous les mots possibles de longueur w (20x20x20=8000 possibilités si w=3) : Sélection des mots dont l alignement avec le mot de la séquence query donne un score T => protéines : matrice de scores (blosum62 par défaut) => ADN : match = 2, mismatch 3 Ex : PQG PQG PEG PQA Score = =18 Score = 15 Score = 12 Si T =13 PQG PEG Élimination de PQA Mot 2 Etc Remarque : dans le blast original, T=13 ~ 50 mots atteignent ce seuil 10

11 Algorithme de Blast Localisation des mots sur les séquences de la banque Liste de mots Séquences de la banque Chaque «hit» est identifié Il s agit d une liste finie et pré-établie. Algorithme de Blast Construction des HSP (Blast1) Construction des HSPs (Blast original ) HSP Pour chaque hit, extension de l alignement (dans les 2 directions) tant que: - l extrémité d une des séquences n est pas atteinte - le score ne chute pas plus d une valeur X en dessous du meilleur score obtenu jusque-là pour cet alignement L alignement ainsi obtenu est appelé HSP (High-scoring segment pair) et a un score supérieur au score du hit initial Identification des meilleures HSPs Seules les HSPs dont le score est supérieur à un seuil fixé sont retenues. Il peut exister plusieurs HSPs entre deux séquences (leur score est alors combiné). absence de gap dans les alignements de Blast1 «ungapped» blast 11

12 Algorithme de Blast Construction des HSP (Blast2=gapped blast ) Extension sans gap : «Two hits method» au moins 2 hits non chevauchants situés sur la même diagonale (pas de gaps) situés à une distance A HSP Dans blast2 : T=11 Exemple: + 15 hits avec score > hits additionnels avec un score > 11 2 paires de hits sont sur une même diagonale et à une distance <40 Blast original (T=13) : 15 tentatives d extension Blast2 (T=11) : 2 tentatives d extension => gain de temps Algorithme de Blast Alignement optimal (Smith & Waterman) - Sélection des HSPs avec score suffisant - Choix d une paire de résidus (amorce) dans l HSP : paire centrale du meilleur segment de 11 paires - Alignement optimal «limité» à partir de l amorce => introduction de gaps L alignement optimal se fait en considérant seulement les alignements qui ne tombent pas plus de Xg en dessous du meilleur score obtenu. amorce 12

13 Algorithme de Blast Alignement optimal limité Y C W Q A T D S G L N A K S I M W Q A T R C I S V Algorithme de Blast Alignement optimal obtenu Lettre : identité + : score positif Alignements e tsobtenus uspar Blast1 amorce 13

14 Les différentes comparaisons Programmes Requête Banque Comparaison Exemples d utilisation Blastn ADN ADN nucléique Recherche d ARN structuraux, d éléments régulateurs Blastp Protéine protéines protéique Recherche de protéines homologues Tblastn Protéine ADN (traduit dans les 6 cadres) Blastx Tblastx ADN (traduit dans les 6 cadres) ADN (traduit dans les 6 cadres) protéique Recherche de similarités entre une protéine et une séquence génomique mal annotée protéines protéique Recherche des phases de lecture dans une séquence codante ADN (traduit dans les 6 cadres) protéique Avantages de tblastn et blastx mais très long Megablast => optimisé pour des séquences nucléiques quasi-identiques (>95% identité) (taille des mots = 28), très rapide 14

15 Interface Blast (NCBI) Sortie Blast Recherche de domaines conservés (Conserved Domain Database, CDD) NCBI-curated domains (use 3D-structure information) Domain models from Pfam SMART COG PRK TIGRFAM 15

16 Sortie Blast Banque et séquence requête utilisées Sortie 16

17 Blast : alignements Séquence requête (query) Séquence de la banque Blast : alignements Biais en composition 17

18 Filtres Filtres Certaines régions peuvent être filtrées : -faible complexité - courts motifs répétés - éléments répétés dispersés connus (ALUs repeats ) => non prises en compte dans la recherche 18

19 Filtres Blast : taxonomy report 19

20 BLAT : the Blast-Like Alignment Tool But : identifier rapidement des régions de forte similarité nucléique => au moins 95% sur 40 bases (ex: primates) protéiques => au moins 80% sur 20 aa (ex : vertébrés é terrestres) Applications : localiser une séquence (gène, ARNm, est, protéine) sur un génome déterminer la structure d un gène (carte exonique) Avantages/inconvénients : gain de temps alignements triés en fonction du génome prise en compte des sites d épissages utilisable uniquement pour séquences très proches Kent, Genome Research 2002 BLAT : the Blast-Like Alignment Tool stockage en mémoire des mots de k lettres du génome => gain de temps élimination des mots trop fréquents (séquences répétées) recherche des mots identiques dans la séquence requête k=11 pour comparaison ADN/ADN k=4 pour comparaisons protéiques alignement si : 2 mots identiques (k=11) pour ADN 3 mots (k=4) identiques pour protéines (version serveur) 1 mot (k=5) identique pour protéines (version stand-alone) sur même diagonale et suffisamment proches prise en compte des sites d épissages 20

21 BLAT : the Blast-Like Alignment Tool BLAT : the Blast-Like Alignment Tool 21

22 BLAT : the Blast-Like Alignment Tool BLAT : the Blast-Like Alignment Tool 22

23 Comparaison avec BlastN (ou Megablast) 23

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

Algorithmes pour la comparaison de séquences II

Algorithmes pour la comparaison de séquences II Algorithmes pour la comparaison de séquences II Hélène TOUZET touzet@lifl.fr Equipe Bioinfo Master recherche informatique www.lifl.fr/~touzet/masterrecherche.html Pourquoi comparer des séquences? Puisque

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique Université d Alexandrie Initiation à la Bioinformatique Basic Local Alignment Search Tool BLAST Université d Alexandrie AUF Auteur(s): Mohamed GAD 2009/2010 Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Alignement de séquences (2/2)

Alignement de séquences (2/2) Alignement de séquences (2/2) Observation à l aide de l outil graphique : le dotplot. Simple, visuel, Très informatif : Permet de repérer une similarité globale Permet de repérer des similarités locales

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC TD Biologie

Plus en détail

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast Bioinformatique appliquée Cours 4 BLAST idée lire un résultat de Blast la famille Blast -1- "quelle est la similarité entre ces 2 séquences? et donc: est-ce que ces deux séquences sont homologues?" "existe-t-il

Plus en détail

INTRODUCTION À LA BIO-INFORMATIQUE

INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2016 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Alignement d une séquence avec une banque. Thierry Lecroq Université de Rouen 1

Alignement d une séquence avec une banque. Thierry Lecroq Université de Rouen 1 Alignement d une séquence avec une banque 1 Problématique générale Localiser des alignements significatifs entre une séquence requête x dans une banque de p séquences Y = {y 0,y 1,,y p 1 }. La solution

Plus en détail

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Les bases de données biologiques Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Sommaire 1. Introduction 2. Le système Entrez 2.1. Description du système Entrez 2.2.

Plus en détail

HMSN206 - Partie Alignement

HMSN206 - Partie Alignement M1 Bioinformatique, Connaissances et Données Master Sciences et Numérique pour la Santé Année 2016-2017 HMSN206 - Partie Alignement Partie I-2 : Matrices de scores, BLAST, FASTA Anne-Muriel Arigon Chifolleau

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Recherche d homologies

Recherche d homologies Recherche d homologies Soluscience Guillaume Chakroun guillaume chakroun@hotmail.com Copyright c 2004 Guillaume Chakroun TABLE DES MATIÈRES Table des matières 1 Introduction 4 2 Les systèmes de scores

Plus en détail

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Exercice 1 (4,5 points) 1. Donner la définition de l acronyme BLAST. (0,5 pt) : Basic Local Alignment Search Tool 2. Expliquer les principes

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Exercice 1 : banques de données. Durée de l épreuve : 2h Documents autorisés Q1) Le schéma ci-dessous représente le nombre d articles

Plus en détail

Comparaison et! Alignement! de séquences

Comparaison et! Alignement! de séquences Comparaison et! Alignement! de séquences Frédérique Barloy-Hubler fhubler@univ-rennes1.fr CNRS-IGDR Rennes Responsable PF Amadeus Annotation des gènes et des génomes Biosit -UMS 3480 Un petit jeu pour

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

AVL Liban La Bioinformatique. Bioinformatique

AVL Liban La Bioinformatique. Bioinformatique AVL Liban 2011 La Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Sami Khuri sami.khuri@sjsu.edu Qu est-ce

Plus en détail

Alignement de séquences

Alignement de séquences Bioinformatique appliquée ours lignement de séquences principes un algorithme d'alignement: programmation dynamique alignement global, alignement local -- Les comparaisons de séquences DOPLO j'ai séquences,

Plus en détail

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014)

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014) Prédiction de gènes Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes Equipe Bonsai (2014) La localisation des gènes C'est la première étape pour interpréter

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée V.2004.4 http://www.esil.univ-mrs.fr/~dgaut/cours Bioinformatique Deux définitions possibles Applications de l informatique

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

TD 1 Biais de codons

TD 1 Biais de codons Module LV348 Version enseignant TD 1 page 1/7 TD 1 Biais de codons Revu dernièrement par Mathilde Carpentier, Cyril Gallut et Joël Pothier Version du 15 janvier 2014 L objectif de ce TP est de prendre

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom :

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom : BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F Professeur : Eric R. Gauthier Test de mi-session 31 octobre 2006 Votre nom : Consignes : 1) Durée : 85 min 2) 5 questions sur 5 pages, pour 80 points. Compte pour

Plus en détail

Alignement Multiple de séquences

Alignement Multiple de séquences Alignement Multiple de séquences Introduction Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Outil essentiel pour : Signatures protéiques Homologie avec une famille de protéines

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Analyse informatique des données moléculaires

Analyse informatique des données moléculaires 6 - Bioinformatique F. CORPET, C. CHEVALET INRA, Laboratoire de Génétique Cellulaire, BP 27, 31326 Castanet-Tolosan cedex e-mail : chevalet@toulouse.inra.fr Analyse informatique des données moléculaires

Plus en détail

ftp://ftp.ncbi.nih.gov/blast/executables/latest

ftp://ftp.ncbi.nih.gov/blast/executables/latest Jour 4: TP : application à la bibliographie et recherche d'information : recherche systématique d'articles scientifiques liés à des séquences sélectionnées d'une banque de séquence (wget). TP: recherche

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Programmes de comparaison de banques de données

Programmes de comparaison de banques de données Programmes decomparaison debanquesdedonnées FASTA introduction Programmesdecomparaisonde2séquencestroplongs Méthodesheuristiques But:filtrerparétapessuccessiveslesséquences «intéressantes» Etablissementd'unscorepourclasserlesmeilleuressimilitudes

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Bioinformatique: alignement de séquences

Bioinformatique: alignement de séquences Bioinformatique: alignement de séquences Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr Problème

Plus en détail

Dr. Christophe Geourjon

Dr. Christophe Geourjon Prédiction de la structure 3D Dr. Christophe Geourjon Pôle de BioInformatique Lyonnais PBIL - Site de Lyon-Gerland IBCP - CNRS UMR 5086 Bioinformatique et RMN structurales 7, passage du Vercors 69367 Lyon

Plus en détail

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000)

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) II) Annotation de gènes codant des protéines 1) Objectif du TD L objectif du

Plus en détail

Recherche dans les banques d ADN par indexation parallèle

Recherche dans les banques d ADN par indexation parallèle Recherche dans les banques d ADN par indexation parallèle Van Hoa Nguyen Institut Francophone d Informatique Hanoi, Vietnam Email: nvhoa@ifi.edu.vn Dominique Lavenier CNRS / IRISA Rennes, France Email:

Plus en détail

Introduction à la comparaison de séquences

Introduction à la comparaison de séquences Introduction à la comparaison de séquences - Université de Lille 1-2 eme Semestre Pourquoi comparer des séquences Recherche de similarités. Déterminer si des séquences sont homologues. Rechercher les exons/introns....

Plus en détail

Introduction Page 3 Accéder à Autochartist. L'Interface d'autochartist Page 4 Panneau de recherche

Introduction Page 3 Accéder à Autochartist. L'Interface d'autochartist Page 4 Panneau de recherche Manuel Utilisateur INdice Introduction Page 3 Accéder à Autochartist L'Interface d'autochartist Page 4 Panneau de recherche L'Interface d'autochartist (suite) Page 5 Panneau de résultats - Motifs Complets

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Annotation de protéines

Annotation de protéines JS Varré Université Lille 1 jean-stephane.varre@lifl.fr http://www.lifl.fr/~varre jean-stephane.varre@lifl.fr 1 / Pourquoi faire de l annotation automatique de protéines? Il est difficile de trouver expérimentalement

Plus en détail

Bioinformatique Appliquée Recherche de similitudes

Bioinformatique Appliquée Recherche de similitudes Besoin d'accélérer la recherche de similitude dans une banque Bioinformatique Appliquée Recherche de similitudes La recherche de similitude permet de comparer une séquence appelée requête (query) à une

Plus en détail

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN Contenu du cours Comparaisons locales et matrices de score Équipe Bonsai http://www.lifl.fr/bonsai Matrices de scores Recherches locales : BLAST et FastA année 2013 Équipe Bonsai Comparaisons locales et

Plus en détail

Data Mining : la classification non supervisée

Data Mining : la classification non supervisée Data Mining : la classification non supervisée Clustering : une affaire de distance. Etude préliminaire. Valeurs discrètes. Soient les deux individus suivants correspondant à des séquences ADN : X = AGGGTGGC

Plus en détail

TD 3 Recherche de similarités dans une banque de séquences

TD 3 Recherche de similarités dans une banque de séquences Module LV348 Version enseignant TD 3 page 1/7 TD 3 Recherche de similarités dans une banque de séquences Revu dernièrement par Mathilde Carpentier, Cyril Gallut et Joël Pothier Version du 30 mars 2012

Plus en détail

Génomique et GPU. Jean Michel Batto jean-michel.batto@jouy.inra.fr

Génomique et GPU. Jean Michel Batto jean-michel.batto@jouy.inra.fr Génomique et GPU Jean Michel Batto jean-michel.batto@jouy.inra.fr INRA, Laboratoire de Génétique Microbienne Centre de Recherche de Jouy en Josas (78) Forum TER@TEC, Ecole Supélec (91), 1 er Juillet 2009

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Fiche technique : étudier les protéines avec UniProt

Fiche technique : étudier les protéines avec UniProt Fiche technique : étudier les protéines avec UniProt http://www.uniprot.org/ Objectifs : ce site en ligne «UniProt», pour Universal Protein Resource, permet d étudier les protéines dans un cadre évolutionniste.

Plus en détail

Examen de bioinformatique Février 2009

Examen de bioinformatique Février 2009 Examen de bioinformatique Février 2009 Durée : 2h (ou 2h30) - Documents interdits Première partie (4 points) 1) La séquence ci-dessous est-elle au format fasta (justifiez votre réponse)? 1 pt Is the sequence

Plus en détail

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD Magistère Biotechnologies Analyse in silico de génomes, protéomes et transcriptomes «Génomique comparative» V.2012.1 Protocole TD Notes : Scripts et données sur : http://rna.igmors.u-psud.fr/gautheret/cours/analinsilico

Plus en détail

Méthodes et algorithmes pour le séquençage

Méthodes et algorithmes pour le séquençage Méthodes et algorithmes pour le séquençage Jérémie MARY http://www.lri.fr/~mary La comparaison de séquences Distance d'édition Selon ce concept, le bon alignement est celui qui minimise les opérations

Plus en détail

A BIOINFORMATIQUE FONCTIONNELLE

A BIOINFORMATIQUE FONCTIONNELLE Biologie moléculaire-2017 1 A BIOINFORMATIQUE FONCTIONNELLE PRÉDIRE LA FONCTION D UNE PROTÉINE INCONNUE Supposons que vous avez trouvé la séquence d'acides aminés d'une protéine inconnue et que vous souhaitez

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires).

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Objectifs de la fiche : 1. Ouvrir des séquences (ADN ou protéine). 2. Changer de règle de numérotation & faire apparaître

Plus en détail

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices Plan 3. Annotation des génomes a) Annotation structurale : localisation des éléments génétiques éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité

Plus en détail

BIO6: Bioinformatique appliquée Correction du TD3

BIO6: Bioinformatique appliquée Correction du TD3 BIO6: Bioinformatique appliquée Correction du TD3 Exercice 1 : programmation dynamique voir le site web indiqué dans le TD pour corriger l'exercice Exercice 2 : similarité de séquence et distance évolutive

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Manipulation des acides nucléiques

Manipulation des acides nucléiques Manipulation des acides nucléiques (voir chapitre 6 du Voet et Voet) - les acides nucléiques forment des polymères : ADN et ARN - ils sont composés de 4 nucléotides: A, C, G et T pour l ADN A, C, G et

Plus en détail

Apprentissage d automates sur les protéines

Apprentissage d automates sur les protéines Apprentissage d automates sur les protéines Approche par fusion de fragments significativement similaires (Jobim 04) François Coste, Goulven Kerbellec, Boris Idmont, Daniel Fredouille Christian Delamarche

Plus en détail

Selection de la banque

Selection de la banque Master BBSG première année Module Bioinformatique Année 203-204 TD2 : Analyse phylogénomique de la famille GH5 des glucosides hydrolases (ANNEXES) II. ANNEXES : Fonctionnement des logiciels ) Annexe :

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences

Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences Vincent Derrien 1 Jean-Michel Richer 1 et Jin-Kao Hao 1 LERIA - Université d Angers, 2 Bd Lavoisier, 49045 Angers, France

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Avant de commencer le TD, installer (ou vérifier qu ils le sont) sur la partition K: du poste de travail, les

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

Modélisation de la structure 3D des protéines

Modélisation de la structure 3D des protéines Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, 20-21 mai 2003

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Intégrité académique. Guide des solutions logicielles pour la détection du plagiat

Intégrité académique. Guide des solutions logicielles pour la détection du plagiat Intégrité académique Guide des solutions logicielles pour la détection du plagiat Version du 25 avril 2014 Table des matières I. Comparaison à partir d Internet... 3 II. Comparaison à l aide de logiciels

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique U n i v e r s i t é d A l e x a n d r i e - A U F Université d Alexandrie Auteur(s): Mohamed GAD 2009/2010 U n i v e r s i t é d A l e x a n d r i e - A U F Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture La localisation des gènes Prédiction de gènes Crs de présentation des tils bio-informatiques pr la localisation puis l'étude des gènes C'est la première étape pr interpréter un génome Distinction entre

Plus en détail

Alignements de deux séquences

Alignements de deux séquences Alignements de deux séquences Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin 2007-08 Plan

Plus en détail

Introduction à l Analyse des séquences biologiques.

Introduction à l Analyse des séquences biologiques. Introduction à l Analyse des séquences biologiques Christian.Fondrat@dsi.univ-paris5.fr Les outils d analyse de séquences C est QUOI? DES BASES DE DONNEES DES PROGRAMMES Utilitaires (consultation, acquisition

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Enveloppes convexes dans le plan

Enveloppes convexes dans le plan ÉCOLE POLYTECHNIQUE ÉCOLES NORMALES SUPÉRIEURES ÉCOLE SUPÉRIEURE DE PHYSIQUE ET DE CHIMIE INDUSTRIELLES CONCOURS D ADMISSION FILIÈRE MP HORS SPÉCIALITÉ INFO FILIÈRE PC COMPOSITION D INFORMATIQUE B (XECLR)

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique Objectifs Clustering On ne sait pas ce qu on veut trouver : on laisse l algorithme nous proposer un modèle. On pense qu il existe des similarités entre les exemples. Qui se ressemble s assemble p. /55

Plus en détail

II. EXCEL/QUERY ET SQL

II. EXCEL/QUERY ET SQL I. AU TRAVAIL, SQL! 1. Qu est-ce que SQL?... 19 2. SQL est un indépendant... 19 3. Comment est structuré le SQL?... 20 4. Base, table et champ... 21 5. Quelle est la syntaxe générale des instructions SQL?...

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Master IAD Module PS. Reconnaissance de la parole (suite) Alignement temporel et Programmation dynamique. Gaël RICHARD Février 2008

Master IAD Module PS. Reconnaissance de la parole (suite) Alignement temporel et Programmation dynamique. Gaël RICHARD Février 2008 Master IAD Module PS Reconnaissance de la parole (suite) Alignement temporel et Programmation dynamique Gaël RICHARD Février 2008 1 Reconnaissance de la parole Introduction Approches pour la reconnaissance

Plus en détail

Quand et pourquoi utiliser une base de données NoSQL?

Quand et pourquoi utiliser une base de données NoSQL? Quand et pourquoi utiliser une base de données NoSQL? Introduction Les bases de données NoSQL sont devenues un sujet très à la mode dans le milieu du développement web. Il n est pas rare de tomber sur

Plus en détail

ZOTERO Un outil gratuit de gestion de bibliographies

ZOTERO Un outil gratuit de gestion de bibliographies ZOTERO Un outil gratuit de gestion de bibliographies Téléchargement sur http://www.zotero.org Zotero est une extension du navigateur Web Firefox 0 Mais désormais applications autonomes par rapport à Firefox

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Introduction à la bioinformatique Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie Evolutive (UMR 5558) celine.brochier-armanet@univ-lyon1.fr Lectures recommandées

Plus en détail

revue de littérature - corpus comparables

revue de littérature - corpus comparables revue de littérature - corpus comparables Julie Roy April 23, 2015 Université de Montréal Introduction Matière première MT : corpus parallèles. Intérêt des corpus comparables : corpus parallèles et dictionnaires

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail