Titre de la leçon? Les mutations

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Titre de la leçon? Les mutations"

Transcription

1 Titre de la leçon? Les mutations I. La drépanocytose Globules rouges d un sujet normal Globules rouges d un sujet atteint de drépanocytose Circulation des globules rouges dans les capillaires (sujet atteint de drépanocytose) I.I Comparaison d ADN du gène de l hémoglobine entre une personne saine et une personne malade Début de la partie strictement codante du gêne bêta de l'hémoglobine humaine : BETA.COD ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGA ACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC Début de la partie codante de l'allèle du gène bêta de l'hémoglobine humaine responsable de la drépanocytose : DREP.COD ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGA ACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC a) Que constates-tu? L adénine est remplacée par une thymine b) Cela peut-il expliquer la maladie? Pas directement

2 I.II Comparaison de la séquence primaire des protéines hémoglobines d une personnes saine et d une personne malade Val His Leu Thr Glu Glu Hémoglobine de personne saine Val His Leu Thr Val Glu Hémoglobine de personne malade a) Que constates-tu? La valine (V) remplace l acide glutamique (E) b) Cela peut-il expliquer la maladie? Oui car la valine n a pas les mêmes propriétés que l acide glutamique. Cette mutation va induire un changement de forme de la protéine. Les hémoglobines vont alors se «cristalliser» ce qui va modifier la forme des globules rouges. BD extraite du site «sos globi»- tu peux le consulter pour en savoir plus sur cette maldie

3 I.III Voici l arbre généalogique de la personne malade. La personne malade est en gris sur le schéma. La drépanocytose est elle dominante ou récessive? Pourquoi? IV Mini Synthèse La drépanocytose est une maladie. génétique car elle est causée par la mutation d un gène. Pour qu une mutation..entraîne génétique une maladie il faut que le gène muté code pour une.. protéine et que la mutation ait un effet sur.. La fabrication de cette protéine. La drépanocytose est une maladie. récessive Cela signifie que pour être atteint par la maladie, un sujet doit posséder les deux allèles mutées. I. V Connais-tu d autres maladie génétiques récessives? Fais un petite recherche et trouve une autre maladie génétique récessive. Indique le nom du gène muté et la fonction de la protéine pour lequel il code.

4 VI. D où proviennent ces mutations? Les mutations génétique se produisent aléatoirement. Cependant, certains produits augmentent leur probabilité d apparition, ce sont les agents mutagènes. Attention, ces produits augmentent juste la probabilité d apparition d une mutation (sa fréquence) mais ne modifie pas son caractère aléatoire. Exemple : rayons X, UV, Rayons gama, NB: Le cancer est une maladie qui peut résulter d une mutation génétique. Dans ce cas, La mutation n aura pas lieu au niveau des cellules germinale (elle ne sera pas transmise à la descendance), mais bien au niveau des cellules somatiques. VII. Mutations et gènes létaux La forme en faucille des globules rouges de personnes ayant contractée la drépanocytose empêche les plasmodiums (responsable de la malaria) d infecter ces cellules. La drépanocytose est une maladie qui est surtout présente en Afrique. Les homozygotes meurent souvent avant d atteindre l âge de se reproduire. Les hétérozygotes ont une partie de leur globules rouges falciforme et une partie de forme normale. Il y a un lien entre ces quatre propositions. Lequel? La drépanocytose «protège» les hétérozygotes de la maladie. C est pour cela qu elle est plus souvent présente en Afrique et aux endroits du monde ou sévit le paludisme qu ailleurs. En effet, les personnes hétérozygote pour le gène muté de la drépanocytose avaient moins de chance que les autres de mourir de la malaria. Ils ont donc plus de probabilité de transmettre cet allèle muté à leur descendance. Que se passerait-il si la mutation était dominante? Les personnes porteuses ne pourraient se reproduire. La maladie disparaîtrait.

5 II. Syndrome de down À partir des cellules du fœtus présentes dans le liquide amniotique, on peut déterminer si le nombre et la structure des chromosomes du fœtus sont normaux : 22 paires de 2 chromosomes, plus la paire XX ou XY qui détermine le sexe du bébé. Les résultats sont obtenus en une quinzaine de jours.

6 a) Quelle est la différence entre ces deux caryotypes? Le nombre de chromosomes 21 b) Qu est ce que ça va avoir comme conséquence? La trisomie 21 est responsable du syndrome de down. Ces caractéristiques les plus notables sont -Déficit du développement cognitif -Cardiopathie. Contrairement à ce qu on croit, le QI des trisomiques 21 peut atteindre un niveau «normal». c) Quelle est la source du problème? Fais un dessin. Il s'agit d une anomalie lors de la formation des cellules germinales (méiose). Les chromosomes d une paire ne sont pas séparés, les deux chromosomes se dirigent donc vers le même pôle. Dessin Combien de chromosomes possèdent les gamètes des parents d un trisomique? Certaines gamètes possèdent n+1 chromosome (23+1 = 24), d autres possèdent n-1 chromosomes (23-1 =22) Combien de chromosomes possédera le zygote issu de la fécondation de tells gamètes? Les zygotes résultant de la fécondation de telles gamètes possèdent 47 chromosomes (cas du trisomique 21) ou 45 chromosomes.

7 Dans le caryotype ci-dessus, on remarque, fixé sur un chromosome 14, un chromosome 21. Comme il y a en plus 2 chromosome 21 "libres" (situés, sur la figure, au-dessus du chiffre 21), il y a bien 3 chromosomes, il y en a 46 et non 47. La trisomie 21 par translocation peut survenir "de novo" chez des parents dont le caryotype est normal. Mais elle peut être transmises par un parent ayant cette translocation et un seul chromosome 21 ("normal porteur"). d) Le caryotype ci-dessus est-il celui d un trisomique? Explique Oui, la personne possède ici trois chromosomes 21 dont un est associé au chromosome 14

8 III. Mutations chromosomiques a) Quand et comment le translocation montrée à la page précédente a-t-elle eu lieu? Dessine. NB : La translocation résulte de crossing-over entre des portions de chromosomes non homologues A compléter La translocation est une mutation chromosomique (car elle affecte les..). chromosomes Il existe d autres sortes d anomalies chromosomiques comme par exemple b) La duplication : Mutation qui résulte du crossing over entre chromosomes homologues mais en des endroits non homologues. Cette anomalie a pour conséquence la perte d une segment pour un chromosome et dédoublement pour l autre. Crossing-over normal Crossing over dans le cas d une duplication A compléter c) La délétion : Une portion de chromosome se détache et ne se rattache à aucun autre chromosome. Elle est donc perdue.

9 IV Polyploïdie La polyploïdie est une anomalie de la répartition des chromosomes lors de la méiose ou de la mitose. Tous les chromosomes se dirigent vers le même pôle de la cellule. La polyploïdie est surtout présente dans le monde végétal. a) Polyploïdie lors de la mitose l ADN est dupliqué sans division de la cellule. La mitose n a pas lieu et le cycle cellulaire est réinitialisé. La polyploïdie lors de la mitose conduit à la l augmentation de la taille des noyaux et donc à l augmentation de la taille des cellules. Dessin a) Polyploïdie lors de la meiose Dans ce cas, lors de la méiose, tous les chromosomes se dirigent vers le même pôle de la cellules. Une cellule diploïde qui réalise la polyploïdie fera des gamètes diploïdes. La descendance pourra donc être triploïde (3n) tétraploïde (4n), La polyploïdie peut-être provoquée en labo afin d obtenir des espèces différentes et plus appréciées par l homme (exemple, espèces avec de grandes fleurs ou de grands fruits).

10 Synthèse : Les anomalies génétiques peuvent être de trois sortes : I. Mutations génétiques (qui n affectent qu un seul gène) Ces mutations sont aléatoires mais elles peuvent être induites par des agents mutagènes. Si les mutations se produisent au niveau des cellules germinales, elles seront transmises à la descendance. Si les mutations se produisent au niveau des cellules somatiques, elles ne seront pas transmises. Certaines mutations génétiques récessives peuvent conférer des avantages sélectifs dans certains environnements. Ces mutations seront alors sélectionnées. II. Mutations chromosomiques (qui affectent la structure du chromosome ) Parmi celles-ci ont dénombre - les duplications - les translocations - les délétions III. IV.! Les polysomies qui sont des anomalies de répartition de chromosome lors de la méiose La polysomie la plus connue est la trisomie 21. Mais d autres polysomies existent, en particulier le syndrome de Turner (personne de sexe féminin ne possédant qu un seul chromosome sexuel (x)) et le syndrome de Klinefelter (personnes de sexe masculin possédant 3 chromosomes sexuels (XXY)). Les polyploïdies sont aussi des anomalies de répartitions de chromosomes mais dans ce cas, tous les chromosomes se dirigent vers le même pôle de la cellule. Les individus résultans de la polyploïdie peuvent être triploïdes, téraploïdes, NB: La synthèse correspond à la matière que tu dois connaître «par cœur». Le signe «attention» met en évidence de nouvelles informations. Mais tu dois aussi avoir compris le reste et être capable d effectuer les exercices réalisés en classe (y compris les dessins!)

Chapitre 17 Les changements chromosomiques à grande échelle

Chapitre 17 Les changements chromosomiques à grande échelle Chapitre 17 Les changements chromosomiques à grande échelle Une translocation réciproque démontrée par une technique appelée coloration des chromosomes Les mutations chromosomiques Les mutations chromosomiques

Plus en détail

SBI3U Épreuve Génétique Nom:

SBI3U Épreuve Génétique Nom: SBI3U Épreuve Génétique Nom: PARTIE A (15) (Connaissances et compréhension) Inscrire la bonne réponse sur la carte SCANTRON 1. Une femme porteuse du gène d hémophilie et un homme hémophile sont croisés.

Plus en détail

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement.

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Les gènes gouvernent la synthèse des protéines qui participent à la réalisation du phénotype mais d'autres éléments, comme

Plus en détail

UNITE ET DIVERSITE DES ËTRES HUMAINS

UNITE ET DIVERSITE DES ËTRES HUMAINS UNITE ET DIVERSITE DES ËTRES HUMAINS Rappels : - organisation du corps humain - La fécondation L HEREDITE ET SON SUPPORT Chaque individu possède des ressemblances et des différences même au sein d une

Plus en détail

1.1 Le brassage génétique et la diversité génétique

1.1 Le brassage génétique et la diversité génétique Chapitre 1 Génétique et évolution 1.1 Le brassage génétique et la diversité génétique La reproduction sexuée permet, chez les espèces qui la pratiquent, d obtenir une variété de descendants qui seront

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

L'apport de l'étude des génomes : les innovations génétiques.

L'apport de l'étude des génomes : les innovations génétiques. Introduction : L'apport de l'étude des génomes : les innovations génétiques. Au sein du vivant, les espèces se différencient les unes des autres par l existence de gènes différents. Au sein d une espèce,

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Délétion 1P36 3.3 ~ Trisomie 9P46. Présentation de la Maladie

Délétion 1P36 3.3 ~ Trisomie 9P46. Présentation de la Maladie Délétion 1P36 3.3 ~ Trisomie 9P46 Présentation de la Maladie deux cellules sexuelles parentales ou gamètes spermatozoïde ovocyte zygote (œuf). Chaque cellule possède un noyau, qui contient l'ensemble du

Plus en détail

Chapitre 3 : conserver ou transmettre l information génétique.

Chapitre 3 : conserver ou transmettre l information génétique. Chapitre 3 : conserver ou transmettre l information génétique. Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

1 les caractères des êtres humains.

1 les caractères des êtres humains. Quelques rappels des classes précédentes ACTIVITÉ livre pages 8 et 9 : apprendre le bilan de la page 9 Les êtres vivants sont répartis en espèces. Chaque être vivant est formé de cellules. schéma d une

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE

Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE Introduction : Tous les individus d une même espèce sont caractérisés par un ensemble de gènes qui sont transmis de génération

Plus en détail

Chapitre 1 La méiose

Chapitre 1 La méiose Chapitre 1 La méiose Marie-Roberte Guichaoua La méiose est un phénomène unique de division cellulaire, propre à la gamétogenèse, au cours de laquelle elle joue un rôle capital en assurant la réduction

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Extrait cours svt 3e. semaine 3

Extrait cours svt 3e. semaine 3 Extrait cours svt 3e semaine 3 Chapitre 1 : Tous parents, tous différents Le titre du chapitre est «tous pareils, tous différents». Le même chapitre, repris plus en détails en Terminale est «tous parents,

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

I Les caractères de l'individu :

I Les caractères de l'individu : Partie 1, Chapitre 1 LES CARACTÈRES DE L'INDIVIDU ET LEUR TRANSMISSION Rappels : Un être vivant : c'est un être qui naît, grandit, mange, rejete des déchets, se reproduit et meurt. Il est constitué de

Plus en détail

LES ANOMALIES CHROSOMIQUES

LES ANOMALIES CHROSOMIQUES LES ANOMALIES CHROSOMIQUES I. GENERALITES : Anomalies constitutionnelles et acquises «constitutionnelles» présentes à la naissance; accident avant la fécondation ( gamètes) ou dans les premières divisions

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

N 43. Problèmes posés par les maladies génétiques, à propos :

N 43. Problèmes posés par les maladies génétiques, à propos : N 43. Problèmes posés par les maladies génétiques, à propos : d une maladie chromosomique : la trisomie 21 d une maladie génique : la mucoviscidose d une maladie d instabilité : le syndrome de l X fragile

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Translocations chromosomiques

Translocations chromosomiques 12 Translocations chromosomiques Adapté des brochures élaborés par l Hôpital Guy et l Hôpital St Thomas à Londres et adapté aux critères de qualité du London IDEAS Genetic Knowledge Park. Traduction française

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques 12 Où puis-je avoir plus d information sur les anomalies chromosomiques? Anomalies chromosomiques Ceci est un guide succinct sur les anomalies chromosomiques. Pour de plus amples informations vous pouvez

Plus en détail

Cours cytogénétique :

Cours cytogénétique : Cours cytogénétique : Introduction : La cytogénétique permet d étudier le nombre et la structure des chromosomes (génétique chromosomique). Un chromosome= une molécule d ADN bicaténaine + des protéines

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

Bio-5065-2. Prétest 2. «S.V.P., ne rien écrire sur le document» Nom de l élève : Date :

Bio-5065-2. Prétest 2. «S.V.P., ne rien écrire sur le document» Nom de l élève : Date : LA TRANSMISSION DES CARACTÈRES HÉRÉDITAIRES Prétest 2 «S.V.P., ne rien écrire sur le document» Nom de l élève : Date : Nathalie Levesque, Centre des 16-18 ans, mai 2004 Commission Scolaire Marie-Victorin

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

TITRE : DES CHROMOSOMES AUX CARACTERES DE L INDIVIDU

TITRE : DES CHROMOSOMES AUX CARACTERES DE L INDIVIDU TITRE : DES CHROMOSOMES AUX CARACTERES DE L INDIVIDU classe :3ème durée : 1h 30 la situation-problème. Mickaël vient d apprendre que son cousin de 28 ans, avec qui, il s entend si bien, a un caryotype

Plus en détail

Chapitre 5: Evolution de la biodiversité

Chapitre 5: Evolution de la biodiversité Chapitre 5: Evolution de la biodiversité Constat: Tous les êtres vivants ont la même structure (cellules, MO) et pourtant ils ont beaucoup évolué au cours des temps géologiques. Problème: Par quels mécanismes

Plus en détail

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Partie 1, Chapitre 4 INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Constat : à l'exception des jumeaux, chaque individu est unique. Ses caractères héréditaires dependent des info génétiques (allèles) portées

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358)

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

Chapitre 1A1 : Le brassage génétique et la diversité des génomes

Chapitre 1A1 : Le brassage génétique et la diversité des génomes Chapitre 1A1 : Le brassage génétique et la diversité des génomes Cellule du foie et son caryotype Animations : Mitose Comparaison Mitose / Méiose Méiose + cellules diploïdes (2n) gamètes haploïdes (n)

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Maladie héréditaire et test génétique

Maladie héréditaire et test génétique Maladie héréditaire et test génétique Nous verrons dans cette partie différents genres d anomalies génétiques, nous servant, pour chaque genre, d un exemple particulier. Quelques genres comportent un gène

Plus en détail

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Les organismes ne peuvent survivre que si leur ADN est soigneusement répliqué et protégé des altérations chimiques et physiques qui pourraient changer

Plus en détail

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes)

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes) Anomalies de structure Réarrangements du matériel chromosomique Un seul ou plusieurs Anomalies Translocations robertsoniennes et réciproques équilibrées Mécanismes de déséquilibre Héritées ou de novo Equilibrées

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS Dr Sylvie Taviaux Laboratoire de cytogénétique Hôpital Arnaud de Villeneuve CHU Montpellier S-taviaux@chu-montpellier.fr Septembre 2014 PRINCIPES

Plus en détail

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014.

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. Vous devez choisir pour chaque question proposée, zéro, une ou plusieurs réponses exactes parmi celles proposées ou bien répondez à la question.

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

Examen de Mi-d'année. Exercice I: L albinisme et ses causes.

Examen de Mi-d'année. Exercice I: L albinisme et ses causes. Class: 3 ème. Secondaire (S.V.) Matière: Biologie Exercice I: L albinisme et ses causes. Examen de Mi-d'année Points: 20 pts. Durée: 180 min. (4.5 pts.) L albinisme résulte d un manque général de la pigmentation

Plus en détail

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr Immunogénétique COURS 1 Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr PRESENTATION CM1 Définitions Rappels des concepts Chromosomes Anomalies chromosomiques CM2 Mutations géniques

Plus en détail

I/ L information génétique se trouve dans les chromosomes du noyau.

I/ L information génétique se trouve dans les chromosomes du noyau. Chapitre 2 : localisation et organisation de l information génétique Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Dr BOGGIO La génétique 2.2 S1 Cycles de la vie et grandes fonctions IFSI Dijon - Promotion COLLIERE 2014-2015

Dr BOGGIO La génétique 2.2 S1 Cycles de la vie et grandes fonctions IFSI Dijon - Promotion COLLIERE 2014-2015 1 Dr BOGGIO La génétique 2.2 S1 Cycles de la vie et grandes fonctions IFSI Dijon - Promotion COLLIERE 2014-2015 14 Les chromosomes sont constitués d ADN. Les gènes sont des segments d ADN. Ils renferment

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome Molécules ADN Division cellulaire Synthèse des protéines. En Lien: Campbell, Reece,2déd./Biologie./chap.13 1 En Lien: Campbell, Reece,2déd./Biologie./chap.13 2 1 Chromosome Phénotype: l'apparence : structures

Plus en détail

Chapitre 2. Les mutations, source de variabilité génétique

Chapitre 2. Les mutations, source de variabilité génétique Chapitre 2 Les mutations, source de variabilité génétique Les allèles sont dus à des modifications delaséquencedesgènes:lesmutations. Quelle est l origine de ces mutations? I. Les mutations sont des modifications

Plus en détail

PARTIE 1: UNITE ET DIVERSITE DES ETRES HUMAINS. CHAPITRE 3 : Reproduction sexuée et diversité génétique

PARTIE 1: UNITE ET DIVERSITE DES ETRES HUMAINS. CHAPITRE 3 : Reproduction sexuée et diversité génétique PARTIE 1: UNITE ET DIVERSITE DES ETRES HUMAINS. CHAPITRE 3 : Reproduction sexuée et diversité génétique Rappel : Nous héritons notre programme génétique de nos parents. Pourtant, il existe des différences

Plus en détail

1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN

1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN 1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN Introduction Toutes ces coccinelles appartiennent au même genre cependant elles présentent toutes des différences. Ces différences

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Thème : Génétique et évolution. Chapitre 2 : Mécanismes de diversification des êtres vivants. I. Les mécanismes génétiques.

Thème : Génétique et évolution. Chapitre 2 : Mécanismes de diversification des êtres vivants. I. Les mécanismes génétiques. Thème : Génétique et évolution. Chapitre 2 : Mécanismes de diversification des êtres vivants. I. Les mécanismes génétiques. A. Les brassages génétiques liés à la reproduction sexuée (méiose et fécondation).

Plus en détail

POLY-PREPAS. Transmission, nature et expression de l information génétique

POLY-PREPAS. Transmission, nature et expression de l information génétique POLY-PREPAS Transmission, nature et expression de l information génétique 1 GENETIQUE HUMAINE 1-INTRODUCTION : Appliquée à l'espèce humaine, la génétique conserve toutes ses normes. Cependant, confronté

Plus en détail

REFERENTIEL : STABILITE ET VARIATIONS DU GENOME ET EVOLUTION

REFERENTIEL : STABILITE ET VARIATIONS DU GENOME ET EVOLUTION REFERENTIEL : STABILITE ET VARIATIONS DU GENOME ET EVOLUTION MOBILISER RAPIDEMENT LE VOCABULAIRE Dominance Recombinaison Sélection naturelle Mutation Récessivité Codominance Homozygote Hétérozygote Génotype

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies Les chromosomes, le caryotype et ses anomalies 1 I. Intérêt de l établissement du caryotype II. Structure t du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype 1. Le rangement

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

V-2-2- Les éléments mobiles ou éléments transposables

V-2-2- Les éléments mobiles ou éléments transposables V-2-2- Les éléments mobiles ou éléments transposables Ce sont des séquences d ADN qui peuvent se déplacer d un endroit à un autre du génome. Ce déplacement est dit transposition. L ADN qui contient l élément

Plus en détail

Dépistage drépanocytose. Édition 2009

Dépistage drépanocytose. Édition 2009 Dépistage drépanocytose Édition 2009 ÊTre hétérozygote et alors Madame, Monsieur, Comme tous les nouveau-nés, votre bébé a eu un prélèvement de sang au talon. Ce prélèvement a été réalisé dans le cadre

Plus en détail

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900.

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900. 04.01.00. GROUPES SANGUINS Dr Deschamps 1 ) DEFINITION : a) Groupe : Ensemble d individus qui ont un caractère en commun et se distinguent ainsi des autres. b) Sanguin : Concerne une cellule ou une molécule

Plus en détail

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN I. STRUCTURE DE L ADN Le génome humain est contenu dans des NOYAUX (EUCARYOTES) Petite quantité d ADN en dehors du noyau dans la MITOCHONDRIE Sous

Plus en détail

Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre

Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre Schéma clé Relation ADN, gène, chromosome Chaque individu d une espèce donnée peut être définie par ses caractères

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations Constat : la méiose produit des gamètes génétiquement différents qui parfois comportent des anomalies qui peuvent empêcher l embryon de se développer ou de se développer normalement et entraîner alors

Plus en détail

TP10/COURS. -III- Le double brassage génétique de la méiose. -1- Brassage intrachromosomique en Prophase I de méiose. #droso. Livre page 22 et 23

TP10/COURS. -III- Le double brassage génétique de la méiose. -1- Brassage intrachromosomique en Prophase I de méiose. #droso. Livre page 22 et 23 TP10/COURS -III- Le double brassage génétique de la méiose -1- Brassage intrachromosomique en Prophase I de méiose Livre page 22 et 23 #droso Il résulte de l existence d échanges d un ou de plusieurs segments

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Chapitre 1 : le brassage génétique et sa contribution à la diversité génétique

Chapitre 1 : le brassage génétique et sa contribution à la diversité génétique Objectif : les anomalies et la diversité - B2I, tache complexe Observation : la méiose produit des gamètes génétiquement différents qui parfois comportent des anomalies qui peuvent empêcher l embryon de

Plus en détail

Caryotype humain : Technique - Indications

Caryotype humain : Technique - Indications Caryotype humain : Technique - Indications Collège National des Enseignants et Praticiens de Génétique Médicale Dr Cédric Le Caignec Service de génétique médicale, CHU Nantes, France Date de création du

Plus en détail

Cellules somatiques vs. cellules germinales (gamètes) Chromosome autosomal vs. Chromosome sexuel (gonosomique)

Cellules somatiques vs. cellules germinales (gamètes) Chromosome autosomal vs. Chromosome sexuel (gonosomique) p.162 à 183 SBI 3U Cellules somatiques vs. cellules germinales (gamètes) Haploïde vs. Diploïde Chromosome autosomal vs. Chromosome sexuel (gonosomique) Chromatine et chromatide http://www.biologieenflash.net/animation.php?ref=bio-0023-2

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

10.25/2. Shéma du processur de fibrose kystique sur une glande

10.25/2. Shéma du processur de fibrose kystique sur une glande Thème 1-A : Expression, stabilité et variation du patrimoine génétique TP 6 : La mucoviscidose : multiples échelons d un phénotype La mucoviscidose présente des indications visibles qui constituent un

Plus en détail

Thème IA1 Méiose, brassage génétique

Thème IA1 Méiose, brassage génétique Thème IA1 Méiose, brassage génétique et diversité des génomes PROBLÉMATIQUE : Comment la reproduction sexuée assure-t-elle à la fois la stabilité d une espèce et la diversité des individus qui la composent?

Plus en détail

Mitose dans une celule végétale

Mitose dans une celule végétale Cours 1 101-NYA-05 Afin de respecter les droits d auteur, à moins d avis contraire, toutes les figures présentées ont été prises dans le manuel suggéré au début de la session : Campbell, Neil A. 4 e Édition,

Plus en détail

La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations.

La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations. Reprendre l essentiel pour bien réussir son année en S.V.T. La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations. En

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Ressources. Production attendue

Ressources. Production attendue Thème du programme : la tectonique des plaques histoire d un modèle Etape 1 : Concevoir une stratégie pour résoudre une situation problème proposer une démarche d investigation Contre arguments de la théorie

Plus en détail

Variabilité génétique et mutation de l ADN

Variabilité génétique et mutation de l ADN Partie 1 chapitre 2 Variabilité génétique et mutation de l ADN Activités pratiques 1 L origine d une variabilité de l ADN (p. 32-33) Connaissances Pendant la réplication de l ADN surviennent des erreurs

Plus en détail

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères.

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Certains caractères sont communs à tous les individus de notre espèce et permettent de nous distinguer des

Plus en détail

I. technique pour établir le caryotype

I. technique pour établir le caryotype 2 LE CARYOTYPE Le caryotype est une photographie de l'ensemble des chromosomes d'une cellule. Les chromosomes sont rangés par paires en fonction de leur forme, leur taille et de la position des bandes

Plus en détail

Quelques messages et points clés.

Quelques messages et points clés. Quelques messages et points clés. 40 On répétera que ce test n est pas un caryotype, que c est un test qui est réalisé à partir d un ADN qui provient de cellules trophoblastiques, donc on s attend dans

Plus en détail

Initiative pour l'information sur les cancers fémmes

Initiative pour l'information sur les cancers fémmes Initiative pour l'information sur les cancers fémmes Coordonné par l Institut europeén de la santé des femmes www.eurohealth.ie Cancer et Génétique Le cancer du sein est le cancer le plus fréquent chez

Plus en détail

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Son importance 3% des grossesses : problème génétique g Individus de moins de 25 ans: 1/20 des pathologies est d origine d génétique g Différents types de maladies

Plus en détail

Chap 5 thème 1 : LE BRASSAGE GENETIQUE ET SA CONTRIBUTION A LA DIVERSITE GENETIQUE

Chap 5 thème 1 : LE BRASSAGE GENETIQUE ET SA CONTRIBUTION A LA DIVERSITE GENETIQUE Partie II thème 1 GENETIQUE ET EVOLUTION Restitution des acquis Présentation des chapitres Chap 5 thème 1 : LE BRASSAGE GENETIQUE ET SA CONTRIBUTION A LA DIVERSITE GENETIQUE Restitution des acquis communiquer

Plus en détail

1 Des innovations génétiques favorables

1 Des innovations génétiques favorables ACTIVITÉ 1 Des innovations génétiques favorables ou défavorables Les mutations sont des innovations génétiques qui apparaissent de manière aléatoire dans le génome des organismes. Elles peuvent avoir des

Plus en détail

Chapitre 1 Les mutations de l ADN et les duplications de gènes : les moteurs des innovations génétiques

Chapitre 1 Les mutations de l ADN et les duplications de gènes : les moteurs des innovations génétiques 1 La molécule d ADN est apparemment stable mais elle présente une certaine variabilité. Des modifications d ADN créent : - de nouveaux allèles à l origine du polymorphisme génétique et phénotypique des

Plus en détail

Méiose et Fécondation participent à la stabilité de l espèce.

Méiose et Fécondation participent à la stabilité de l espèce. Méiose et Fécondation participent à la stabilité de l espèce. Introduction : Une espèce comprend des individus qui possèdent les mêmes caractères de l espèce, qui sont interféconds et qui engendrent des

Plus en détail

QCM «Stabilité et variabilité des génomes et évolution» 1. Au cours du cycle sexuel de tous les êtres vivants à reproduction sexuée : A- Le caryotype

QCM «Stabilité et variabilité des génomes et évolution» 1. Au cours du cycle sexuel de tous les êtres vivants à reproduction sexuée : A- Le caryotype QCM «Stabilité et variabilité des génomes et évolution» 1. Au cours du cycle sexuel de tous les êtres vivants à reproduction sexuée : A- Le caryotype des cellules somatiques de l espèce est toujours conservé.

Plus en détail

Devoir maison n 1 : La relation entre phénotypes et protéines

Devoir maison n 1 : La relation entre phénotypes et protéines Devoir maison n 1 : La relation entre phénotypes et protéines Une maladie génétique : Le Xeroderma pigmentosum A partir des informations tirées des documents 1 à 4, présentez les divers niveaux de phénotypes

Plus en détail

Comment expliquer nos ressemblances et nos différences?

Comment expliquer nos ressemblances et nos différences? Chez l espèce humaine, comme chez toute espèce, il existe des ressemblances et des différences entre les individus, y compris à l intérieur d une même famille. Comment expliquer nos ressemblances et nos

Plus en détail

La génétique et l hérédité

La génétique et l hérédité La génétique et l hérédité Exercice de révision : La phénylcétonurie est une maladie héréditaire due à un allèle récessif. Dans les cellules du foie, une enzyme, la PAH (phénylalanine hydroxylase), permet

Plus en détail

C O R R I G E. I. MAITRISE DES CONNAISSANCES (05 points) Introduction

C O R R I G E. I. MAITRISE DES CONNAISSANCES (05 points) Introduction SCIENCES DE LA VIE ET DE LA TERRE 1/6 09 G 28 A 01 C O R R I G E I. MAITRISE DES CONNAISSANCES (05 points) Introduction La contraction musculaire nécessite l hydrolyse de molécules d ATP, dont le stock

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

-anomalies chromosomiques: nombre, structure -recombinaison de chromosomes

-anomalies chromosomiques: nombre, structure -recombinaison de chromosomes La cytogénétique est l'étude des phénomènes génétiques au niveau de la cellule, plus précisément au niveau des chromosome sans la nécessité d'extraire l'adn : -anomalies chromosomiques: nombre, structure

Plus en détail

Docteur Sophie ROUSSEAUX

Docteur Sophie ROUSSEAUX Histologie - Biologie du développement De la gamétogenèse à l embryon pré-implantatoire Chapitre 1 : Introduction, la méiose, la spermatogénèse Docteur Sophie ROUSSEAUX Médecine P1 Multimédia - Année 2006/2007

Plus en détail

Variabilité génétique et stabilité des espèces

Variabilité génétique et stabilité des espèces TP-TD 2 Variabilité génétique et stabilité des espèces Objectif et Compétences Faire preuve d'esprit logique et critique Analyser des documents Interpréter des observations Travail à faire : Sur une feuille

Plus en détail

Les chromosomes, le caryotype et ses anomalies. Dr. Martina Carlotti

Les chromosomes, le caryotype et ses anomalies. Dr. Martina Carlotti Les chromosomes, le caryotype et ses anomalies Dr. Martina Carlotti I. Introduction II. La structure du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype : Comment établir un

Plus en détail