Structures des ARN.

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Structures des ARN."

Transcription

1 Structures des RN Hélène TOZET

2 Structure secondaire de l RN ppariements : Watson-rick :, Wobble :,,... Pseudo-nœuds Triplets de bases

3 Exemple : RN de transfert (lanine E. coli) Structure primaire ggggcuauagcucagcugggagagcgccugcuu ugcacgcaggaggucugcgguucgaucccgcauagcuccacca Structure secondaire

4 Développement d un logiciel de comparaison de molécules d RN

5 omment déterminer la structure d une molécule? structure primaire séquençage structure secondaire et tertiaire de manière exacte, expérimentalement ristallographie par diffraction à rayons X Résonance magnétique nucléaire (RMN) Long, difficile et coûteux par extrapolation, à partir de la structure primaire : lgorithmes de prédiction de structures secondaires Méthode 1 : approche thermodynamique Méthode 2 : approche comparative

6 pproche thermodynamique 1. À chaque configuration de la molécule correspond une quantité d énergie libre. 2. La configuration la plus stable est celle qui minimise l énergie libre. 3. La molécule, en se repliant, adopte la configuration la plus stable. On s est ramené à un problème combinatoire : dont l énergie est optimale. trouver la structure Simplification du modèle : la structure secondaire exclut les pseudonœuds et les triplets

7 Modèle de départ Nussinov L énergie de la molécule est la somme des énergies de chaque paire de bases. α(r i, r j ) : énergie libre de l appariement (r i, r j ) α(r i, r j ) < 0 α(r i, r j ) = 0 α(r i, r j ) = + si j i > 3 et r i r j si i = j sinon énergie libre de la structure secondaire S E(S) = (r i,r j ) S α(r i, r j )

8 Exemple Fonction d énergie : α(, ) = 2 α(, ) = 3 α(, ) = 1 La structure a pour énergie 15 lgorithme: Programmation dynamique

9 Etape 1: décomposition du problème en instances plus petites i i+1 i+2 j 1 j S i,j : structure secondaire optimale pour la sous-séquence i... j Trois possibilités pour r j : 1. r j ne s apparie pas avec la sous-chaîne r i... r j 1 : S i,j = S i,j 1 {r j, r j } E(S i,j ) = E(S i,j 1 ) 2. r j s apparie avec r i : S i,j = S i+1,j 1 {r i, r j } E(S i,j ) = E(S i+1,j 1 ) + α(r i, r j ) 3. r j s apparie avec r k pour un i < k < j : S i,j = S i,k 1 {r k, r j } S k+i,j 1 E(S i,j ) = min{e(s i,k 1 ) + α(r k, r j ) + E(S k+1,j 1 ), k ]i, j[} E(S i,j ) = min cas 1, 2 et 3

10 Etape 2 : construction de la table de programmation dynamique ne table T, de dimension 2: T (i, j) := E(S i,j ) T (i, j) = min T (i, j 1) T (i + 1, j 1) + α(r i, r j ) min{t (i, k 1) + α(r k, r j ) + T (k + 1, j 1)} ne table S qui stocke le devenir de r j omplexité haque case de la table nécessite O(n) calculs. omplexité globale en O(n 3 ).

11 Exemple

12 Etape 3: construction de la structure secondaire optimale On remonte la table de programmation dynamique S.

13 Mfold Zuker, Turner et al. Paramètres d énergie liaison hydrogène énergie d empilement Motifs structuraux a. épingle à cheveux (hairpin) b. boucle interne (internal loop) c. renflement (bulge loop) d. jonction e. tige (duplex) f. Exclus : pseudo-nœud (pseudoknot)

14 Limites de l approche thermodynamique Pertinence de la définition de la fonction d énergie. Solution : transformer l algorithme pour obtenir un ensemble de configurations sous-optimales Les hypothèses biologiques ne sont pas toutes valides : Il existe des molécules d RN qui se replient en formant des nœuds, ou dans lesquelles un appariement regroupent 3 nucléotides. Solution : complexifier les algorithmes Pas de prise en compte d interactions avec des molécules voisines. Pas de prise en compte du sens de la synthétisation de l RN.

15 Exemple : RN de transfert

16 ee

17 Haemophilus influenza RNase P RN sous-unité RN de RNase P (Hemophilus influenza) Mfold : 21 structures sous-optimales

18 pproche comparative Lors de l évolution, la structure secondaire est mieux préservée que la structure primaire. Des séquences primaires proches, mais différentes, ont la même structure secondaire. pplication Travailler non pas avec une séquence, mais avec deux, ou une famille de séquences.

19 Repliement inverse On cherche une séquence similaire ( homologue ) pour laquelle la structure secondaire est connue. succession d hélices, boucles... On distribue les motifs le long de la séquence de structure inconnue respecter les appariements favoriser les insertions et les déletions hors des hélices Exemple : R (. Notre-Dame, algos génétiques)

20 Et si on ne connait pas la structure... mais on dipose d une famille de séquences homologues? hangement de base compensatoire: Quand une base impliquée dans un appariement mute, la base complémentaire mute également, pour préserver la paire, et donc, la structure secondaire.

21 Étape 1 : construction d un alignement multiple Étape 2 : détection des positions corrélées présomption d appariement

22 Étape 1 : construction d un alignement multiple Étape 2 : détection des positions corrélées présomption d appariement

23 omment mesurer la corrélation entre deux colonnes? I(i, j) : information mutuelle des colonnes i et j de l alignement multiple I(i, j) = f xi,x j log 2 f xi,x j f xi f xj f xi fréquence de la base x i dans la colonne i f xi f xj fréquence du couple x i x j dans les colonnes i et j I(i, j) varie entre 0 et 2 bits. Quantité d information révélée par la colonne j, la colonne i étant connue. M ij est maximale quand i et j individuellement paraissent aléatoires (f i = f j = 0.25) et que i et j sont parfaitement corrélées.

24 Exemples I = log 2(4/3) 2 + log 2(4/3) 4 + log 2(4) 4 I = log 2(4) 4 + log 2(4) 4 + log 2(4) 4 + log 2(4) 4 = 2 La corrélation entre les deux colonnes est maximale.

25 TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTTTT--- TTTTT-TTTTTTTT.TTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTT-TTTTT-TTTTTTT TTT-TTTTTTTTTTTT TTT-TTTTT-TTTTTTT TTTTTTTTTTTTTT--- TTT-TTTTT-TTTTTTT TTTT-TTTTTTTTTTTT TTTT-TTTTTTT-TTTTTTT TTT-TTTTTTTTTT TTT-TTTTTTTTTTT TTT--TTTTTTTTTTT RNt

26 TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTTTT--- TTTTT-TTTTTTTT.TTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTT-TTTTT-TTTTTTT TTT-TTTTTTTTTTTT TTT-TTTTT-TTTTTTT TTTTTTTTTTTTTT--- TTT-TTTTT-TTTTTTT TTTT-TTTTTTTTTTTT TTTT-TTTTTTT-TTTTTTT TTT-TTTTTTTTTT TTT-TTTTTTTTTTT TTT--TTTTTTTTTTT RNt

27 TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTTT--- TTTT-TTTTTTTTTTTTT--- TTTTT-TTTTTTTT.TTT--- TTTT-TTTTTTTTTTT TTTT-TTTTTTTTTTT TTT-TTTTT-TTTTTTT TTT-TTTTTTTTTTTT TTT-TTTTT-TTTTTTT TTTTTTTTTTTTTT--- TTT-TTTTT-TTTTTTT TTTT-TTTTTTTTTTTT TTTT-TTTTTTT-TTTTTTT TTT-TTTTTTTTTT TTT-TTTTTTTTTTT TTT--TTTTTTTTTTT RNt

28 Vérification... Structure secondaire de l RNt

29 omparaison de molécules d RN omparaison des séquences lgorithmes sur les mots lignement, recherche de motifs, etc. omparaison des structures secondaires lgorithmes sur les arbres lignement, recherche de motifs, etc. La comparaison des structures secondaires prend en compte plus d information, mais est moins courante : peu de structures sont connues complexité des algorithmes

30 Représentation arborescente pour la structure secondaire de l RN de transfert : 2 bases appariées (hélice) : base libre (boucle)

Introduction à la bio-informatique

Introduction à la bio-informatique Introduction à la bio-informatique Hélène Touzet Équipe Bioinfo LIFL USTL www.lifl.fr/~touzet/m1/ A C G G T G C C T A ADN A U C C U A G Transcription ARN messager Traduction prote ine fonction de la prote

Plus en détail

Algorithmes de comparaison de séquences

Algorithmes de comparaison de séquences Algorithmes de comparaison de séquences Hélène Touzet Équipe Bioinfo LIFL USTL Master recherche informatique www.lifl.fr/~touzet/masterrecherche.html Pourquoi comparer des séquences? Puisque c est la structure

Plus en détail

Alignements de séquences

Alignements de séquences de séquences Problématique Matrices de points Distance d édition + calcul d un alignement optimal Qu est-ce qu une distance Méthode naïve: énumération de tous les alignements possibles Programmation dynamique

Plus en détail

Algorithmes pour la comparaison d ARN : distance d édition entre arbres. Serge Dulucq (LABRI)

Algorithmes pour la comparaison d ARN : distance d édition entre arbres. Serge Dulucq (LABRI) Algorithmes pour la comparaison d ARN : distance d édition entre arbres Serge Dulucq (LABRI) Hélène Touzet (LIFL) : bases appariées (tige) : base libre (boucle) Représentation arborescente pour la structure

Plus en détail

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Cours 1 Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Hélène Touzet La cellule 2 Que trouve-t-on dans une cellule? 30% ions,... 4% phospolipides

Plus en détail

Corrigé de l Examen d optimisation combinatoire, M1 MIAGE Classique Durée 2h - le 11 avril Aucun document autorisé

Corrigé de l Examen d optimisation combinatoire, M1 MIAGE Classique Durée 2h - le 11 avril Aucun document autorisé 1 Corrigé de l Examen d optimisation combinatoire, M1 MIAGE Classique Durée 2h - le 11 avril 2008 -Aucun document autorisé Exercice 1 Question de cours 1 Qu est-ce qu une relaxation d un problème d optimisation,

Plus en détail

Méthodes de théorie des jeux pour la prédiction de la structure 3D de l ARN

Méthodes de théorie des jeux pour la prédiction de la structure 3D de l ARN Méthodes de théorie des jeux pour la prédiction de la structure 3D de l RN lexis Lamiable To cite this version: lexis Lamiable. Méthodes de théorie des jeux pour la prédiction de la structure 3D de l RN.

Plus en détail

GIPAD GS2 Recherche Opérationnelle Correction devoir final APP2

GIPAD GS2 Recherche Opérationnelle Correction devoir final APP2 GIPAD GS2 Recherche Opérationnelle Correction devoir final APP2 2 décembre 2009 1 Modèles de packing Problème 1 Une grille de calcul est composée d ordinateurs interconnectés sur lesquelles peuvent s exécuter

Plus en détail

Algorithmes sur les arbres et les graphes en bioinformatique

Algorithmes sur les arbres et les graphes en bioinformatique M2 - IAD Algorithmes sur les arbres et les graphes en bioinformatique Reconstruction des arbres phylogénétiques Quelles sont les relations génétiques entre espèces? Idée : comparer des caractères spécifiques

Plus en détail

IV - Optimisation en espace de l alignement de séquences. S de taille m, T de taille n. Valeur d un alignement global optimal: V (S, T )

IV - Optimisation en espace de l alignement de séquences. S de taille m, T de taille n. Valeur d un alignement global optimal: V (S, T ) IV - Optimisation en espace de l alignement de séquences S de taille m, T de taille n. Valeur d un alignement global optimal: V (S, T ) Algorithme classique pour l alignement global: Espace O(mn) Impossibilité

Plus en détail

Chapitre 5 Structures tridimensionnelles des protéines

Chapitre 5 Structures tridimensionnelles des protéines hapitre 5 Structures tridimensionnelles des protéines 1.Structure secondaire A. Le groupement peptidique B. Structures en hélice. Les structures β Les propriétés d'une protéine dépendent essentiellement

Plus en détail

«Distance-Géometrie» Structure secondaire. 3D préliminaire Liaisons hydrogène Angles dihédraux. Dépôt banque

«Distance-Géometrie» Structure secondaire. 3D préliminaire Liaisons hydrogène Angles dihédraux. Dépôt banque «Distance-Géometrie» Acquisitions spectrales Attribution des systèmes de spins Attribution séquentielle Collection et calibrage de effets noe Calcul des distances limites Calcul de structure Echange des

Plus en détail

Cours 2: Récursivité et programmation dynamique

Cours 2: Récursivité et programmation dynamique Cours 2: Récursivité et programmation dynamique Récursivité, mémoïsation, programmation dynamique Distance minimale, diviser pour régner Sous-suites croissantes, mémoïsation Chemin dans un DAG, programmation

Plus en détail

Zone où les hélices sont très courtes

Zone où les hélices sont très courtes Structures secondaires des protéines La structure du squelette de la protéine est déterminée par ses 2 angles φ et ψ pour chaque acide aminé. En raison de l encombrement stérique tous les angles ne sont

Plus en détail

Partie n 2 : Chapitre n 2 : ADN, molécule informative Cours chapitre n 2 : L ADN, molécule informative de tous les organismes vivants

Partie n 2 : Chapitre n 2 : ADN, molécule informative Cours chapitre n 2 : L ADN, molécule informative de tous les organismes vivants Partie n 2 : hapitre n 2 : DN, molécule informative ours chapitre n 2 : L DN, molécule informative de tous les organismes vivants Nature et variabilité de la molécule d DN : 1 L DN est une molécule codée

Plus en détail

Génération aléatoire. Origine de la génération aléatoire. Pourquoi générer des objets aléatoires. Nicolas Hanusse Chargé de Recherche CNRS - LaBRI

Génération aléatoire. Origine de la génération aléatoire. Pourquoi générer des objets aléatoires. Nicolas Hanusse Chargé de Recherche CNRS - LaBRI Génération aléatoire Nicolas Hanusse Chargé de Recherche CNRS - LaBRI Origine de la génération aléatoire Wilf (960-70): simulation des trajectoires de particules à l intérieur de réacteurs nucléaires;

Plus en détail

Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines

Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines Guillaume Collet INRA, unité Mathématique, Informatique et Génome 26 juin 2006 Guillaume Collet (MIG)

Plus en détail

Exploration en situation d adversité

Exploration en situation d adversité Exploration en situation d adversité Igor Stéphan UFR Sciences Angers 5-6 Igor Stéphan Jeux / 49 Exploration en situation d adversité Jeux à deux joueurs (Le joueur existentiel,, que l on souhaite faire

Plus en détail

Aujourd hui. Rappels et compléments. Chapitre 5 : méthodes et algorithmes de tri. Lecture avec scanf()

Aujourd hui. Rappels et compléments. Chapitre 5 : méthodes et algorithmes de tri. Lecture avec scanf() Aujourd hui Rappels et compléments Lecture avec scanf() Chapitre 5 : méthodes et algorithmes de tri 1 Rappels et compléments Lecture avec scanf() (cf p. 93-96 polycopié langage C) 2 Le flux d entrée stdin

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

On peut traduire directement cette définition en un algorithme récursif :

On peut traduire directement cette définition en un algorithme récursif : CHAPITRE III Programmation Dynamique III.1 Exemple introductif : la suite de Fibonacci La suite de Fibonacci est la suite d entier (u n ) n 0 définie récursivement par : u 0 = 0 u 1 = 1 u n = u n 1 + u

Plus en détail

cours 1 - Mécanique de l ADN

cours 1 - Mécanique de l ADN cours 1 - Mécanique de l ADN les protéines qui se lient à l ADN exercent des forces et déforment l hélice TATA binding protein ADN comment l ADN répond-il à une traction/torsion? 1 Manipuler une molécule

Plus en détail

Méthodes Heuristiques

Méthodes Heuristiques Méthodes Heuristiques ou comment résoudre efficacement les problèmes difficiles. Dr, 2010 Comment résoudre un problème NP-difficile? On a vu en optimisation combinatoire plusieurs classes de problèmes

Plus en détail

EXPRESSION DES GÈNES DE MIARN

EXPRESSION DES GÈNES DE MIARN EXPRESSION DES GÈNES DE MIARN Notre génome contient un nombre important de gènes de miarn (Griffiths-Jones et al. 2006; Landgraf et al. 2007), dont les produits matures interfèrent avec la traduction des

Plus en détail

Activité 1 : STRUCTURE ET FONCTION DE LA PROTEINE CODEE PAR UN GENE HOMEOTIQUE

Activité 1 : STRUCTURE ET FONCTION DE LA PROTEINE CODEE PAR UN GENE HOMEOTIQUE TP6 : La diversification des êtres vivants avec modification des génomes Mise en situation et recherche à mener www.larecherche.fr/content/recherche/article?id=25131 Montrer à partir des différents documents,

Plus en détail

Recherche de motifs ATTENTION!

Recherche de motifs ATTENTION! Recherche de motifs Épreuve pratique d algorithmique et de programmation Concours commun des écoles normales supérieures Durée de l épreuve: 3 heures 30 minutes Juin/Juillet 2010 ATTENTION! N oubliez en

Plus en détail

Chapitre 6 Structures tridimensionnelles des protéines

Chapitre 6 Structures tridimensionnelles des protéines Chapitre 6 Structures tridimensionnelles des protéines Les protéines fibreuses - La kératine α - Une hélice d'hélices - Le collagène - Un câble à trois hélices Les protéines globulaires - Interprétation

Plus en détail

Projet 1: Arbres couvrants minimaux par l algorithme de Kruskal

Projet 1: Arbres couvrants minimaux par l algorithme de Kruskal Rappels Ecole Normale Supérieure Algorithmique et programmation 2008 2009 Projet 1: Arbres couvrants minimaux par l algorithme de Kruskal Soit G = (S, A, w) un graphe connexe, pondéré, non orienté de sommets

Plus en détail

Introduction. Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot)

Introduction. Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Introduction Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Outil essentiel pour : Signatures protéiques Homologie avec une famille de protéines particulière Structure secondaire

Plus en détail

Biologie moléculaire en 30 fiches

Biologie moléculaire en 30 fiches Philippe LETTA Biologie moléculaire en 0 fiches e édition Dunod, Paris, 00, 0 ISB --0-0- Table des matières Partie Structure Fiche onstituants Fiche Structure Fiche rganisation 0 Fiche ompaction Fiche

Plus en détail

La structure des protéines

La structure des protéines La structure des protéines Hervé Darbon herve.darbon@afmb.univ mrs.fr http://www.afmb.univ mrs.fr/ Supports de cours: http://master.afmb.univ mrs.fr/ f/ Rubrique: «supports de cours/bio71 Les structures

Plus en détail

Spectre RMN du proton

Spectre RMN du proton Spectre RMN du proton 1. Principe de la spectroscopie RMN La spectroscopie de résonance magnétique nucléaire (RMN) permet d identifier les atomes d hydrogène d une molécule et informe sur leur environnement

Plus en détail

Arbre des suffixes. Recherche de motifs

Arbre des suffixes. Recherche de motifs rbre des suffixes et Recherche de motifs rbre des suffixes Structure de données qui permet de représenter exactement tous les facteurs d un texte Une feuille de l arbre = un suffixe du mot un facteur =

Plus en détail

Alignement Multiple de séquences

Alignement Multiple de séquences Alignement Multiple de séquences Introduction Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Outil essentiel pour : Signatures protéiques Homologie avec une famille de protéines

Plus en détail

STRUCTURE DES PROTEINES

STRUCTURE DES PROTEINES STRUCTURE DES PRTEIES STRUCTURE DES PRTEIES!Les protéines sont formées à partir d un répertoire (alphabet) de 20 acides α-aminés naturels (configuration L) Chaine Latérale Amine primaire R 2 carbone α

Plus en détail

Cours de recherche opérationnelle I

Cours de recherche opérationnelle I Cours de recherche opérationnelle I Nadia Brauner Nadia.Brauner@imag.fr Programmation dynamique Programmation dynamique Plan 1 Jeux introductifs 2 Principe de sous-optimalité 3 Programmation dynamique

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

Unité d Enseignement RCP101 : Recherche Opérationnelle et Aide à la Décision. Cours 2 Chemins de longueur optimale

Unité d Enseignement RCP101 : Recherche Opérationnelle et Aide à la Décision. Cours 2 Chemins de longueur optimale Unité d Enseignement RCP101 : Recherche Opérationnelle et Aide à la Décision Cours 2 Chemins de longueur optimale Conservatoire National des Arts et Métiers 2 UE RCP101 Recherche Opérationnelle et Aide

Plus en détail

MÉCANIQUE QUANTIQUE CLONAGE D UN QUBIT RAPPELS INTRODUCTION À L INFORMATION QUANTIQUE. CNOT 0i 0i! 0i 0i CNOT 1i 0i! 1i 1i.

MÉCANIQUE QUANTIQUE CLONAGE D UN QUBIT RAPPELS INTRODUCTION À L INFORMATION QUANTIQUE. CNOT 0i 0i! 0i 0i CNOT 1i 0i! 1i 1i. INTRODUCTION À L INFORMATION QUANTIQUE MÉCANIQUE QUANTIQUE Notion de qubit Etats séparables, états intriqués Argument EPR : La mécanique quantique est elle complète? Portes quantiques et théorème de non-clonage

Plus en détail

LA TRADUCTION 1. 2 e position. Tyr Tyr STOP STOP His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu Tableau 1 : Le code génétique.

LA TRADUCTION 1. 2 e position. Tyr Tyr STOP STOP His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu Tableau 1 : Le code génétique. L TRDTION 1 La traduction est le mécanisme qui permet de passer de l alphabet nucléique (, T,, ) à l alphabet protéique que constituent les acides aminés. est un processus qui fait intervenir plus d une

Plus en détail

La programation dynamique

La programation dynamique La programation dynamique François Lemieux UQAC François Lemieux (UQAC) La programation dynamique 1 / 51 La programmation dynamique 1 Le compromis espace/temps 2 Principes de la programmation dynamique

Plus en détail

Thème : OBSERVER Ondes et matière (Sous thème : Analyse spectrale)

Thème : OBSERVER Ondes et matière (Sous thème : Analyse spectrale) Thème : OBSERVER Ondes et matière (Sous thème : Analyse spectrale) Type de ressources : Exemple d évaluation en situation d apprentissage, typologies d exercices Interdisciplinarité (himie-sciences de

Plus en détail

Cours 8: Quelques algorithmes en bioinformatique

Cours 8: Quelques algorithmes en bioinformatique Cours 8: Quelques algorithmes en bioinformatique Alignement de 2 séquences, programmation dynamique Alignement de k séquences, NP-complétude Alignement de k séquences, algorithme approché Construction

Plus en détail

Heuristique et métaheuristique. 8. Optimisation combinatoire. Optimisation combinatoire. Problème du voyageur de commerce

Heuristique et métaheuristique. 8. Optimisation combinatoire. Optimisation combinatoire. Problème du voyageur de commerce Heuristique et métaheuristique IFT1575 Modèles de recherche opérationnelle (RO) 8. Optimisation combinatoire Un algorithme heuristique permet d identifier au moins une solution réalisable à un problème

Plus en détail

Chapitre 5. L exemple des protéines motrices : actine, myosine et les autres...

Chapitre 5. L exemple des protéines motrices : actine, myosine et les autres... Chapitre 5. L exemple des protéines motrices : actine, myosine et les autres... 5.1. Corréler les structures anatomique et histologique à la composition biochimique 5.2. Comprendre le mécanisme de transformation

Plus en détail

Chaînes de caractères

Chaînes de caractères Chapitre 1 Chaînes de caractères 1.1 détecter tous les anagrames entrée: sortie: soir loup isor lune dent {soir,isor} Un mot w est un anagrame d un mot v, s il existe une permutation des lettres qui transforme

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Tests statistiques. Définitions et principes généraux des tests statistiques

Tests statistiques. Définitions et principes généraux des tests statistiques Tests statistiques Définitions et principes généraux des tests statistiques Présentation générale Un test d hypothèse est une règle de décision. La décision est un pari et comporte toujours des risques

Plus en détail

Spectre RMN. Principe et exploitation. 1) Principe : s exprime en parties par million (ppm) Evaluation des compétences C3 - Activité 3

Spectre RMN. Principe et exploitation. 1) Principe : s exprime en parties par million (ppm) Evaluation des compétences C3 - Activité 3 Evaluation des compétences C3 - Activité 3 S approprier Analyser Réaliser Valider Communiquer Spectre RMN Principe et exploitation Les techniques de spectroscopie (UV-visible, IR, RMN) reposent sur des

Plus en détail

Introduction à la comparaison de séquences

Introduction à la comparaison de séquences Introduction à la comparaison de séquences - Université de Lille 1-2 eme Semestre Pourquoi comparer des séquences Recherche de similarités. Déterminer si des séquences sont homologues. Rechercher les exons/introns....

Plus en détail

Alignement multiple de séquences. Thierry Lecroq Université de Rouen

Alignement multiple de séquences. Thierry Lecroq Université de Rouen Alignement multiple de séquences Thierry Lecroq Université de Rouen Problème Aligner k séquences x 0, x 1,, x k-1 de manière optimale. 2 Interêts biologiques Inférer des relations d évolution d entre espèces

Plus en détail

Algo 2 Exercices corrigés. Arbre de décision

Algo 2 Exercices corrigés. Arbre de décision Exercices corrigés Arbre de décision Les arbres de décisions permettent de caractériser une classe d algorithmes de tris : les algos de tris par comparaisons séquentiels et déterministes. Cela correspond

Plus en détail

P i,k P k,j P (2) Le calcul du carré de la matrice P! P (2) = P 2 p. 1/1. i,j = k=1

P i,k P k,j P (2) Le calcul du carré de la matrice P! P (2) = P 2 p. 1/1. i,j = k=1 Calculs exacts et asymptotiques Calcul exact des probabilités de transition en plusieurs étapes La probabilité d une transition de l état i à l état j dans 2 transitions est la somme pour tout k de la

Plus en détail

Analyse comparative pour l étude des gènes d ARN

Analyse comparative pour l étude des gènes d ARN nalyse comparative pour l étude des gènes d RN Hélène Touzet Équipe Bioinfo LIFL STL http://www.lifl.fr/bioinfo modèle thermodynamique MFOLD RNfold prédiction de structures prédiction de gènes analyse

Plus en détail

Algorithmique M1 Université Paris Diderot

Algorithmique M1 Université Paris Diderot Algorithmique M1 Université Paris Diderot Coorigé (béta 1.1) du partiel du 28 novembre 2008 Exercice 1 : applications de cours 1.1. Récurrence Étant donné que T (n) = 9T ( n/3 ) + n 2 + 3 trouvez le comportement

Plus en détail

Master Recherche de l Université des Sciences et Technologies de Lille (spécialité informatique)

Master Recherche de l Université des Sciences et Technologies de Lille (spécialité informatique) Détection d RN non-codants MÉMOIRE présenté le 4 juillet 2005 pour le stage de Master Recherche de l niversité des Sciences et Technologies de Lille (spécialité informatique) par rnaud Fontaine Hélène

Plus en détail

Ingénierie des Protéines (Modélisation structurale)

Ingénierie des Protéines (Modélisation structurale) Ingénierie des Protéines (Modélisation structurale) 2 cours (4h) : 13 et 20 fév (14 16 H) Structures de protéines Modélisation moléculaire Modélisation par homologie 1 TD/TP informatique (4h) : 20 mars

Plus en détail

Cours de Biologie Moléculaire SVI- S5 ( )

Cours de Biologie Moléculaire SVI- S5 ( ) Cours de Biologie Moléculaire SVI- S5 (2014-15) Le dogme centrale de la Biologie Moléculaire Représente le mécanisme d expression de l information génétique (Francis Crick (fin des années 50) et Nature

Plus en détail

EXPRESSION, STABILITÉ ET VARIATION DU PATRIMOINE GÉNÉTIQUE

EXPRESSION, STABILITÉ ET VARIATION DU PATRIMOINE GÉNÉTIQUE Première S - Cours 1 suite EXPRESSION, STABILITÉ ET VARIATION DU PATRIMOINE GÉNÉTIQUE III. Relations complexes entre génotype et phénotype : 1 ) Les différentes échelles d un phénotype : Rappel : Le génotype

Plus en détail

Algorithmique du texte. Recherche approchée

Algorithmique du texte. Recherche approchée Algorithmique du texte Recherche approchée 1 Introduction Objectif Retrouver des motifs similaires Applications recherche de similarité dans les séquences biologiques recherche d un mot dans un texte,

Plus en détail

1 Structure de la matière condensée. Corrigé du T.D. n 9 Matière molle

1 Structure de la matière condensée. Corrigé du T.D. n 9 Matière molle 1 Structure de la matière condensée. Corrigé du T.D. n 9 Matière molle 2 3 4 5 6 7 P. Busch et al.: ''Diblock copolymer thin films investigated by tapping mode AFM: Molar mass dependence of surface ordering'',

Plus en détail

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Structure secondaire d une molécule d ARNt Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Plan Généralités sur l ARN Moyens de prédiction des structures

Plus en détail

2 Algorithmique sur chacune des représentations

2 Algorithmique sur chacune des représentations Algorithmique M1 TD 1 : Graphes et représentations 1 Trois façons de représenter un graphe 1 2 4 3 6 5 Exercice 1 : Donner une représentation du graphe ci-dessus au moyen d une liste d adjacence, puis

Plus en détail

Recherche approximative d un mot dans un texte

Recherche approximative d un mot dans un texte Recherche approximative d un mot dans un texte Problème: trouver toutes les occurrences approximatives d un mot P = p 1 p 2...p m dans un texte T = t 1 t 2...t n. Exemple: Mot: TATA Texte: ACG TAATA G

Plus en détail

Le problème du voyageur de commerce

Le problème du voyageur de commerce École polytechnique X2013 INF412 Fondements de l informatique Le problème du voyageur de commerce Sujet proposé par David Monniaux et Bruno Salvy (corrigé) On appelle problème du voyageur de commerce le

Plus en détail

Moindres carrés. Michel Bierlaire. Laboratoire Transport et Mobilité EPFL - ENAC - TRANSP-OR. Moindres carrés p.

Moindres carrés. Michel Bierlaire. Laboratoire Transport et Mobilité EPFL - ENAC - TRANSP-OR. Moindres carrés p. Moindres carrés p. 1/38 Moindres carrés Michel Bierlaire michel.bierlaire@epfl.ch Laboratoire Transport et Mobilité EPFL - ENAC - TRANSP-OR Moindres carrés p. 2/38 Problème des moindres carrés Problème

Plus en détail

Cours 4: Programmation linéaire

Cours 4: Programmation linéaire Cours 4: Programmation linéaire Position du problème Algorithme du simplexe générique Dualité. Dégénérescence et terminaison de l algorithme 1-1 Cours 4: Programmation linéaire Position du problème Algorithme

Plus en détail

2. Si le nième élément n appartient pas à la solution optimale, cela signifie, que la solution

2. Si le nième élément n appartient pas à la solution optimale, cela signifie, que la solution Problème Sac à Dos. Le problème du Sac à Dos est un problème classique en informatique. Il modélise une situation analogue au remplissage d un sac. Une personne veut remplir un sac à dos ne pouvant pas

Plus en détail

Algorithmes pour la prédiction de structures secondaires des ARN. 19/03/2007 Stéfan Engelen - M2 UPMC 1

Algorithmes pour la prédiction de structures secondaires des ARN. 19/03/2007 Stéfan Engelen - M2 UPMC 1 Algorithmes pour la prédiction de structures secondaires des ARN 19/03/2007 Stéfan Engelen - M2 UPMC 1 L ARN La structure secondaire d ARN L ARN Acide Ribo Nucléique Polymère constitué de 4 nucléotides

Plus en détail

Séance 3: Liaisons entre variables

Séance 3: Liaisons entre variables Analyse des individus Laboratoire de Statistique et Probabilités UMR 5583 CNRS-UPS wwwlspups-tlsefr/gadat Troisième partie III Liaisons entre variables Liaisons entre variables ordinales : corrélation

Plus en détail

CHAPITRE VII. Plus courts chemins

CHAPITRE VII. Plus courts chemins CHAPITRE VII Plus courts chemins VII. VII.. Présentation du problème Graphes pondérés On s intéresse à des graphes qui sont pondérés et a priori orientés. Il y a donc un poids, un réel, sur chaque arc

Plus en détail

Techniques Avancées d IA. d optimisation combinatoire

Techniques Avancées d IA. d optimisation combinatoire Techniques Avancées d IA Méthodes incomplètes d optimisation combinatoire M1 IA&RF Oct-Déc.. 2015 On n a pas d algorithme permettant de trouver directement (efficacement) et à tous les coups la solution

Plus en détail

Optimisation du calcul du capital économique d'une compagnie d'assurance vie par la méthode des Simulations dans les Simulations

Optimisation du calcul du capital économique d'une compagnie d'assurance vie par la méthode des Simulations dans les Simulations Optimisation du calcul du capital économique d'une compagnie d'assurance vie par la méthode des Simulations dans les Simulations Conférence débat de l Institut des Actuaires Jean-Baptiste Garnier & Anne-Claire

Plus en détail

Chapitre III: Structure spatiale des protéines III.1. Conformation des protéines. La séquence des acides aminés est déterminée par les gènes.

Chapitre III: Structure spatiale des protéines III.1. Conformation des protéines. La séquence des acides aminés est déterminée par les gènes. III.1. Conformation des protéines La séquence des acides aminés est déterminée par les gènes. La séquence des acides aminés détermine la structure tridimensionnelle. Une séquence d acides aminés conduit

Plus en détail

Arborescences et représentations informatiques des graphes

Arborescences et représentations informatiques des graphes Arborescences et représentations informatiques des graphes robillard@ensiie.fr 13 décembre 2007 Plan Arborescences 1 Arborescences 2 Matrice d adjacence Liste d adjacence Avantages et inconvénients de

Plus en détail

Exercice 1 Synthèse organique

Exercice 1 Synthèse organique DEVOIR SURVEILLE N 2 PHYSIQUE-CHIMIE Série S DURÉE DE L ÉPREUVE : 2h00 L usage d'une calculatrice EST autorisé Ce sujet comporte un exercice présenté sur 4 pages numérotées de 1 à 8. Exercice 1 Synthèse

Plus en détail

Routage Qualité de service et ingénierie. Routage et Qualité de service. Métriques 15/03/12

Routage Qualité de service et ingénierie. Routage et Qualité de service. Métriques 15/03/12 Routage Qualité de service et ingénierie routage contraint 1 Routage et Qualité de service Routage contraint Calculer un chemin vérifiant Contraintes sur une ou plusieurs métriques Et/ou op@misant une

Plus en détail

Programmation dynamique

Programmation dynamique Complexité et Graphe 2014-2015 ENSTA Programmation dynamique Exercice 1 Triangle de Pascal On veut calculer les coefficients binomiaux C k n = ( n k suivantes ( : ) ( ) ( ) n n 1 n 1 = + pour 0 < k < n,

Plus en détail

Distance d édition. Pour comparer des séquences, on va définir une distance:

Distance d édition. Pour comparer des séquences, on va définir une distance: Distance d édition Pour comparer des séquences, on va définir une distance: Définition: Une distance D est une relation ayant les propriétés suivantes: D(x, x)=0 D(x, y)=d(y, x) D(x, z) apple D(x, y)+d(y,

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Examen du 11/1/11 -corrigé

Examen du 11/1/11 -corrigé lgorithmique M Examen du // -corrigé Université Paris iderot On applique un algorithme de cours Exercice Routage Le serveur est connecté à la machine par un réseau avec les noeuds,,,, les capacités de

Plus en détail

Approche bayésienne pour la tomographie des temps de première arrivée. Jihane BELHADJ Thomas ROMARY Alexandrine GESRET Mark NOBLE

Approche bayésienne pour la tomographie des temps de première arrivée. Jihane BELHADJ Thomas ROMARY Alexandrine GESRET Mark NOBLE Approche bayésienne pour la tomographie des temps de première arrivée Jihane BELHADJ Thomas ROMARY Alexandrine GESRET Mark NOBLE Tomographie sismique La tomographie des temps de première arrivée a pour

Plus en détail

ANALYSE ORGANIQUE ET RECHERCHE DE STRUCTURE

ANALYSE ORGANIQUE ET RECHERCHE DE STRUCTURE hapitre 4 ANALYSE ORGANIQUE ET REERE DE STRUTURE Introduction Jusqu à maintenant nous avons étudié des molécules organiques isolées Nous avons vu leurs structures, comment on peut les nommer et les relations

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

TS - Chapitre 4 : la spectroscopie. 3) Découverte de la spectroscopie RMN : Résonance Magnétique Nucléaire

TS - Chapitre 4 : la spectroscopie. 3) Découverte de la spectroscopie RMN : Résonance Magnétique Nucléaire TS - hapitre 4 : la spectroscopie 3) Découverte de la spectroscopie RMN : Résonance Magnétique Nucléaire TS - hapitre 4 : la spectroscopie TS - hapitre 4 : la spectroscopie A partir des trois documents

Plus en détail

Structures fines : le couplage scalaire (1) Structures fines : le couplage scalaire (2)

Structures fines : le couplage scalaire (1) Structures fines : le couplage scalaire (2) Structures fines : le couplage scalaire () Les niveaux d'énergie d'un noyau peuvent être affectés par l'état de spin d'un noyau voisin. Deux noyaux dans cette situation sont couplés. Ce couplage est "transporté"

Plus en détail

Qu'est-ce que l'adn?

Qu'est-ce que l'adn? Structure Physico-chimique de l'adn Qu'est-ce que l'adn? L'ADN (acide désoxyribonucléique) est une macromolécule biologique formée par deux chaînes complémentaires qui s'emboîtent tout en s'enroulant l'une

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 1 : La reproduction conforme de la cellule et la réplication

Plus en détail

Chap. 2 : Algorithmes de routage (Préliminaires)

Chap. 2 : Algorithmes de routage (Préliminaires) UMR 7030 - Université Paris-Nord - Institut Galilée Cours Systèmes Distribués Pseudocode à utiliser Les algorithmes seront présentés dans un pseudocode similaire au langage Pascal. Un algorithme distribué

Plus en détail

Propriétés et fonctions des molécules du vivant.

Propriétés et fonctions des molécules du vivant. Propriétés et fonctions des molécules du vivant. Comment la structure des protéines explique-t-elle leurs fonctions? I) DE L'ACIDE AMINE A LA PROTEINE 1) Structures et propriétés des acides aminés 2) La

Plus en détail

IV- La description des mouvements

IV- La description des mouvements IV- La description des mouvements 1-Mouvements aléatoires Aléatoire mais pas n'importe comment! Amplitudes Temps caractéristiques s Les fonctions de mémoire Paramètres d'ordre L'analyse «model-free» de

Plus en détail

Informatique TD7 : Complexité et structures de données

Informatique TD7 : Complexité et structures de données Informatique TD7 : Complexité et structures de données CPP septembre - novembre 2016 1 Complexité 1.1 Introduction (5mn) Un algorithme est dit de complexité polynomiale si sa complexité est une fonction

Plus en détail

La RMN pour les nuls. Cours RMN - 1

La RMN pour les nuls. Cours RMN - 1 La RM pour les nuls ours RM - 1 La Résonance Magnétique (ucléaire) Définition : utilisation des propriétés magnétiques des noyaux des atomes placés dans un champ magnétique très intense. Les particules

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Cours 5: Programmation dynamique

Cours 5: Programmation dynamique 1 Cours 5: Programmation dynamique Olivier Bournez bournez@lix.polytechnique.fr LIX, Ecole Polytechnique 2011-12 Algorithmique Exemple: C k n Exemple: On veut calculer C k n = n! k!(n k)! (aussi noté (

Plus en détail

MATH-H Mise à niveau en algorithmique

MATH-H Mise à niveau en algorithmique MATH-H-404 - Mise à niveau en algorithmique Bernard Fortz Nikita Veshchikov Université Libre de Bruxelles Département d informatique bernard.fortz@ulb.ac.be - nikita.veshchikov@ulb.ac.be 2011-2012 Plan

Plus en détail

Alignements de deux séquences

Alignements de deux séquences Alignements de deux séquences Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin 2007-08 Plan

Plus en détail

Algorithmes de graphes pour la recherche de motifs récurrents dans les structures tertiaires d ARN

Algorithmes de graphes pour la recherche de motifs récurrents dans les structures tertiaires d ARN Algorithmes de graphes pour la recherche de motifs récurrents dans les structures tertiaires d ARN Mahassine Djelloul To cite this version: Mahassine Djelloul. Algorithmes de graphes pour la recherche

Plus en détail

Système de recommandation dans un réseau social professionnel : Phase 2

Système de recommandation dans un réseau social professionnel : Phase 2 Système de recommandation dans un réseau social professionnel : Phase Maria Malek 3 février 010 1 Traitement du réseau des citations Nous rappelons que le réseau que nous venons d extraire à partir du

Plus en détail