Plateforme de bioinformatique

Dimension: px
Commencer à balayer dès la page:

Download "Plateforme de bioinformatique"

Transcription

1 Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle

2 Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1% 2005 Arrivées des séquenceurs de nouvelles générations 2008 Projet 1000 Genomes

3 Le séquençage du génome complet Obtenir la séquence des bases des molécules d ADN est au coeur de la biologie moléculaire Aujourd hui, grâce au séquençage de nouvelle généra;on des projets d envergure peuvent être menés par de pe;tes équipes de recherche à une frac;on du coût de ce qu il en coûtait auparavant 2003 génome humain 2012 >10 ans 8 jours $ $

4 Le séquençage Le coût du séquençage a diminué drastiquement Séquençage du génome de James Watson avec la technologie 454 en 2007 : 2 millions de $ Bientôt : 1 génome humain pour 1000$ La diminution des coûts favorise l émergence de nouvelles applications!

5 Une course à l équipement

6 Séquençage de nouvelle généra;on - Sta;s;ques Séquençage de nouvelle génération - Statistiques Données du site omicsmaps.com Le données sont fournies sur un base volontaire par les détenteurs de séquenceurs de nouvelle génération Fort probablement biaisées

7 Les technologies de séquençage Les technologies de séquençage de nouvelle génération https://flxlexblog.wordpress.com/2014/06/11/developments-in-next-generation-sequencing-june-2014-edition/

8 Séquençage par synthèse (Illumina) Séquençage par synthèse (Illumina) HiSeq Taille minimale des séquences: 1*36 bp Taille maximale des séquences: 2*250 bp Quantité de données produites: 18Gb-1Tb Durée d un analyse: 29h-11j Qualité des données: >75 à >85% des bases au-delà de Q30 MiSeq Taille minimale des séquences: 1*25 bp Taille maximale des séquences: 2*300 bp Quantité de données produites: 12Mb - 15Gb Durée d un analyse: 4-65h Qualité des données: >75 à >90% des bases au-delà de Q30

9 Séquencage SMRT (PacBio) Séquençage SMRT (PacBio) PacBio RS II

10 Une Une mul;tude multitude d applica;on d applications... Génome Séquençage de novo Reséquençage de génomes complets et détection des variations : Reséquençage de régions ciblées (exons) Métagénome Diversité des microbes Échantillons hétérogènes Transcriptome (RNA-Seq) Profil d expression des ARNm Variants d épissage Expression propre à certaines allèles Expression des micro ARN Épigénome (ChIP-Seq) Sites actifs dans la transcription Interactions ADN - Protéines Modification des histones Nucléosomes

11 Séquencage du génome complet(pacbio) Le défi des projets u;lisant des données de nouvelle généra;on réside dans la ges;on, l analyse et l interpréta;on des données Il existe des centaines de programmes des;nés à l'analyse de données de nouvelle généra;on Si des plate- formes commerciales existent (ex. Genome quest), la plupart des groupes font appel à des bio- informa;ciens qui privilégient l u;lisa;on d ou;ls indépendants Gb de données 56 Tb de données brutes

12 Pipeline standard de séquencage de nouvelle généra;ons ADN, ARN, nucléo;des Matériel biologique Analyses des donées brutes Conversion du signal et détermination des bases Alignement sur le génome en;er Alignement sur le génome de référence Annota;on Intégration des processus biologique Analyse et intégration d une quantité impressionnante de données est le prochain grand défis

13 Le séquençage d exome

14 Le séquençage du génome

15 Calcul Canada High Performance Compu;ng resources from six partner consor;a Compute servers Colosse, Québec Guillimin, Montréal Image : Compute Calcul Canada

16 Colosse

17 Le séquençage d exome En produc;on sur les serveurs de Colosse (U. Laval) et de Guillemin (McGill) Etape 1 Etape 2 Etape 3 Green boxes: analyze step Blue boxes: annota;on step Red boxes: metrics steps Image : hfps://biowiki.atlassian.net/wiki/display/ps/dnaseq+pipeline

18 L analyse des données de Chip- Seq L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

19 L épigénome Définir épigénétique et épigénomique

20 Programme de régula;on de l expression des gènes Conforma;on des chromosomes + Structure de la chroma;ne + Facteurs de transcrip;ons + Co- Facteurs + Transcrip;on = Programme d expression des gènes

21 Les différentes types d informa;on Rivera and Ren, Cell, 2013.

22 Les facteurs de transcrip;ons Qu est-ce qu un facteur de transcription? Les facteurs de transcriptions sont des protéines qui se lient à des séquences d ADN spécifiques et régulent l expression des gènes

23 Les modifica;ons des histones

24 Le ChIP- Seq ChIP-Seq - Protocol protocole expérimental expérimental 10 7 cells Gel size select bp fragments millions of short reads (101 bp) 101bp read Next-Generation Sequencing base pair fragment

25 L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

26 L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Alignement Détection des régions enrichies Positions des régions (bed) Annotation L analyse des données de ChIP-Seq Séquences alignées (bam) Données Régions brutes (fastq) annotées (tsv) Nettoyage des séquences Données nettoyées (fastq) Alignement Séquences alignées (bam) Analyse des motifs Liste des motifs (pwm) Régions annotées (tsv) Annotation Détection des régions enrichies L analyse des données de ChIP-Seq Positions des régions (bed) Données brutes (fastq) Analyse des Nettoyage motifs des séquences Liste des motifs Données (pwm) nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

27 Friedman p value Intégra;on des données Exp1 Exp1 Exp1 Exp2 Exp2 Exp2 Données d utilisateur Exp3 ENCODExplorer Exp3 Exp3 metagene 30 H3K4me3 enhancers Friedman p value H3K4me1 tss Friedman p value 0 Données d ENCODE Résultats Mean RPM for each position group H3K4me3_0 H3K4me3_25 H3K4me3_50 H3K4me3_75 3H3K4me3_100 Mean RPM for each position 2 1 STAT1 tss 0 Mean RPM for each position group 1.5 STAT1_0 STAT1_25 STAT1_50 STAT1_75 STAT1_ group H3K4me1_0 H3K4me1_25 H3K4me1_50 H3K4me1_75 H3K4me1_

28 Projet Encode Prescott SL, Cell 2015

29

30

31

32

33 PROJET PERSPECTIVE Royaume- Uni Pays- Bas Allemagne Canada (ON, QC) États- Unis (UT) Projet interna;onal échan;llons Séquençage Massivement Parallèle Consomma;on 2015 : 200 coeurs- année = 100 ans de calcul sur un ordinateur personnel moyen

34

35

36 Annota;ons Sources de données: ENCODE, ROADMAP, FANTOM Genome Project NCBI GEO Ou;ls: HaploReg, RegulomeDB, UCSC Genome Browser Galaxy HaploView

37 Projet Encode

38 1000 genomes

39 ICGC Interna;onal Cancer Genome Consor;um 39

40 VEXOR

41 VEXOR

42 VEXOR

43 VEXOR Choose your variants Choose your experiments

44 Visualisa;on des données

45 Visualisa;on des données

46 Intégra;on des données

47 Intégra;on des données Erez Lieberman-Aiden, et al. Science 326, 289 (2009) Duan Z., et al. Nature. May 20;465(7296):363-7 (2010)

48 Médecine Personalisée 48

49 Merci Charles Joly- Beauparlant Astride Louise- Deschenes Fréderic Fournier Audrey Lemaçon Maxime Vallée Adrien Dessemond Equipe Jacques Simard: Penny Soucy Mar;ne Dumont Equipe Steve Bilodeau: Fabien Lamaze Mar;ne Dumont Collaborateurs Lajmi Lakhal Kadher Kadraoui Florent Parent Guillaume Bourque

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Le contrôle qualité sur les données fastq

Le contrôle qualité sur les données fastq Le contrôle qualité sur les données fastq TP detection exome Plan Théorie 1: le format FastQ et l'encodage des qualités Session pratique 1: conversion des qualités (fichier illumina.fastq) Théorie 2: le

Plus en détail

Forma&on à la prise en main du service galaxy.prabi.fr

Forma&on à la prise en main du service galaxy.prabi.fr Forma&on à la prise en main du service galaxy.prabi.fr Vincent Navra,l Dominique Guyot Chris,ne Oger Jean- François Taly Clothilde Deschamps Amandine Fournier 10/03/2015 Plan de la forma&on 14h- 14h30:

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Soumission de données brutes de séquences à SRA. Novembre 2013

Soumission de données brutes de séquences à SRA. Novembre 2013 Soumission de données brutes de séquences à SRA Novembre 2013 1 Objectif Soumettre les données brutes issues du séquençage haut débit aux banques publiques d archivage Données : séquences brutes (reads)

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Bilan enquête de satisfaction 2014

Bilan enquête de satisfaction 2014 Haut du formulaire Biogenouest Génomique Bilan enquête de satisfaction 2014 Bas du formulaire Rennes Villejean (RNV) Caractéristiques de l enquête : Date d ouverture : 10 mars 2015 Date de clôture : 9

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION PRINCIPES DE BASE SUR LES DONNEES ET LE CALCUL HAUTE PERFORMANCE Lois de Gray sur l ingénierie des données 1 : Les calculs scientifiques traitent des volumes considérables

Plus en détail

Ray : un logiciel parallèle performant pour le séquençage

Ray : un logiciel parallèle performant pour le séquençage Ray : un logiciel parallèle performant pour le séquençage Sébastien Boisvert, Université Laval @sebhtml http://boisvert.info 2014-01-31 10h30-10h50 amphithéâtre (1035) du pavillon JA Bombardier, Université

Plus en détail

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Yvan Le Bras, Projet e-biogenouest, CNRS UMR 6074 IRISA-INRIA, Rennes I. Informations globales

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Next Generation Sequencing Bioinformatics - Biology ! Initié en 2008, le programme international ICGC a pour objectif de

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal I. CFTR MASTR TM v2 Dx performance evalua:on study (Mul$plicom)

Plus en détail

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 JM Costa 5èmes Journées de Biologie Praticienne Mazagan, 4-5 Avril 2014 LABORATOIRE CERBA, Laboratoire du réseau DIAGNOSTIC PRÉNATAL

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

INTRODUCTION TO NEXT GENERATION SEQUENCING

INTRODUCTION TO NEXT GENERATION SEQUENCING ECOLE DE BIOINFORMATIQUE INITIATION AU TRAITEMENT DES DONNÉES DE GÉNOMIQUE OBTENUES PAR SÉQUENÇAGE À HAUT DÉBIT 05-10 OCTOBRE 2014 - STATION BIOLOGIQUE - ROSCOFF INTRODUCTION TO NEXT GENERATION SEQUENCING

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Données issues des «Omics» en Biologie et Médecine

Données issues des «Omics» en Biologie et Médecine BIG DATA @ USPC Données issues des «Omics» en Biologie et Médecine Jean-Michel Camadro Pôle «Sciences de la Vie et Santé» USPC 30 Novembre 2015 «Omics» en Biologie et Médecine L univers des «Omics» G T

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil

Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil Responsable scientifique: Johanne Tremblay Responsable technique: Gilles Corbeil Service de biopuces Équipements Affymetrix au CRCHUM Acquisition en 2004 (FCI - Dr Hamet) Système GeneChip (Format cartouche)

Plus en détail

DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE

DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE A working group: GUGGO Several Bioinformatics centre: PCIM Brest ABiMS Roscoff GenOuest Rennes BIPAA Rennes BIRD Nantes IRHS Angers Yvan Le Bras, Cyril Monjeaud,

Plus en détail

STATION 1A Plateforme de séquençage de nouvelle génération

STATION 1A Plateforme de séquençage de nouvelle génération STATION 1A Plateforme de séquençage de nouvelle génération Dr JACQUES SIMARD Le mandat de cette plateforme est d offrir l expertise à la fine pointe de la technologie afin de générer des données de séquence

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Stratégies de séquençage à haut débit en oncologie

Stratégies de séquençage à haut débit en oncologie Master bioinformatique, Université de Rouen Sylvain Mareschal [@etu.univ-rouen.fr] Stratégies de séquençage à haut débit en oncologie Introduction Stratégies de séquençage à haut débit en oncologie Continuité

Plus en détail

Contrôle des connaissances QCM Sujet de l'examen

Contrôle des connaissances QCM Sujet de l'examen Contrôle des connaissances QCM Sujet de l'examen Remarques Durée : 2 heures. Une seule bonne réponse par question. 0,5 point par bonne réponse, 0 point par réponse indéterminée ou fausse. Noter les réponses

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

Conclusions du GT Supra GH relatif au NGS. Bureau de CME 26/08/2015

Conclusions du GT Supra GH relatif au NGS. Bureau de CME 26/08/2015 Conclusions du GT Supra GH relatif au NGS Bureau de CME 26/08/2015 Le contexte : la révolution du NGS Technique de Sanger NGS NGS : Next Generation Sequencing La révolution du NGS : les machines Le moyen/haut

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Réunion France Génomique : Work Package 2.6

Réunion France Génomique : Work Package 2.6 Contents Réunion France Génomique : Work Package 2.6 Réunion ChIP-sep France Génomique 1 Tour de table / présentation / intérêt pour le groupe de travail.................... 1 Analyse de ChIP-seq avec

Plus en détail

Plateforme Transcriptome Végétale

Plateforme Transcriptome Végétale Plateforme Transcriptome Végétale INRA- Unité de Recherche en Génomique Végétale Journée «Plateformes Génopole», 25 juin 2013. Sandrine Balzergue, balzerg@evry.inra.fr Analyse quan8ta8ve de l expression

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris Contexte Rôle des estrogènes dans l expression sexe-dépendante

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Maria Bernard Laurent Cauquil - Sarah Maman Ibouniyamine Nabihoudine 5 Février 2014 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- Galaxy pour

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Présenta)on Biotuesday. Mardi 7 mai 2013

Présenta)on Biotuesday. Mardi 7 mai 2013 Présenta)on Biotuesday Mardi 7 mai 2013 Solutions de Génomique au Service des maladies infectieuses Spin- off de P2i (Université Lyon 1) P2i : Plateforme technologique d innova)on en Infec)ologie Feder/Région

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

La géné'que médicale et les applica'ons du séquençage à haut- débit

La géné'que médicale et les applica'ons du séquençage à haut- débit La géné'que médicale et les applica'ons du séquençage à haut- débit Dr. Marco Belfiore FAMH en énétique Médicale Division de énétique et Infertilité ML-Laboratoires Médicaux / enesupport ARL, 02.10.2014

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Philippe Bardou Sarah Maman Ibouniyamine Nabihoudine Olivier Rué 06 Novembre 2013 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- 1 Galaxy pour

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/

Introduction, présentation de la plateforme South Green. hp://southgreen.cirad.fr/ Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/ SupAgro, Montpellier, 10 février 2014 Le déluge de données NGS Next-generation sequencing Rappel: synthèse de l ADN 5

Plus en détail

Séminaire Aristote - 11 avril 2012 Jedeclare.com d'un Portail Déclara:f à une Plate- forme globale de dématérialisa:on au service d'une profession

Séminaire Aristote - 11 avril 2012 Jedeclare.com d'un Portail Déclara:f à une Plate- forme globale de dématérialisa:on au service d'une profession Séminaire Aristote - 11 avril 2012 Jedeclare.com d'un Portail Déclara:f à une Plate- forme globale de dématérialisa:on au service d'une profession Stéphane Gasch Directeur des études informa:ques du CSOEC

Plus en détail

Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées.

Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées. Point sur la mise en place du «NextGenerationSequencing» NGS sur la plateforme de génétique des tumeurs de Midi-Pyrénées. David GRAND Ingénieur Laboratoire d'anatomo-cytopathologie Institut Universitaire

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique Rapport de stage de deuxième année de DUT Génie Biologique option Bioinformatique Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes

Plus en détail

Le webdéveloppement durable GreenIT à toutes les sauces

Le webdéveloppement durable GreenIT à toutes les sauces Le webdéveloppement durable GreenIT à toutes les sauces Paris Web 14 octobre 2011 Christophe Clouzeau @Christophe_Cl cclouzeau@neoma- interac;ve.com 1987 : Rapport Brundtland Commission des Na=ons unies

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Qu'est-ce que l'épigénétique? Véronique Adoue INSERM U1043 Toulouse-Purpan

Qu'est-ce que l'épigénétique? Véronique Adoue INSERM U1043 Toulouse-Purpan Qu'est-ce que l'épigénétique? Véronique Adoue INSERM U1043 Toulouse-Purpan L épigénétique L épigénétiqueestl étudede mécanismeshéréditairesde l expression des gènes n entraînantpas de changement de la

Plus en détail