Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010"

Transcription

1 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010

2 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications confondues Nombre de fœtus testés Nombre de fœtus atteints > Pertes fœtales théoriques (0,5-1%) (ratio: 1/5-1/10) Diagnostic des anomalies chromosomiques : Age maternel ( 38 ans) pour 394 trisomies 21 détectées Marqueurs sériques pour 415 trisomies 21 détectées > Pertes fœtales théoriques (0,5-1%) pour 809 trisomies 21 détectées (ratio: 1/2.6-1/5.2)

3 Procédure non invasive de diagnostic prénatal Obtention de cellules foetales Sang maternel

4 Diagnostic prénatal in utero des anomalies chromosomiques et génétiques : approche invasive Objectif Obtention de cellules fœtales pour: Analyse de génétique moléculaire Mise en culture et établissement du caryotype fœtal

5 Diagnostic prénatal à partir du sang maternel Cellules fœtales circulantes 1893 trophoblaste «pulmonaire» (Schmorl) 1959 trophoblastes circulants (Douglas) 1969 lymphocytes Y (Walknowska) 1979 isolement cellules fœtales par FACS (Herzenberg) 1990 érythroblastes foetaux (Bianchi) 2002 étude NIFTY I 2010???

6 Diagnostic prénatal à partir du sang maternel Cellules fœtales circulantes Prenat Diagn 2002;22: Echec pour 17 % des échantillons Taux de détection de cellules T21+ (FISH) : 74,4 % (4% faux positifs)

7 Diagnostic prénatal à partir du sang maternel Cellules fœtales circulantes : les difficultés Quantité : 1 à 2 par ml de sang Pas de culture possible Analyse «unicellulaire» délicate Isolement et enrichissement complexes (méthodes immunologiques) Persistance («microchimérisme fœtal»)

8 Diagnostic prénatal à partir du sang maternel Un «nouveau» concept L ADN fœtal sérique ou plasmatique (ADN fœtal libre circulant) Lancet 1997;350: Détection de séquences ADN dérivées du chromosome Y : 80 % (24/30)

9 ADN fœtal plasmatique Physiopathologie Origine cellulaire: les cellules trophoblastiques

10 ADN fœtal circulant Physiopathologie Processus de relargage dans la circulation maternelle: apoptose cellulaire Veines utérines Passage pulmonaire (?) ADN circulant

11 ADN fœtal plasmatique Physiopathologie Origine cellulaire: les cellules trophoblastiques Apparition précoce dans la circulation maternelle (détection 5-6SA) Augmentation de la concentration tout au long de la grossesse Disparition rapide (< 48 h) après accouchement (1/2 vie 16 min) Pas de persistance après grossesse

12 ADN fœtal plasmatique Difficultés et limites Analyse moléculaire Séquençage MLPA, QF-PCR Caryotype moléculaire (CGH-array, SNP-array)

13 ADN fœtal plasmatique Difficultés et limites d analyse Ne représente que 3 à 6% de l ADN plasmatique Quantité faible au 1 er trimestre : Geq/ml

14 Analyse de l ADN fœtal plasmatique Recherche de séquences absentes du génome maternel Y X Détermination du sexe fœtal : Recherche de séquences dérivées du chromosome Y (gènesry)

15 Détermination du sexe foetal Intérêts Maladies génétiques liées à l X Eviter un geste invasif (CVS) chez les patientes conductrices qui portent un fœtus de sexe féminin (ne présentant aucun risque) Hyperplasie congénitales des surrénales (déficit en 21-hydroxylase) Eviter le recours à un traitement corticoïde chez les patientes qui portent un foetus de sexe masculin (traitement inutile) Ambiguïtés sexuelles échographiques, discordances caryotypes/échographie Aide à la prise en charge.

16 Analyse de l ADN fœtal plasmatique Recherche de séquences absentes du génome maternel RHD+ RHD- Génotypage RHD fœtal : séquences dérivées du gène RHD

17 Analyse de l ADN fœtal circulant: application au génotypage RHD Les bases moléculaires du système rhésus Blood 1991;78: Nat Genet 1993;5:62-5. N Engl J Med 1993;329:

18 Analyse de l ADN fœtal circulant: application au génotypage RHD Les bases moléculaires du phénotype RhD-négatif Upstream Rhesus box Downstream Rhesus box

19 Analyse de l ADN fœtal plasmatique Recherche de séquences absentes du génome maternel RHD+ RHD- Génotypage RHD fœtal : séquences dérivées du gène RHD Ce qui a changé! Plus de recours à l amniocentèse chez les patientes alloimmunisées pour évaluation foetale Plus d injection systématique d immunoglobulines anti-d chez les patientes RhD-négatives après un geste invasif (villosités choriales ou amniocentèse) Intérêt: environ 30% des fœtus sont RhD-négatifs

20 Analyse de l ADN fœtal plasmatique Recherche de séquences absentes du génome maternel RHD+ RHD- Génotypage RHD fœtal : séquences dérivées du gène RHD Ce qui a changé! Plus de recours à l amniocentèse chez les patientes alloimmunisées pour évaluation foetale Plus d injection systématique d immunoglobulines anti-d chez les patientes RhD-négatives après un geste invasif (villosités choriales ou amniocentèse) Ce qui est nouveau! Prophylaxie anti-d à 28-32SA ciblée chez les patientes RhDnégatives dont le fœtus est de génotype RHD positif

21 Génotypage RHD fœtal à partir du sang maternel: principe Les bases moléculaires du système rhésus Sensibilité Ex5 Ex7 Ex10 Allèle RHD Caucase Afrique noire Allèle RHD Neg «classique» Allèle RHD- «RHD-CE-D s» Allèle RHD- «RHDψ» % <1% <1% 18% 15% 67% Fréquence du phénotype RhD-négatif: 15-17% 3-5%

22 Aspects règlementaires L analyse de l ADN fœtal circulant est un acte de diagnostic prénatal Laboratoires : Autorisation de diagnostic prénatal par l ARH Praticiens : Agrément par l Agence de la Biomédecine Déclaration annuelle des activités diagnostiques

23 Diagnostic prénatal non invasif des maladies monogéniques (ou caractéristique génétique)? Un défi technologique majeur-1

24 Diagnostic prénatal non invasif des maladies monogéniques (ou caractéristique génétique)? Le challenge CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACAGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG CCATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTG

25 Détection d une population minoritaire d allèle muté: exemple de la PCR-HRM Proportion de l allèle muté au sein d un background «sauvage» 5% 2.5% 1% 0%

26 Analyse de l ADN fœtal plasmatique Recherche de mutations ponctuelles chez le foetus Mutation de novo : achondroplasie Recherche de la mutation G380R du gène FGFR3 Ce qui va changer? (validation clinique en cours) Complément à l analyse échographique Ce qui pourrait se faire? Hypochondroplasie Nanisme thanatophore Syndrome d Apert

27 Analyse de l ADN fœtal plasmatique Recherche de mutations ponctuelles chez le foetus K1 K2 SNP paternel : génotypage KEL (K1) Recherche du variant Thr193Met du gène KEL Ce qui va changer? (validation clinique en cours) Plus de recours à l amniocentèse chez les patientes alloimmunisées pour évaluation fœtale Ce qui pourrait se faire? Génotypage plaquettaire (HPA1 ) Diagnostic des maladies autosomiques dominantes (paternelle) Test de paternité

28 Analyse de l ADN fœtal plasmatique Recherche de mutations ponctuelles chez le foetus G551D F508del SNP paternel: diagnostic d exclusion Ce qui pourrait se faire? (publiés) Mucoviscidose Béta-thalassémies Acidémie propionique Amaurose congénitale de Leber Hémoglobine E Dystonie (DYT1)

29 Analyse de l ADN fœtal libre circulant Ce qui paraît impossible..et pourtant! Quantification de SNP maternel Preuve de concept 10 patientes terme moyen: 19SA Béta-thalassémie/Hémoglobine E 5 fœtus correctement génotypés

30 Diagnostic prénatal in utero en France : quelques chiffres clés

31 Diagnostic prénatal non invasif des anomalies chromosomiques (trisomie 21)? Un défi technologique majeur-2

32 ADN fœtal plasmatique et trisomie Quantification de marqueurs NON-SPECIFIQUES 95 copies maternelles 5 copies foetales 95 copies maternelles 7.5 copies foetales Chr21 mère Chr21 foetus Foetus Euploïde Foetus T21

33 ADN fœtal plasmatique et trisomie 21 Dosage chromosomique relatif (RCD) par Digital PCR 95 copies maternelles 7.5 copies foetales 95 copies maternelles 5 copies foetales Ratio:1.025 Ratio:1.000

34 ADN fœtal plasmatique et trisomie Quantification par «massively parallel sequencing» reads chromosomes bridge amplification by synthesis PCR emulsion by ligation Single molecule amplification Massive parallel sequencing

35 ADN fœtal plasmatique et trisomie 21 Quantification par «massively parallel sequencing» 18 patientes (terme médian: 18 semaines) Tous les cas (9) correctement identifiés 15 patientes (terme médian: 14 semaines) Tous les cas (9) correctement identifiés

36

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 JM Costa 5èmes Journées de Biologie Praticienne Mazagan, 4-5 Avril 2014 LABORATOIRE CERBA, Laboratoire du réseau DIAGNOSTIC PRÉNATAL

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

Diagnostic prénatal non invasif (DPNI)

Diagnostic prénatal non invasif (DPNI) Diagnostic prénatal non invasif (DPNI) Etat des lieux des applications Charles COUTTON PHU, Génétique Chromosomique Colloque Médical du Jeudi 05 Mars 2015 Pourquoi? DPN: nécessite un geste invasif pour

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité. Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba

Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité. Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba Paris le 13 avril 2013 Madame ABD, conductrice d hémophilie A sévère

Plus en détail

Qu'est-ce que nukleo?

Qu'est-ce que nukleo? Qu'est-ce que nukleo? nukleo est un test prénatal non invasif qui permet de dépister la trisomie 21 et d autres anomalies chromosomiques chez le fœtus. nukleo est réalisé à partir d'une simple prise de

Plus en détail

Quelques messages et points clés.

Quelques messages et points clés. Quelques messages et points clés. 40 On répétera que ce test n est pas un caryotype, que c est un test qui est réalisé à partir d un ADN qui provient de cellules trophoblastiques, donc on s attend dans

Plus en détail

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité PARIS ILE-DE-FRANCE OUEST Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité Françoise Muller Hôpital Robert Debré Le contexte Le dépistage prénatal de la trisomie 21 repose sur

Plus en détail

DÉPISTAGE PRÉNATAL NON INVASIF (DPNI) DE LA TRISOMIE 21 SUR PLASMA MATERNEL

DÉPISTAGE PRÉNATAL NON INVASIF (DPNI) DE LA TRISOMIE 21 SUR PLASMA MATERNEL Diagnostic Anténatal Non Invasif des Maladies Génétiques DÉPISTAGE PRÉNATAL NON INVASIF (DPNI) DE LA TRISOMIE 21 SUR PLASMA MATERNEL LABORATOIRE DE GENETIQUE ARCHET 2 Trisomie 21 Fréquence 1/800 La plus

Plus en détail

Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant

Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant Dr Laïla El Khattabi Service de Cytogénétique, Hôpital Cochin, Paris DPNT21 en France aujourd hui

Plus en détail

21.09.2015. Sujets. L histoire de l ADN fœtal libre. Il faut savoir que. La technique: Femme normale. Découvertes à la base des tests NIPT

21.09.2015. Sujets. L histoire de l ADN fœtal libre. Il faut savoir que. La technique: Femme normale. Découvertes à la base des tests NIPT Dépistage Prénatal non invasif(dpni;nipt): possibilités et limites des nouveaux tests Dr. Giuditta Filippini FAMH génétique médicale European clinical laboratory geneticist Sujets Découvertes à la base

Plus en détail

Dépistage non invasif de la trisomie 21 par analyse de l ADN fœtal circulant

Dépistage non invasif de la trisomie 21 par analyse de l ADN fœtal circulant Dépistage non invasif de la trisomie 21 par analyse de l ADN fœtal circulant Contacts: Jean-Marc Costa, jmcosta@lab-cerba.com Pascale Kleinfinger, pkleinfinger@lab-cerba.com Laurence Lohmann, llohmann@lab-cerba.com

Plus en détail

Dépistage / Diagnostic de la trisomie 21 en période prénatale

Dépistage / Diagnostic de la trisomie 21 en période prénatale Lyon Neuroscience Research Center Dépistage / Diagnostic de la trisomie 21 en période prénatale Damien Sanlaville Journée mondiale de la trisomie 21 Lyon, le 22 mars 2014 Un point crucial Bien comprendre

Plus en détail

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL GENETIQUE MOLECULAIRE ANNEE :2015

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL GENETIQUE MOLECULAIRE ANNEE :2015 RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL ANNEE :2015 Note relative au remplissage de ce rapport : Si vous rencontrez des difficultés à remplir ce rapport ou si des questions vous paraissent

Plus en détail

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Dépistage Non Invasif de la T21 Oùen sommes nous? Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Pr Alexandra Benachi Exerçant au CHU Antoine Béclère,

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL CYTOGENETIQUE ANNEE : 2017

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL CYTOGENETIQUE ANNEE : 2017 RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL ANNEE : 2017 Note relative au remplissage de ce rapport : Si vous rencontrez des difficultés à remplir ce rapport ou si des questions vous paraissent

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Analyses - Liste des analyses à accompagner d'une attestation de consultation

Analyses - Liste des analyses à accompagner d'une attestation de consultation Analyses - Liste des analyses à accompagner d'une attestation de consultation Libellé Document a joindre au prelevement Acétylcholinestérase - liquide amniotique attestation de consultation et consentement

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

GROSSESSE Ne rien oublier. 2. Suivi de la grossesse: le calendrier

GROSSESSE Ne rien oublier. 2. Suivi de la grossesse: le calendrier GROSSESSE Ne rien oublier 2. Suivi de la grossesse: le calendrier A / LE DEPISTAGE DU RISQUE DE TRISOMIE 21 Introduction: risque de l amniocentese Taux de dépistage Nombre de T21 dépistés Les faux positifs

Plus en détail

Collège de Gynécologie CVL

Collège de Gynécologie CVL Docteur Laurence GOT Docteur Béatrice LAUDIER Pôle Biopathologie CHR d Orléans 31 mai 2012 DEPISTAGE vs DIAGNOSTIC PRENATAL Dépistage : détermine si le fœtus a un risque augmenté d être porteur d une pathologie

Plus en détail

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif.

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif. 1 Normalement, chaque individu a dans chacune de ces cellules 23 paires de chromosomes numérotées de 1 à 22, la 23ème paire étant la paire des chromosomes sexuels. Une des anomalies chromosomiques les

Plus en détail

Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel. Notice d information à l attention des parents

Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel. Notice d information à l attention des parents Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel Notice d information à l attention des parents Madame, Monsieur, Le diagnostic prénatal de la trisomie 21 est organisé

Plus en détail

COMMISSION DE LA TRANSPARENCE AVIS. 31 mars 2010

COMMISSION DE LA TRANSPARENCE AVIS. 31 mars 2010 COMMISSION DE LA TRANSPARENCE AVIS 31 mars 2010 Examen du dossier des spécialités inscrites pour une durée de 5 ans par arrêté du 19/04/2005 (JO du 03/05/2005) RHOPHYLAC 200 microgrammes/2 ml, solution

Plus en détail

POUR UNE GROSSESSE PLUS SEREINE...

POUR UNE GROSSESSE PLUS SEREINE... POUR UNE GROSSESSE PLUS SEREINE... Être parent change profondément une vie et constitue l une des plus belles expériences qui soit. Cette grande aventure apporte également d importantes responsabilités,

Plus en détail

-CN seuil à 3,5 mm. -MSM2T + CN -MSM2T sans mesure de CN - Signes Echographiques ET2 et ET3. -CN (seuil à 3,5 mm) et ET2 et ET3? -Suppression des MSM?

-CN seuil à 3,5 mm. -MSM2T + CN -MSM2T sans mesure de CN - Signes Echographiques ET2 et ET3. -CN (seuil à 3,5 mm) et ET2 et ET3? -Suppression des MSM? Quel dépistage de la trisomie 21 fœtale en 2015 : Marqueurs sériques maternels ou tests génétiques non invasifs? Françoise Muller et ABA Biochimie Prénatale Hôpital Robert Debré Francoise.muller@rdb.aphp.fr

Plus en détail

TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES. LABORATOIRE CERBA, Laboratoire du réseau

TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES. LABORATOIRE CERBA, Laboratoire du réseau TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES 1 LABORATOIRE CERBA, Laboratoire du réseau QU EST-CE QU EST LA TRISOMIE 21? } Syndrome de Down } Maladie génétique } Maladie

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

Médecine prédictive. Objectif Eviter la naissance d un enfant atteint d une maladie grave et incurable au moment du diagnostic

Médecine prédictive. Objectif Eviter la naissance d un enfant atteint d une maladie grave et incurable au moment du diagnostic Médecine prédictive Introduction à la médecine Prédictive Définition : la médecine prédictive a pour objet l'identification d un marqueur de prédisposition à une maladie et pour but le dépistage et/ou

Plus en détail

Génotypage Rhésus D fœtal sur sang maternel Bénéfice de la technique chez la femme RhD négatif immunisée ou non

Génotypage Rhésus D fœtal sur sang maternel Bénéfice de la technique chez la femme RhD négatif immunisée ou non Génotypage Rhésus D fœtal sur sang maternel Bénéfice de la technique chez la femme RhD négatif immunisée ou non LE COMPLEXE Rh Protéine RHD : protéine transmembranaire du Globule Rouge 15000 sites par

Plus en détail

Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique»

Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique» Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique» Chercheur Sujet de recherche Subvention allouée BUJAN Louis DE

Plus en détail

La consultation de déclaration de grossesse

La consultation de déclaration de grossesse La consultation de déclaration de grossesse Dr Muriel Doret Maître de conférence universitaire - Praticien hospitalier Gynécologie Obstétrique Hôpital Femme-Mère-Enfant Les Jeudi de l Europe 38ième Forum

Plus en détail

Cours sur l anémie hémolytique du nouveau-né

Cours sur l anémie hémolytique du nouveau-né Cours sur l anémie hémolytique du nouveau-né né Dr Marie-José STELLING Musée des grenouilles à Estavayer-le-Lac Anémie hémolytique du nouveau-né né Trois conditions doivent être réunies: présence d un

Plus en détail

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME Clinique de Fertilité ULB ERASME Introduction Pour des couples à haut risque de mettre au monde un enfant atteint d une maladie génétique, l approche classique par les examens anténatals conventionnels

Plus en détail

Dépistage prénatal 11 e -14 e semaine

Dépistage prénatal 11 e -14 e semaine 23 Dépistage prénatal 11 e -14 e semaine Brochure d information Pour vous, pour la vie Quelques faits. La grande majorité des bébés naissent normaux ;. Toutes les femmes, quelque soit leur âge, présentent

Plus en détail

Extrait des Mises à jour en Gynécologie et Obstétrique

Extrait des Mises à jour en Gynécologie et Obstétrique COLLÈGE NATIONAL DES GYNÉCOLOGUES ET OBSTÉTRICIENS FRANÇAIS Président : Docteur B. Maria Extrait des Mises à jour en Gynécologie et Obstétrique TOME XXIV publié le 30.11.2000 VINGT-QUATRIÈMES JOURNÉES

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

L HÔPITAL NORD, PÔLE D EXCELLENCE DANS LE DIAGNOSTIC PRÉNATAL

L HÔPITAL NORD, PÔLE D EXCELLENCE DANS LE DIAGNOSTIC PRÉNATAL L HÔPITAL NORD, PÔLE D EXCELLENCE DANS LE DIAGNOSTIC PRÉNATAL DOSSIER DE PRESSE INAUGURATION DU CENTRE DE MÉDECINE FŒTALE ET DU LABORATOIRE DE BIOLOGIE MOLÉCULAIRE FOETO-MATERNELLE HÔPITAL NORD VENDREDI

Plus en détail

DATATION de la GROSSESSE

DATATION de la GROSSESSE DATATION de la GROSSESSE Julia BEGLER-FONNIER Maternité CHU CAREMEAU Intérêts Améliorer le pronostic de la grossesse: Déterminer la date d accouchement; Évaluer la croissance fœtale Pouvoir interpréter

Plus en détail

PREVENTION DE L ALLO-IMMUNISATION Rh D FOETO-MATERNELLE.

PREVENTION DE L ALLO-IMMUNISATION Rh D FOETO-MATERNELLE. Association Loi 1901 n 0784014641 29 rue de Versailles - 78150 Le Chesnay Tel : 01.39.43.12.04 Fax : 01.39.43.13.58 E-mail : cpav@wanadoo.fr Web: http://www.nat78.com PREVENTION DE L ALLO-IMMUNISATION

Plus en détail

Dépistage de la T21 :

Dépistage de la T21 : Dépistage de la T21 : Nouvelles stratégies dans le Hainaut Dr I. DAMAREY Dr N. TILLOUCHE Dr H. QUIQUEMPOIS EPIDEMIOLOGIE T 21 : la plus fréquente des Trisomies 50.000 personnes en France 1/839 naissances

Plus en détail

La médecine fœtale est une discipline

La médecine fœtale est une discipline Quel avenir pour le diagnostic prénatal? RÉSUMÉ : Le formidable essor des techniques de diagnostic prénatal a permis sans cesse des progrès depuis les années 80, dans la qualité du dépistage et du diagnostic

Plus en détail

POUR UNE GROSSESSE PLUS SEREINE

POUR UNE GROSSESSE PLUS SEREINE POUR UNE GROSSESSE PLUS SEREINE Être parent change profondément une vie et constitue l une des plus belles expériences qui soit. Cette grande aventure apporte également d importantes responsabilités, des

Plus en détail

On en vient maintenant au test lui-même.

On en vient maintenant au test lui-même. On en vient maintenant au test lui-même. 6 Avant d envisager la technologie elle-même, quelques mots sur le diagnostic prénatal non invasif qui est réalisé historiquement à partir du sang maternel. On

Plus en détail

QCM 1. QCM génétique QCM 1 QCM 2 QCM 3 QCM 2 17/03/2010

QCM 1. QCM génétique QCM 1 QCM 2 QCM 3 QCM 2 17/03/2010 QCM 1 QCM génétique Thomas Briot Interne, Pharmacie Dans l étude d un arbre généalogique, un seul des critères suivants est spécifique de l hérédité autosomique dominante: 1. Sujets atteints à chaque génération

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières.

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières. Cette nouvelle édition des fiches régionales relatives à l activité 2013 des centres pluridisciplinaires de diagnostic prénatal (CPDPN), des laboratoires de diagnostic prénatal (DPN) et de l activité 2014

Plus en détail

La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique

La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique Les DPNI utilisent l ADN acellulaire (cfdna). Échantillon de sang maternel cfdna

Plus en détail

PREVENTION RHESUS ET GENOTYPAGE RHD FOETAL. Agnès Mailloux, Yves Brossard

PREVENTION RHESUS ET GENOTYPAGE RHD FOETAL. Agnès Mailloux, Yves Brossard PREVENTION RHESUS ET GENOTYPAGE RHD FOETAL Agnès Mailloux, Yves Brossard INCOMPATIBILITES RHD FOETO-MATERNELLES EN FRANCE INCIDENCE estimée MORTALITE estimée & (pour 1000 naissances) MORBIDITE SEVERE 1966

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Laboratoires TESTS DANS ENTIER.

Laboratoires TESTS DANS ENTIER. NIFTY est un test sanguin sécuritaire et facile qui détecte avec précision certaines conditions génétiques telles que le syndrome de Down, dès la 10 e semaine de votre grossesse. PLUS DE 600 000 TESTS

Plus en détail

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations Constat : la méiose produit des gamètes génétiquement différents qui parfois comportent des anomalies qui peuvent empêcher l embryon de se développer ou de se développer normalement et entraîner alors

Plus en détail

Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire.

Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire. Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire. 23 Je vais vous présenter trois types de résultats. Le premier groupe de résultats consiste en une comparaison

Plus en détail

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL BIOCHIMIE FŒTALE ET MARQUEURS SERIQUES ANNEE : 2015

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL BIOCHIMIE FŒTALE ET MARQUEURS SERIQUES ANNEE : 2015 RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL BIOCHIMIE FŒTALE ET MARQUEURS SERIQUES Biochimie fœtale : page 3 à page 10 Marqueurs sériques : page 11 à page 17 ANNEE : 2015 Note relative au remplissage

Plus en détail

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA 09 Octobre 2015 5 Mb Principe de la CGH array Nanotechnologie

Plus en détail

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient

Analyses à accompagner d'une attestation de consultation et/ou du consentement du patient Laboratoires Saint Julien & Beaulieu L'attestation de consultation doit être délivrée par le prescripteur. Un formulaire de consentement est disponible au laboratoire du même type qu à la page 68 de ce

Plus en détail

Indications de la détection de l ADN fœtal dans le diagnostic prénatal Damien Sanlaville

Indications de la détection de l ADN fœtal dans le diagnostic prénatal Damien Sanlaville Indications de la détection de l ADN fœtal dans le diagnostic prénatal Damien Sanlaville Service de Génétique, CHU de Lyon Centre de Recherche en Neurosciences de Lyon Paris, 15 Mars 2017 COI : Société

Plus en détail

SUIVI DE GROSSESSE NORMALE

SUIVI DE GROSSESSE NORMALE SUIVI DE GROSSESSE NORMALE DES Gynécologie Médicale 27/03/14 Julie Blanc Maternité Port-Royal Epidémiologie 810 000 naissances en 2013 9,9 +/- 3,7 consultations pendant la grossesse 2010 > 2003 Consultations

Plus en détail

DEPISTAGE PRENATAL NON INVASIF (DPNI) DES TRISOMIES 13,18,21

DEPISTAGE PRENATAL NON INVASIF (DPNI) DES TRISOMIES 13,18,21 Consentement Indications Grossesse Patiente DEPISTAGE PRENATAL NON INVASIF (DPNI) DES TRISOMIES 13,18,21 L a b o ratoire BIOXA - PO R T E D E PARIS 27, rue du Colonel Fabien 51100 REIMS 03.26.04.07.89-03.26.08.76.50

Plus en détail

SUVI DE LA FEMME ENCEINTE. Suivi de la RAI positive : Titrage microtitrage Prise en charge clinique et biologique de la femme immunisée

SUVI DE LA FEMME ENCEINTE. Suivi de la RAI positive : Titrage microtitrage Prise en charge clinique et biologique de la femme immunisée SUVI DE LA FEMME ENCEINTE Suivi de la RAI positive : Titrage microtitrage Prise en charge clinique et biologique de la femme immunisée INCOMPATIBILITES FOETO-MATERNELLES ERYTHROCYTAIRES Epidémiologie Incidence

Plus en détail

Cas clinique Dans quelle mesure Mme X fait-elle partie des groupes à risque de ce type de pathologie?

Cas clinique Dans quelle mesure Mme X fait-elle partie des groupes à risque de ce type de pathologie? Consultation préconceptionnelle Dr Alain LIQUIER Cas cliniques : maladies génétiques Travail en groupe : 3 x 15 min Cas clinique 1 Mme X vient vous voir parce qu elle est enceinte d environ 5 semaines

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Correction de la conférence du 22 Mars 2011 Génétique Susanna Davoust

Correction de la conférence du 22 Mars 2011 Génétique Susanna Davoust Correction de la conférence du 22 Mars 2011 Génétique Susanna Davoust 1/ Parmi les propositions suivantes concernant les notions de génotype et de phénotype, lesquelles sont justes? A : Le génotype est

Plus en détail

Place de la Génétique en Médecine Générale

Place de la Génétique en Médecine Générale Place de la Génétique en Médecine Générale Principes et indications des examens en génétique médicale ECU-UCL 12.01.2008 Dr I.Maystadt Génétique : quelques petits rappels Cytogénétique tique 46 chromosomes

Plus en détail

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900.

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900. 04.01.00. GROUPES SANGUINS Dr Deschamps 1 ) DEFINITION : a) Groupe : Ensemble d individus qui ont un caractère en commun et se distinguent ainsi des autres. b) Sanguin : Concerne une cellule ou une molécule

Plus en détail

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes)

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes) Anomalies de structure Réarrangements du matériel chromosomique Un seul ou plusieurs Anomalies Translocations robertsoniennes et réciproques équilibrées Mécanismes de déséquilibre Héritées ou de novo Equilibrées

Plus en détail

CONDUITE A TENIR DEVANT UNE PATIENTE antigène HBs + PENDANT LA GROSSESSE

CONDUITE A TENIR DEVANT UNE PATIENTE antigène HBs + PENDANT LA GROSSESSE Communauté Périnatale de l Agglomération Versaillaise Association Loi 1901 n 0784014641 29 rue de Versailles 78150 Le Chesnay Tel : 01 39 43 12 04 Web : www.nat78.com email: cpav@medical78.com CONDUITE

Plus en détail

Dépistage Prénatal Non-Invasif (DPNI) Nouvelle génération

Dépistage Prénatal Non-Invasif (DPNI) Nouvelle génération Dépistage Prénatal Non-Invasif (DPNI) Nouvelle génération Environ 1 à 2 % des fœtus présentent des anomalies chromosomiques. En intégrant les nouvelles technologies d Illumina, SYNLAB, avec toute l expertise

Plus en détail

Dépistage prénatal non-invasif des trisomies 13, 18 et 21

Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Le nouveau test de dépistage prénatal des trisomies sur prise de sang maternel Qu est-ce que le DPNI par Biomnis? Le DPNI est un examen innovant

Plus en détail

Introduction. Physio-pathologie. Epidémiologie. Allo-immunisation Foeto-Maternelle. Physio-pathologie Mode Immunisation

Introduction. Physio-pathologie. Epidémiologie. Allo-immunisation Foeto-Maternelle. Physio-pathologie Mode Immunisation Allo-immunisation Foeto-Maternelle Prise en charge et principe de prévention Introduction Production d Ac chez la mère dirigé contre un Ag de groupe sanguin avec risque d hémolyse et d anémie fœtale V.

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Le dépistage des risques en cours de la grossesse

Le dépistage des risques en cours de la grossesse Le dépistage des risques en cours de la grossesse DR : BOUCHOUCHA-H Le plan du cours Introduction Les risques à dépistés et les moyens de dépistage L échographie : Conclusion -iso-immunisation : GR-RH

Plus en détail

CHU de Caen D E P I S TA G E D E L A T R I S O M I E 2 1 F ΠTA L E. L a b o r a t o i r e d h o r m o n o l o g i e

CHU de Caen D E P I S TA G E D E L A T R I S O M I E 2 1 F Œ TA L E. L a b o r a t o i r e d h o r m o n o l o g i e CHU de Caen Pôle biologie & Pôle Femme - Enfant L a b o r a t o i r e d h o r m o n o l o g i e D E P I S TA G E D E L A T R I S O M I E 2 1 F Œ TA L E Information pour les professionnels de santé impliqués

Plus en détail

PREVENTION DE L ALLO IMMUNISATION ANTI ERYTHROCYTAIRE RHESUS D CHEZ LA FEMME ENCEINTE DE RHESUS NEGATIF

PREVENTION DE L ALLO IMMUNISATION ANTI ERYTHROCYTAIRE RHESUS D CHEZ LA FEMME ENCEINTE DE RHESUS NEGATIF version 3 page 1/10 Référence : RSN/PR/REA.O/009/C Date de 1 ère mise en service : 09/05/2004 Suivi des modifications N Date de la Objet de la modification Faite par : version modification 1 13/12/2006

Plus en détail

Centres pluridisciplinaires de diagnostic prénatal 2010

Centres pluridisciplinaires de diagnostic prénatal 2010 Centres pluridisciplinaires de diagnostic prénatal 2010 Matériel et méthodes Les activités des centres pluridisciplinaires de diagnostic prénatal font l objet d un suivi annuel sur un modèle de dossier

Plus en détail

SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004

SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004 SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004 SOINS PRENATAUX (1) Soins prénataux constituent une avance significative dans les soins obstétricaux. Soins prénataux sont une pratique universelle.

Plus en détail

Dépistage et surveillance échographique des grossesses multiples. Dr Nicole Jastrow Meyer 15 novembre 2012

Dépistage et surveillance échographique des grossesses multiples. Dr Nicole Jastrow Meyer 15 novembre 2012 Dépistage et surveillance échographique des grossesses multiples Dr Nicole Jastrow Meyer 15 novembre 2012 Les grossesses gémellaires sont en augmentation et représentent 2 à 5% de toutes les grossesses

Plus en détail

Anémie hémolytique du nouveau-né

Anémie hémolytique du nouveau-né Anémie hémolytique du nouveau-né né Trois conditions doivent être réunies: présence d un anticorps anti-érythrocytaire dans le plasma maternel passage de cet anticorps dans le sang fœtal par voie placentaire

Plus en détail

CLARTE NUCALE Docteurs Marc TORRENT, stéphane SAULT

CLARTE NUCALE Docteurs Marc TORRENT, stéphane SAULT CLARTE NUCALE Docteurs Marc TORRENT, stéphane SAULT LONGUEUR CRANIO-CAUDALE (LCC, DCC) C est la mesure de la taille du fœtus entre le vertex et les fesses. 1 ) Approche technique : Critères de réussite

Plus en détail

Arbres décisionnels 2010 Page 1 de 9 TABLE DES MATIERES

Arbres décisionnels 2010 Page 1 de 9 TABLE DES MATIERES Arbres décisionnels 2010 Page 1 de 9 TABLE DES MATIERES CLASSIFICATION DES SITUATIONS CLINIQUES UTILISEES DANS TOUS LES ARBRES DECISIONNELS... 2 QUAND REALISER UNE ENQUETE FAMILIALE?... 3 CONDUITE A TENIR

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

MALFORMATIONS, ANOMALIES GÉNIQUES, CHROMOSOMIQUES ET MORPHOLOGIQUES. INDICATIONS DU CONSEIL GÉNÉTIQUE ET DU DIAGNOSTIC PRENATAL.

MALFORMATIONS, ANOMALIES GÉNIQUES, CHROMOSOMIQUES ET MORPHOLOGIQUES. INDICATIONS DU CONSEIL GÉNÉTIQUE ET DU DIAGNOSTIC PRENATAL. MALFORMATIONS, ANOMALIES GÉNIQUES, CHROMOSOMIQUES ET MORPHOLOGIQUES. INDICATIONS DU CONSEIL GÉNÉTIQUE ET DU DIAGNOSTIC PRENATAL. Pr. Habiba CHAABOUNI-BOUHAMED & Dr. Myriam CHAABOUNI Service des maladies

Plus en détail

Dépistage prénatal non-invasif des trisomies 13, 18 et 21

Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Le nouveau test de dépistage prénatal des trisomies sur prise de sang maternel Qu est-ce que le DPNI par Biomnis? Le DPNI est un examen innovant

Plus en détail

JORF n 0013 du 16 janvier 2014 page 748 texte n 11 ARRETE

JORF n 0013 du 16 janvier 2014 page 748 texte n 11 ARRETE Les premières versions de la loi Bioéthique ne plaçaient pas l'échographie obstétricale et fœtale parmi les examens de diagnostic prénatal. De ce fait, la réalisation de ces examens n'était pas soumise

Plus en détail

N 43. Problèmes posés par les maladies génétiques, à propos :

N 43. Problèmes posés par les maladies génétiques, à propos : N 43. Problèmes posés par les maladies génétiques, à propos : d une maladie chromosomique : la trisomie 21 d une maladie génique : la mucoviscidose d une maladie d instabilité : le syndrome de l X fragile

Plus en détail

VALIDATION ANALYTIQUE DU TEST

VALIDATION ANALYTIQUE DU TEST 23 LES RÉSULTATS VALIDATION ANALYTIQUE DU TEST } Cerba vs laboratoire de référence : comparaison externe ü 176 échantillons traités en aveugle (single test) ü Mise en contrôle : 4 (taux de non rendu 2,3%)

Plus en détail

Différents types de chromosomes en Giemsa

Différents types de chromosomes en Giemsa Différents types de chromosomes en Giemsa Marquage Giemsa simple - Comptage d une mitose: 45, 46 ou 47 - Reconnaissance des groupes et certains chromosomes dans les groupes, mais pas dans leur structure,

Plus en détail

Diagnostic prénatal 2012

Diagnostic prénatal 2012 Diagnostic prénatal 2012 Matériel et métho Les activités diagnostic prénatal font l objet d un suivi d activité annuelle sur un modèle dossier fixé par arrêté du ministre la santé. Tous les laboratoires

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Varicelle et grossesse

Varicelle et grossesse CNR Infections Rubéoleuses Materno-fœtales Varicelle et grossesse Atelier Siemens, Mai 2013 L. Grangeot-Keros, Centre National des Infections rubéoleuses materno-fœtales Hôpital Paul Brousse, Villejuif

Plus en détail

PICARDIE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières.

PICARDIE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières. Cette nouvelle édition des fiches régionales relatives à l activité 2013 des centres pluridisciplinaires de diagnostic prénatal (CPDPN), des laboratoires de diagnostic prénatal (DPN) et de l activité 2014

Plus en détail

Comportement reproductif et fécondation. Cours de Première S

Comportement reproductif et fécondation. Cours de Première S Comportement reproductif et fécondation Cours de Première S Hormones et comportement sexuel Hormones et comportement sexuel! Sommation spatio-temporelle des neurones de l hypothalamus! Intègrent des messages

Plus en détail

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Approches génomiques des cancers Exemple des leucémies aiguës Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Leucémies aiguës : prolifération de progéniteurs immatures Leucémies aiguës lymphoblastiques

Plus en détail

AUVERGNE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières.

AUVERGNE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières. Cette nouvelle édition des fiches régionales relatives à l activité 2013 des centres pluridisciplinaires de diagnostic prénatal (CPDPN), des laboratoires de diagnostic prénatal (DPN) et de l activité 2014

Plus en détail

Titre de la leçon? Les mutations

Titre de la leçon? Les mutations Titre de la leçon? Les mutations I. La drépanocytose Globules rouges d un sujet normal Globules rouges d un sujet atteint de drépanocytose Circulation des globules rouges dans les capillaires (sujet atteint

Plus en détail