Plateforme de bioinformatique

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Plateforme de bioinformatique"

Transcription

1 Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle

2 Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1% 2005 Arrivées des séquenceurs de nouvelles générations 2008 Projet 1000 Genomes

3 Le séquençage du génome complet Obtenir la séquence des bases des molécules d ADN est au coeur de la biologie moléculaire Aujourd hui, grâce au séquençage de nouvelle généra;on des projets d envergure peuvent être menés par de pe;tes équipes de recherche à une frac;on du coût de ce qu il en coûtait auparavant 2003 génome humain 2012 >10 ans 8 jours $ $

4 Le séquençage Le coût du séquençage a diminué drastiquement Séquençage du génome de James Watson avec la technologie 454 en 2007 : 2 millions de $ Bientôt : 1 génome humain pour 1000$ La diminution des coûts favorise l émergence de nouvelles applications!

5 Une course à l équipement

6 Séquençage de nouvelle généra;on - Sta;s;ques Séquençage de nouvelle génération - Statistiques Données du site omicsmaps.com Le données sont fournies sur un base volontaire par les détenteurs de séquenceurs de nouvelle génération Fort probablement biaisées

7 Les technologies de séquençage Les technologies de séquençage de nouvelle génération https://flxlexblog.wordpress.com/2014/06/11/developments-in-next-generation-sequencing-june-2014-edition/

8 Séquençage par synthèse (Illumina) Séquençage par synthèse (Illumina) HiSeq Taille minimale des séquences: 1*36 bp Taille maximale des séquences: 2*250 bp Quantité de données produites: 18Gb-1Tb Durée d un analyse: 29h-11j Qualité des données: >75 à >85% des bases au-delà de Q30 MiSeq Taille minimale des séquences: 1*25 bp Taille maximale des séquences: 2*300 bp Quantité de données produites: 12Mb - 15Gb Durée d un analyse: 4-65h Qualité des données: >75 à >90% des bases au-delà de Q30

9 Séquencage SMRT (PacBio) Séquençage SMRT (PacBio) PacBio RS II

10 Une Une mul;tude multitude d applica;on d applications... Génome Séquençage de novo Reséquençage de génomes complets et détection des variations : Reséquençage de régions ciblées (exons) Métagénome Diversité des microbes Échantillons hétérogènes Transcriptome (RNA-Seq) Profil d expression des ARNm Variants d épissage Expression propre à certaines allèles Expression des micro ARN Épigénome (ChIP-Seq) Sites actifs dans la transcription Interactions ADN - Protéines Modification des histones Nucléosomes

11 Séquencage du génome complet(pacbio) Le défi des projets u;lisant des données de nouvelle généra;on réside dans la ges;on, l analyse et l interpréta;on des données Il existe des centaines de programmes des;nés à l'analyse de données de nouvelle généra;on Si des plate- formes commerciales existent (ex. Genome quest), la plupart des groupes font appel à des bio- informa;ciens qui privilégient l u;lisa;on d ou;ls indépendants Gb de données 56 Tb de données brutes

12 Pipeline standard de séquencage de nouvelle généra;ons ADN, ARN, nucléo;des Matériel biologique Analyses des donées brutes Conversion du signal et détermination des bases Alignement sur le génome en;er Alignement sur le génome de référence Annota;on Intégration des processus biologique Analyse et intégration d une quantité impressionnante de données est le prochain grand défis

13 Le séquençage d exome

14 Le séquençage du génome

15 Calcul Canada High Performance Compu;ng resources from six partner consor;a Compute servers Colosse, Québec Guillimin, Montréal Image : Compute Calcul Canada

16 Colosse

17 Le séquençage d exome En produc;on sur les serveurs de Colosse (U. Laval) et de Guillemin (McGill) Etape 1 Etape 2 Etape 3 Green boxes: analyze step Blue boxes: annota;on step Red boxes: metrics steps Image : hfps://biowiki.atlassian.net/wiki/display/ps/dnaseq+pipeline

18 L analyse des données de Chip- Seq L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

19 L épigénome Définir épigénétique et épigénomique

20 Programme de régula;on de l expression des gènes Conforma;on des chromosomes + Structure de la chroma;ne + Facteurs de transcrip;ons + Co- Facteurs + Transcrip;on = Programme d expression des gènes

21 Les différentes types d informa;on Rivera and Ren, Cell, 2013.

22 Les facteurs de transcrip;ons Qu est-ce qu un facteur de transcription? Les facteurs de transcriptions sont des protéines qui se lient à des séquences d ADN spécifiques et régulent l expression des gènes

23 Les modifica;ons des histones

24 Le ChIP- Seq ChIP-Seq - Protocol protocole expérimental expérimental 10 7 cells Gel size select bp fragments millions of short reads (101 bp) 101bp read Next-Generation Sequencing base pair fragment

25 L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

26 L analyse des données de ChIP-Seq Données brutes (fastq) Nettoyage des séquences Données nettoyées (fastq) Alignement Détection des régions enrichies Positions des régions (bed) Annotation L analyse des données de ChIP-Seq Séquences alignées (bam) Données Régions brutes (fastq) annotées (tsv) Nettoyage des séquences Données nettoyées (fastq) Alignement Séquences alignées (bam) Analyse des motifs Liste des motifs (pwm) Régions annotées (tsv) Annotation Détection des régions enrichies L analyse des données de ChIP-Seq Positions des régions (bed) Données brutes (fastq) Analyse des Nettoyage motifs des séquences Liste des motifs Données (pwm) nettoyées (fastq) Annotation Détection des régions enrichies Positions des régions (bed) Alignement Régions annotées (tsv) Analyse des motifs Séquences alignées (bam) Liste des motifs (pwm)

27 Friedman p value Intégra;on des données Exp1 Exp1 Exp1 Exp2 Exp2 Exp2 Données d utilisateur Exp3 ENCODExplorer Exp3 Exp3 metagene 30 H3K4me3 enhancers Friedman p value H3K4me1 tss Friedman p value 0 Données d ENCODE Résultats Mean RPM for each position group H3K4me3_0 H3K4me3_25 H3K4me3_50 H3K4me3_75 3H3K4me3_100 Mean RPM for each position 2 1 STAT1 tss 0 Mean RPM for each position group 1.5 STAT1_0 STAT1_25 STAT1_50 STAT1_75 STAT1_ group H3K4me1_0 H3K4me1_25 H3K4me1_50 H3K4me1_75 H3K4me1_

28 Projet Encode Prescott SL, Cell 2015

29

30

31

32

33 PROJET PERSPECTIVE Royaume- Uni Pays- Bas Allemagne Canada (ON, QC) États- Unis (UT) Projet interna;onal échan;llons Séquençage Massivement Parallèle Consomma;on 2015 : 200 coeurs- année = 100 ans de calcul sur un ordinateur personnel moyen

34

35

36 Annota;ons Sources de données: ENCODE, ROADMAP, FANTOM Genome Project NCBI GEO Ou;ls: HaploReg, RegulomeDB, UCSC Genome Browser Galaxy HaploView

37 Projet Encode

38 1000 genomes

39 ICGC Interna;onal Cancer Genome Consor;um 39

40 VEXOR

41 VEXOR

42 VEXOR

43 VEXOR Choose your variants Choose your experiments

44 Visualisa;on des données

45 Visualisa;on des données

46 Intégra;on des données

47 Intégra;on des données Erez Lieberman-Aiden, et al. Science 326, 289 (2009) Duan Z., et al. Nature. May 20;465(7296):363-7 (2010)

48 Médecine Personalisée 48

49 Merci Charles Joly- Beauparlant Astride Louise- Deschenes Fréderic Fournier Audrey Lemaçon Maxime Vallée Adrien Dessemond Equipe Jacques Simard: Penny Soucy Mar;ne Dumont Equipe Steve Bilodeau: Fabien Lamaze Mar;ne Dumont Collaborateurs Lajmi Lakhal Kadher Kadraoui Florent Parent Guillaume Bourque

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

http://get.genotoul.fr

http://get.genotoul.fr http://bioinfo.genotoul.fr i f Gestion des données de l HiSeq 2000 Plateformes GenoToul Bioinformatique et GeT-PlaGe Ch. Klopp / G. Salin 07 octobre 2011 gerald.salin@toulouse.inra.fr Contexte NGS Collaboration

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Apport des NGS dans l'amélioration des algues

Apport des NGS dans l'amélioration des algues Des approches originales basées sur le séquençage nouvelle génération Apport des NGS dans l'amélioration des algues Gregory Carrier Laboratoire PBA Physiologie et Biotechnologie des Algues Direction: Gaël

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

Analysing chip- seq data using Galaxy

Analysing chip- seq data using Galaxy Analysing chip- seq data using Galaxy PhD programme 2013 Stéphanie Le Gras Overview Top menu Analyze your data Log in/out HISTORY PANEL keep track of each jobs that have been run Grey: job is waikng to

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Les techniques de séquençage L analyse qualité

Les techniques de séquençage L analyse qualité Les techniques de séquençage L analyse qualité http://bioinfo.genotoul.fr Séquençage : déterminer la succession linéaire des bases A, C, G, T de l ADN, la lecture de cette séquence permet d étudier l information

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Prépara2on à l Agréga2on interne de SV STU Universités Paris Diderot et Paris Est Créteil. Eléments de génie génétique

Prépara2on à l Agréga2on interne de SV STU Universités Paris Diderot et Paris Est Créteil. Eléments de génie génétique Prépara2on à l Agréga2on interne de SV STU Universités Paris Diderot et Paris Est Créteil Eléments de génie génétique 2 octobre 2010 Hervé TOSTIVINT Muséum Na2onal d Histoire Naturelle htos2vi@mnhn.fr

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

TECHNOLOGIES DE SÉQUENÇAGE. M2BI Benjamin Noel

TECHNOLOGIES DE SÉQUENÇAGE. M2BI Benjamin Noel TECHNOLOGIES DE SÉQUENÇAGE M2BI Benjamin Noel bnoel@genoscope.cns.fr http://www.genoscope.cns.fr/rdbioseq 18 OCTOBRE 2016 TECHNOLOGIES DE SÉQUENÇAGE Introduction Différentes technologies de séquençage

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr Plateforme de Recherche de Mutations contact: pfm@genoscope.cns.fr La plateforme recherche de mutations La plateforme mutation: - Gis Institut des maladies rares et IbiSA. - Les instituts thématiques de

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain 1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain Le séquençage du génome humain et après? Comment a-t-il été séquencé? Que nous apprend la séquence? Et après?

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

Soumission de données brutes de séquences à SRA. Novembre 2013

Soumission de données brutes de séquences à SRA. Novembre 2013 Soumission de données brutes de séquences à SRA Novembre 2013 1 Objectif Soumettre les données brutes issues du séquençage haut débit aux banques publiques d archivage Données : séquences brutes (reads)

Plus en détail

Durée : 3 heures Coefficient : 2 REMARQUES IMPORTANTES

Durée : 3 heures Coefficient : 2 REMARQUES IMPORTANTES CONCOURS EXTERNES IT 2014 EPREUVE TECHNIQUE D ADMISSION Durée : 3 heures Coefficient : 2 CONCOURS N 26 Corps : Ingénieur d études BAP : A : Science du vivant Emploi-type : Ingénieur en traitement de données

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Analyse du développement précoce du fruit chez la tomate par une

Analyse du développement précoce du fruit chez la tomate par une Analyse du développement précoce du fruit chez la tomate par une approche RNAseq Mohamed Zouine Laboratoire GBF Le 7 octobre 2011 Le développement précoce du fruit Bourgeon Floral Fleur Absence de Pollinisation

Plus en détail

Méthodologie et faits saillants Enquête québécoise sur la qualité des services de garde éducatifs

Méthodologie et faits saillants Enquête québécoise sur la qualité des services de garde éducatifs Méthodologie et faits saillants Enquête québécoise sur la qualité des services de garde éducatifs CADRISQ 2 juin 2004-23 septembre 2005 Plan de la présentation Intro : contexte et objectifs Méthodologie

Plus en détail

Le contrôle qualité sur les données fastq

Le contrôle qualité sur les données fastq Le contrôle qualité sur les données fastq TP detection exome Plan Théorie 1: le format FastQ et l'encodage des qualités Session pratique 1: conversion des qualités (fichier illumina.fastq) Théorie 2: le

Plus en détail

Services en génomique Séquençage Génotypage Bioinformatique R&D

Services en génomique Séquençage Génotypage Bioinformatique R&D Services en génomique Séquençage Génotypage Bioinformatique R&D Catalogue Sommaire Séquençage Séquençage Sanger 6 Identification de micro-organismes 8 Séquençagedegénomes 10 Séquençage de transcriptomes

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Mise en place d outils de biologie moléculaire Céline Martinez, Pierre

Plus en détail

La vision. Rapport annuel 2008-2009, Faculté de médecine, Université Laval.

La vision. Rapport annuel 2008-2009, Faculté de médecine, Université Laval. 27 mai 2010, Douxième journée annuelle de la recherche Pavillon Ferdinand-Vandry, Faculté de médecine, Université Laval 10 minutes, 14h30-14h45, Salle 1811 Ray: assemblage parallèle de génomes à partir

Plus en détail

MODULE 4 Introduction à IGV

MODULE 4 Introduction à IGV MODULE 4 Introduction à IGV Jean-Baptiste Rivière jean-baptiste.riviere@u-bourgogne.fr 22/01/2014 Integrative Genomics Viewer (IGV) Logiciel de visualisation de données génomiques (NGS, microarray, annotations

Plus en détail

Formation INSERM : Les Biopuces. Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie

Formation INSERM : Les Biopuces. Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie Formation INSERM : Les Biopuces Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie ENS - 9 février 2004 Laboratoire de Génétique Moléculaire - CNRS Laboratoire de Biologie Moléculaire du

Plus en détail

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes.

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Epigénétique Introduction «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Deux périodes successives récentes dans l étude des génomes

Plus en détail

Plan. Rappel : vision classique de la régulation. Nouvelles possibilités à l ère postgénomique

Plan. Rappel : vision classique de la régulation. Nouvelles possibilités à l ère postgénomique Régulation de l expression des gènes O. Lecompte Laboratoire de Bioinformatique et Génomique Intégratives - IGBMC odile.lecompte@igbmc. fr Plan Rappel : vision classique de la régulation Nouvelles possibilités

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud FORMATION RADSEQ SOUS GALAXY Intervenant(s) : Yvan Le Bras, Cyril Monjeaud E-BIOGENOUEST Programme fédérateur Biogenouest co-financé par les Régions Bretagne et Pays de la Loire 24 mois Lancé depuis Mai

Plus en détail

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Si les conditions physiques telles que l âge, les antécédents, mais aussi des facteurs sociaux, psychiques et culturels influencent

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome Mercredi 9 octobre ABECASSIS Anna L2 GM Pr Beroud 16 pages Support de l'information génétique ; structure et fonction du génome Plan A. Des gènes aux protéines I. Structure de l'adn II. Structure des gènes

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Analyse des données 1: erreurs expérimentales et courbe normale

Analyse des données 1: erreurs expérimentales et courbe normale Analyse des données 1: erreurs expérimentales et courbe normale 1 Incertitude vs. erreur Une mesure expérimentale comporte toujours deux parties: la valeur vraie de la grandeur mesurée et l'erreur sur

Plus en détail

Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes

Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes Marie Petitjean Directeur de thèse : Didier Hocquet Laboratoire d'hygiène Hospitalière - CHRU Besançon Laboratoire Chrono-Environnement

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Forma&on à la prise en main du service galaxy.prabi.fr

Forma&on à la prise en main du service galaxy.prabi.fr Forma&on à la prise en main du service galaxy.prabi.fr Vincent Navra,l Dominique Guyot Chris,ne Oger Jean- François Taly Clothilde Deschamps Amandine Fournier 10/03/2015 Plan de la forma&on 14h- 14h30:

Plus en détail

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine Cours de Biologie Moléculaire L2S3 Structure de l ADN Organisation des génomes 2ème cours (1h30) Les propriétés physicochimiques de l ADN Structure des génomes La chromatine L ADN est chargé négativement

Plus en détail

Application du NGS. Dre. Heidi Fodstad, PhD FAMH en génétique médicale

Application du NGS. Dre. Heidi Fodstad, PhD FAMH en génétique médicale Application du NGS en génétique clinique Dre. Heidi Fodstad, PhD FAMH en génétique médicale Introduction Plan de la présentation NGS en génétique constitutionnelle Recommandations et bonne pratiques Les

Plus en détail

Décrypter les données omiques : importance du contrôle qualité. Application au cancer de l ovaire

Décrypter les données omiques : importance du contrôle qualité. Application au cancer de l ovaire Décrypter les données omiques : importance du contrôle qualité. Application au cancer de l ovaire Laure Sambourg To cite this version: Laure Sambourg. Décrypter les données omiques : importance du contrôle

Plus en détail

La génomique, du laboratoire de recherche aux applica7ons médicales. philippe.glaser@pasteur.fr

La génomique, du laboratoire de recherche aux applica7ons médicales. philippe.glaser@pasteur.fr La génomique, du laboratoire de recherche aux applica7ons médicales. philippe.glaser@pasteur.fr Plan de la présenta4on! De la géné4que à la génomique : les bases! L évolu4on des méthodes de séquençage

Plus en détail

Ray : un logiciel parallèle performant pour le séquençage

Ray : un logiciel parallèle performant pour le séquençage Ray : un logiciel parallèle performant pour le séquençage Sébastien Boisvert, Université Laval @sebhtml http://boisvert.info 2014-01-31 10h30-10h50 amphithéâtre (1035) du pavillon JA Bombardier, Université

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Génétique et épigénétique

Génétique et épigénétique Le génome : avancées scientifiques et thérapeutiques et conséquences sociales The genome: scientific and therapeutic developments and social consequences 2002 Éditions scientifiques et médicales Elsevier

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Validation d une méthode performante de dosage des steviols glycosides de Stevia Rebaudiana

Validation d une méthode performante de dosage des steviols glycosides de Stevia Rebaudiana Validation d une méthode performante de dosage des steviols glycosides de Stevia Rebaudiana J.M. Roussel, Consultant, Aix-en-Pce Prof. Dr. Gertrud Morlock, Chair of Food Science, JLU Giessen S. Meyer,

Plus en détail

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions intégration Populations Organismes Tissus, organes Relations inter-espèces, Équilibres écologiques Développement,

Plus en détail

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité Développement de Techniques et Analyse Moléculaire de la Biodiversité HyDRIMZ DENITEXPRESS a Influence de faibles concentrations en nanoparticules de CuO sur l expression des gènes de la dénitrification

Plus en détail

NOUVEAU CENTRE HOSPITALIER DE L UNIVERSITÉ DE MONTRÉAL MISE EN PLACE DE LA MAINTENANCE ET DE L EXPLOITATION

NOUVEAU CENTRE HOSPITALIER DE L UNIVERSITÉ DE MONTRÉAL MISE EN PLACE DE LA MAINTENANCE ET DE L EXPLOITATION NOUVEAU CENTRE HOSPITALIER DE L UNIVERSITÉ DE MONTRÉAL MISE EN PLACE DE LA MAINTENANCE ET DE L EXPLOITATION 2 11 juin 2014 54 èmes journées IHF Ges3on patrimoniale Rajko STOKIC SOMMAIRE I - Contexte 1.1

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE

DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE DOCKER & A PRIVATE CLOUD: A HAPPY MARRIAGE A working group: GUGGO Several Bioinformatics centre: PCIM Brest ABiMS Roscoff GenOuest Rennes BIPAA Rennes BIRD Nantes IRHS Angers Yvan Le Bras, Cyril Monjeaud,

Plus en détail

On en vient maintenant au test lui-même.

On en vient maintenant au test lui-même. On en vient maintenant au test lui-même. 6 Avant d envisager la technologie elle-même, quelques mots sur le diagnostic prénatal non invasif qui est réalisé historiquement à partir du sang maternel. On

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

APPEL CONJOINT DE LETTRES D INTENTION DU CONSEIL

APPEL CONJOINT DE LETTRES D INTENTION DU CONSEIL APPEL CONJOINT DE LETTRES D INTENTION DU CONSEIL NATIONAL DE RECHERCHES DE L ITALIE ET DE GÉNOME CANADA POUR DES PROJETS À GRANDE ÉCHELLE DE GÉNOMIQUE EN SANTÉ HUMAINE Novembre 2008 Table des matières

Plus en détail

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes Présentation Bioinformatique: analyse des génomes Céline Brochier-Armanet (Laurent Duret) Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr

Plus en détail

Voyage Au Cœur Du Génome

Voyage Au Cœur Du Génome Voyage Au Cœur Du Génome Jean-Philippe.Vert@ensmp.fr ENSMP - CG - Bioinformatique 17 mars 2005 Une brève histoire 1866 : Lois de l hérédité (Mendel) 1909 : Morgan et les drosophilistes 1944 : L ADN est

Plus en détail

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ

Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Control qualité des données brutes, ne2oyage des données Manipula7on des fichiers FASTQ Stéphanie Le Gras DU Dijon Objec7fs Comprendre ce que sont les données brutes de séquençage haut débit (type Illumina)

Plus en détail

La génomique fonctionnelle

La génomique fonctionnelle Marc Noël, B.Sc. Agr. Chargé de comptes principal Merial Canada Inc. Journée bovine de l Estrie 2006 25 novembre 2006 All animals are equal but some animals are more equal than others. George Orwell -

Plus en détail

ET AU-DELÀ Enrichissement de cible pour le NGS HaloPlex Sondes SureFISH Puces à ADN CGH+SNP SurePrint

ET AU-DELÀ Enrichissement de cible pour le NGS HaloPlex Sondes SureFISH Puces à ADN CGH+SNP SurePrint DES PUCES À ADN ET AU-DELÀ Enrichissement de cible pour le NGS HaloPlex Sondes SureFISH Puces à ADN CGH+SNP SurePrint UNE COMPAGNIE, DES APPLICATIONS ILLIMITÉES LEADER DE L'ANALYSE MOLÉCULAIRE ET DE LA

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Les bases de données biologiques Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Sommaire 1. Introduction 2. Le système Entrez 2.1. Description du système Entrez 2.2.

Plus en détail

Bilan enquête de satisfaction 2014

Bilan enquête de satisfaction 2014 Haut du formulaire Biogenouest Génomique Bilan enquête de satisfaction 2014 Bas du formulaire Rennes Villejean (RNV) Caractéristiques de l enquête : Date d ouverture : 10 mars 2015 Date de clôture : 9

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

À LA DÉCOUVERTE DE LA RECHERCHE

À LA DÉCOUVERTE DE LA RECHERCHE À LA DÉCOUVERTE DE LA RECHERCHE (une partie de) la bio-info. Pierre Peterlongo Avril 2015 Bioinfo: quelques repères Découverte Recherche - Mars 2015 2 Découverte Recherche - Mars 2015 3 BioInfo: Quand?

Plus en détail