Save this PDF as:

Dimension: px
Commencer à balayer dès la page:



1 BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie de Montréal Courriels: Page web du cours: dbin1002/ Démonstrateur: Robin Milosz, Objectifs: Le cours BIN1002 vise à introduire l étudiant au domaine de la bioinformatique en y survolant plusieurs thèmes importants. Contenu: Structure et prédiction de gènes, séquençage de deuxième génération, alignement local et global et recherche de similarités, structures secondaires d ARN, médecine personnalisée. Références: - D. Gusfiled, Algorithms on Strings, Trees and Sequences - Computer Science and Computational Biology, Cambridge University Press, D.W. Mount, Bioinformatics: Sequence and Genome Analysis, Second Edition, Cold Spring Harbor Laboratory Press, M. Pop, S.L. Salzberg et M. Shumway, Genome Sequence Analysis: Algorithms and Issues, IEEE, Évaluation: L évaluation du cours sera constituée de: - 2 devoirs (fait en partie pendant les travaux pratiques) : 2 10% - Un examen intra: 20% - Présentation d un sujet bioinformatique non couvert au cours (voir à la fin de ce document pour les sujets d exposés et les modalités: 30% - Un test récapitulatif: 30%

2 Plan des séances - BIN Automne 2015: - 2 septembre, local Z-255, 10h30-12h30 2h: Présentation du cours (SH & GL) Présentation des professeurs et du plan de cours Présentation et choix des thèmes de présentations - Travaux Pratiques: 4 septembre, local M-625, 11h30-13h30 Environnement informatique Unix Introduction à la programmation en Perl - 9 septembre, local Z-255, 10h30-12h30 1h: Structure des gènes (GL) Promoteur, transcription, épissage, traduction Séquences caractéristiques de ces différents processus 1h: Prédiction de gènes (SH) Cadre de lecture ouvert (Open Reading Frame:ORF) Survol d autres méthodes de prédiction (HMM, réseaux de neurones, etc..) - Travaux pratiques: 11 septembre, local M-625, 11h30-13h30 Test de remise - 16 septembre, local Z-255, 10h30-12h30 1h: Génomique comparative, concept d homologie (GL) 1h: Introduction aux alignements (SH) Problèmatique, matrice de points Distance d édition et calcul d un alignement optimal - Travaux pratiques: 18 septembre, local M-625, 11h30-13h30 Introduction aux outils et ressources web de bioinformatique Énoncé du devoir 1-23 septembre, local Z-255, 10h30-12h30 1h: Alignements local et global et recherche de similarités (SH) Alignement global vs local Distance vs similarité Alignements avec trous 2

3 - Travaux pratiques : 24 septembre, local M-625, 11h30-13h30 Logiciels d alignements - 30 septembre, local Z-255, 10h30-12h30 2h: Introduction au séquançage de deuxième génération (Next-generation sequencing) (GL) - Travaux pratiques: 2 octobre, local M-625, 11h30-13h30 BLAST Travail sur devoir 1-7 octobre, local Z-255, 10h30-12h30 2h: BLAST et FASTA (SH) Pourquoi des heuristiques d alignements? Matrice PAM et BLOSUM Heuristiques FASTA et BLAST et évaluation statistique des résultats - Travaux pratiques: 9 octobre, local M-625, 11h30-13h30 Fichier fasta Travail sur devoir 1 Remise devoir 1-14 octobre, local G-815, 10h30-12h30 2h: Examen Intra - Travaux pratiques: 16 octobre, local M-625, 11h30-13h30 Introduction à l analyse de données de sequençage 2e gen. Énoncé du devoir 2 - du 19 au 23 octobre: Semaine de relâche - 28 octobre, local Z-255, 10h30-12h30 2h: Transcriptomique (Sébastien Lemieux) - Travaux pratiques: 30 octobre, local M-625, 11h30-13h30 Paired reads 3

4 Fichiers format sam Travail sur le devoir 2-4 novembre local Z-255, 10h30-12h30 2h: Médecine personnalisée: maladies génétiques complexes et dossiers électroniques (GL) - Travaux pratiques: 6 novembre, local M-625, 11h30-13h30 Travail sur le devoir 2 Remise devoir 2-11 novembre local Z-255, 10h30-12h30 2h: Révision des plans d exposés avec les professeurs (10 minutes par équipe) (SH et GL) - Travaux pratiques: 13 novembre, local M-625, 11h30-13h30 Fin programmation en Perl Transeq et BackTranseq Aide à la préparation des exposés (priorité aux équipes présentant le 18 novembre) - 18 novembre local Z-255, 10h30-12h30 2h: Exposés des équipes du groupe 1 (SH et GL) - Travaux pratiques: 20 novembre, local M-625, 11h30-13h30 Gène homologues Alignements multiples Aide à la préparation des exposés (priorite aux équipes du groupe 2, présentant le 25 novembre) novembre local Z-255, 10h30-12h30 2h: Exposés des équipes du groupe 2 (SH et GL) - Travaux pratiques: 27 novembre, local M-625, 11h30-13h30 Amorces ADN, outils web Aide à la préparation des exposés (priorite aux équipes du groupe 3, présentant le 2 décembre). - 2 décembre local Z-255, 10h30-12h30 2h: Exposés des équipes du groupe 3 (SH et GL) 4

5 - Travaux pratiques: 4 décembre, local M-625, 11h30-13h30 PDB Visualisation de protéines Révision pour l examen final - 16 décembre, local AA1360, 10h30-12h30 2h: Test récapitulatif Thèmes des exposés, références et format de la présentation: Voici différents thèmes possibles pour les exposés (les références seront sur la page web): 1. Algorithmes d alignement pour les courtes séquences de NGS (Guillaume Lettre) 2. Algorithmes didentification disoformes à partir de données RNAseq (Guillaume Lettre) 3. Bio-informatique et le nuage (cloud computing) (Guillaume Lettre) 4. Calcul moléculaire (Sylvie Hamel) 5. Dynamique moléculaire (Sylvie Hamel) 6. Génomique comparative (Sylvie Hamel) 7. microarn et détection d ARN non codants (Sylvie Hamel) 8. Outils de recherche et d annotation du génome humain: UCSC Genome Browser ou ENSEMBL (Guillaume Lettre) 9. Phylogénie: méthodes de construction d arbres (Sylvie Hamel) 10. Pubmed: votre meilleur ami! (Guillaume Lettre) 11. Tout autre sujet qui vous intéresse et qui n est pas couvert dans le cours (sous réserve de l approbation de SH ou GL) Format et évaluation de la présentation: L évaluation de la présentation comprend trois parties: - Un résumé de 2 pages + une page de bibliographie est à remettre le 16 octobre. Ce résumé comptera pour 10%. - Un plan d exposé (ppt, ps ou pdf) est à remettre le 9 novembre. Ce document comptera pour 5%. 5

6 - La présentation comme telle doit durer 20 minutes. L exposé sera suivi d une dizaine de minutes de questions. La présentation comptera pour 15%. Il est important de préparer un exposé qui couvrera l aspect biologique, la définition des concepts, les problèmes les plus intéressants liés au sujet que vous avez choisi et l apport de la bioinformatique. Préparation: 1. Lecture des articles ou chapitres de livres conseillés sur la page web du cours 2. Recherche d informations supplémentaires (WEB : Discussion avec le parrain (entre parenthèse ci-haut) 4. Faire la présentation à l aide de PowerPoint ou d Acroread. Demander conseil à votre démonstrateur quant à la mise en forme des diapositives. 5. Un étudiant devra emprunter un portable à la DGTIC la journée de la présentation. 6


INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2016 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Capsule. Ajouter un fichier PowerPoint ou une nouvelle à un plan de cours de trimestre existant et le publier

Capsule. Ajouter un fichier PowerPoint ou une nouvelle à un plan de cours de trimestre existant et le publier Capsule Ajouter un fichier PowerPoint ou une nouvelle à un plan de cours de trimestre existant et le publier Après la lecture de cette capsule, un utilisateur novice de Zone Cours sera en mesure : d ouvrir

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

AVL Liban La Bioinformatique. Bioinformatique

AVL Liban La Bioinformatique. Bioinformatique AVL Liban 2011 La Sami Khuri Department of Computer Science San José State University San José, California, USA Sami Khuri Qu est-ce

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail


FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail


DÉCOUVREZ LES LIGNES DIRECTRICES 2015 DÉCOUVREZ LES LIGNES DIRECTRICES 2015 La trousse d outils électroniques de la Fondation des maladies du cœur et de l AVC vous donne les ressources dont vous avez besoin pour mettre en œuvre les nouvelles

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

IMM115 Gestion des opérations de maintenance

IMM115 Gestion des opérations de maintenance Département de génie de la production autoomatisée Programme de certificat Enseignant : Groupe 01 : Christian Martin Préalable : IMM110 PLAN DE COURS HIVER 2014 IMM115 OBJECTIFS SPÉCIFIQUES L objectif

Plus en détail

MTH8442 Ordonnancement de Plan production. (3-0-6) 3 cr

MTH8442 Ordonnancement de Plan production. (3-0-6) 3 cr MTH8442 Ordonnancement de Plan production de cours Automne 2008 (3-0-6) 3 cr Michel Gamache Local A-305.29 340-4711 poste 5920 François Soumis Local A-520.15 340-4711 poste 6044

Plus en détail


LES FAMILLES MULTIGÉNIQUES : L'EXEMPLE DES CHAÎNES DE L'HÉMOGLOBINE Fiche sujet-élève Les similitudes entre gènes sont interprétées comme le résultat d une ou plusieurs duplications d un gène ancestral. Des molécules homologues appartiennent à la même famille multigénique

Plus en détail

UNIVERSITÉ DE MONTRÉAL DÉPARTEMENT DE SOCIOLOGIE ************* Cours de niveau gradué en méthodes quantitatives *************

UNIVERSITÉ DE MONTRÉAL DÉPARTEMENT DE SOCIOLOGIE ************* Cours de niveau gradué en méthodes quantitatives ************* ************* Cours de niveau gradué en méthodes quantitatives ************* SOL 6210 - Analyse quantitative avancée Le séminaire d analyse quantitative avancée se donne en classe une fois par année. Chaque

Plus en détail

Nom de la procédure : Utilisation du nouveau système d impression Produit(s) affecté(s) :

Nom de la procédure : Utilisation du nouveau système d impression Produit(s) affecté(s) : Nom de la procédure : Utilisation du nouveau système d impression Produit(s) affecté(s) : PaperCut MF Numéro procédure : GU-PC-10-001 Auteur : Serge Bouchard Date de création : 23 novembre 2010 Révisé

Plus en détail

GES855 - Gestion de l'information, veille et prise de décision stratégique dans un contexte d innovation

GES855 - Gestion de l'information, veille et prise de décision stratégique dans un contexte d innovation Département de génie de la production automatisée Programme de maîtrise PLAN DE COURS Enseignant : Élisabeth Lavigueur Responsable : Mickaël Gardoni Session/année: Été 2014 Groupe : 01 GES855 - Gestion

Plus en détail

Plateforme de capture et d analyse de sites Web AspirWeb

Plateforme de capture et d analyse de sites Web AspirWeb Projet Java ESIAL 2A 2009-2010 Plateforme de capture et d analyse de sites Web AspirWeb 1. Contexte Ce projet de deuxième année permet d approfondir par la pratique les méthodes et techniques acquises

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail



Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

QUA121 Contrôle statistique de la qualité

QUA121 Contrôle statistique de la qualité Département de génie mécanique Programme de certificat Enseignant : Groupe 01 : Fayçal Benhamed Préalable : MAT321 PLAN DE COURS HIVER 2013 QUA121 1 OBJECTIFS SPÉCIFIQUES L étudiant sera en mesure de :

Plus en détail


ESPACE COLLABORATIF SHAREPOINT Conseil de l Europe Service des Technologies de l Information ESPACE COLLABORATIF SHAREPOINT DOSSIER D UTILISATEUR 1/33 Sommaire 1. Présentation de SharePoint... 3 1.1. Connexion... 4 2. Les listes...

Plus en détail

Formulaire du dépôt de plan de cours

Formulaire du dépôt de plan de cours Formulaire du dépôt de plan de cours H 2013 H 2014 PROGRAMME : Technologie de l électronique industrielle TITRE : Gestion de projets CODE : 243-374-RA PONDÉRATION : 1-2-1 DISCIPLINE : Génie électrique

Plus en détail

VPS/PDF. La Distribution Électronique de l Édition d Entreprise. Distributeur exclusif de la gamme des logiciels Levi, Ray & Shoup, Inc.

VPS/PDF. La Distribution Électronique de l Édition d Entreprise. Distributeur exclusif de la gamme des logiciels Levi, Ray & Shoup, Inc. VPS/PDF La Distribution Électronique de l Édition d Entreprise Distributeur exclusif de la gamme des logiciels Levi, Ray & Shoup, Inc. Quotidiennement, toute entreprise diffuse à ses clients, ses employés

Plus en détail

Titre de la leçon Canada 2026 : changements démographiques Analyse de l évolution de la population et problèmes démographiques potentiels

Titre de la leçon Canada 2026 : changements démographiques Analyse de l évolution de la population et problèmes démographiques potentiels Qui nous sommes Titre de la leçon Canada 2026 : changements démographiques Analyse de l évolution de la population et problèmes démographiques potentiels Aperçu général À l aide de données démographiques,

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce Année 2007-2008 Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce B. Monsuez Projet informatique «Voyageur de commerce» Résolution

Plus en détail

PLAN DE COURS HIVER 2014 PGM125 Systèmes de Gestion de la maintenance informatisés (module 7)

PLAN DE COURS HIVER 2014 PGM125 Systèmes de Gestion de la maintenance informatisés (module 7) Département de génie de la production automatisée Programme court en maintenance Enseignant : Claude Bilodeau Responsable : Michel Rioux, ing., Ph.D. Groupe : 65 Session : Hiver 2014 PLAN DE COURS HIVER

Plus en détail

IFT3902 : (Gestion de projet pour le) développement, (et la) maintenance des logiciels

IFT3902 : (Gestion de projet pour le) développement, (et la) maintenance des logiciels IFT3902 : (Gestion de projet pour le) développement, (et la) maintenance des logiciels Yann-Gaël Guéhéneuc Professeur adjoint, local 2345 Département d informatique et de recherche

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Numérique ENI. Bibliothèque. Un nouvel outil pour enrichir vos connaissances. Recherchez l information au cœur des livres

Numérique ENI. Bibliothèque. Un nouvel outil pour enrichir vos connaissances. Recherchez l information au cœur des livres Bibliothèque La 1 ère Bibliothèque informatique en ligne entièrement en français Un nouvel outil pour enrichir vos connaissances Recherchez l information au cœur des livres 2 La Bibliothèque Elle contient

Plus en détail

Guide du rédacteur pour le site d histoire et de géographie de l académie de Dijon.

Guide du rédacteur pour le site d histoire et de géographie de l académie de Dijon. Guide du rédacteur pour le site d histoire et de géographie de l académie de Dijon. Le site d histoire de l académie de Dijon est en spip. Il favorise la mutualisation puisque chacun peut devenir rédacteur

Plus en détail

Plan de cours. Chiffriers et bases de données en gestion commerciale

Plan de cours. Chiffriers et bases de données en gestion commerciale Collège Lionel-Groulx 100, rue Duquet Sainte-Thérèse, (Québec) J7E 3G6 Téléphone : (450) 430-3120 Télécopieur : (450) 430-2783 Site Internet : Session : Hiver 2009 No de cours : 420-CJ0-LG

Plus en détail


LES ACHATS SUR LE WEB (Version 3) LES ACHATS SUR LE WEB (Version 3) COMMERCE ÉLECTRONIQUE (B2B) La fonctionnalité de commerce électronique (B2B) du système financier SOFE permet à l usager de faire son magasinage sur le site Web des fournisseurs

Plus en détail

Demande d admission en ligne DESS en santé mondiale (1668)

Demande d admission en ligne DESS en santé mondiale (1668) Demande d admission en ligne DESS en santé mondiale (1668) L unique façon de faire une demande d ADMISSION au DESS en santé mondiale (1668) Voici la procédure étape par étape : Notez qu après avoir été

Plus en détail

Catalogue des formations Médecine et paramédical

Catalogue des formations Médecine et paramédical Catalogue des formations Médecine et paramédical Sommaire Recherche documentaire et maîtrise de l information médicale... 2 Utilisation des catalogues des bibliothèques de médecine... 3 Utilisation de

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Les bases de données biologiques Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Sommaire 1. Introduction 2. Le système Entrez 2.1. Description du système Entrez 2.2.

Plus en détail



Plus en détail

Plan de cours. Cours : INF888 Infonuagique Modèle et implantation Trimestre : Automne 2015 Enseignant : Fadi Joseph et Claude Cardinal

Plan de cours. Cours : INF888 Infonuagique Modèle et implantation Trimestre : Automne 2015 Enseignant : Fadi Joseph et Claude Cardinal Faculté des sciences Centre de formation en technologies de l information Plan de cours Cours : INF888 Infonuagique Modèle et implantation Trimestre : Automne 2015 Enseignant : Fadi Joseph et Claude Cardinal

Plus en détail

se FOrmer et ÉcHanGer autour de la PÉdaGOGie universitaire numérique ateliers proposés par le département apprendre

se FOrmer et ÉcHanGer autour de la PÉdaGOGie universitaire numérique ateliers proposés par le département apprendre E LOGO SIMPLIFIÉ POUR MARQUAGE PUBLICITAIRE F O r m a t i O n c O n t i n u e se FOrmer et ÉcHanGer autour de la PÉdaGOGie universitaire numérique ateliers proposés par le département apprendre FORMATION

Plus en détail

Devoir à la maison en algorithmique (2 nde )

Devoir à la maison en algorithmique (2 nde ) Devoir à la maison en algorithmique (2 nde ) Introduction Quel constat : Les devoirs à la maison permettent de soutenir les apprentissages des élèves et prennent en compte la diversité des aptitudes des

Plus en détail

PROCEDURE DE REALISATION DE LA VAE «Manager du déploiement opérationnel du Développement Durable»

PROCEDURE DE REALISATION DE LA VAE «Manager du déploiement opérationnel du Développement Durable» PROCEDURE DE REALISATION DE LA VAE «Manager du déploiement opérationnel du Développement Durable» Objet : Ce document a pour objectif de fournir au candidat les informations nécessaires pour réaliser une

Plus en détail


MGL835 INTERACTION HUMAIN-MACHINE PLAN DE COURS DESCRIPTION SOMMAIRE École de technologie supérieure Trimestre : Hiver 2013 Département de génie logiciel et des TI Professeur : Michael McGuffin Maîtrise en génie logiciel Responsable : Michael McGuffin Préalable : Aucun

Plus en détail


MODALITÉS DEMANDES DE BOURSES D ÉTUDES EMPLOYÉS DU MOUVEMENT DESJARDINS MODALITÉS DEMANDES DE BOURSES D ÉTUDES EMPLOYÉS DU MOUVEMENT DESJARDINS Objectifs du programme de bourses de la Fondation Desjardins Les bourses aux employés s'adressent à ceux poursuivant des études à

Plus en détail



Plus en détail

Valorisation du capital humain Une façon d accroître son revenu

Valorisation du capital humain Une façon d accroître son revenu Fiche technique 4.3 Art et artisanat page 1 Nous savons qu il y a une abondance de connaissances et de savoir-faire à la portée de chaque communauté agricole, agroalimentaire et rurale franco-ontarienne.

Plus en détail



Plus en détail

FRANÇAIS 3010W sample syllabus

FRANÇAIS 3010W sample syllabus FRANÇAIS 3010W sample syllabus 1 Semaine 1 2 Programme INTRODUCTION - Présentation du cours (voir description du cours sur BB) - Création de groupes de travail pour La Nouvelle Collective - Questionnaire

Plus en détail


CHAP 7 : LA PRODUCTION D UN DOCUMENT MULTIMEDIA CHAP 7 : LA PRODUCTION D UN DOCUMENT MULTIMEDIA CHAP 7 : LA PRODUCTION D UN DOCUMENT MULTIMEDIA LA CONCEPTION D UN DOCUMENT MULTIMEDIA 1-1. Recherchez les différents types d informations numériques que peut comporter un document 3-3. Précisez l intérêt du réseau internet pour développer un document

Plus en détail

Laboratoire de mathématiques financières ACT 3282

Laboratoire de mathématiques financières ACT 3282 Automne 2015 Département des mathématiques et statistiques Université de Montréal Laboratoire de mathématiques financières ACT 3282 1. Renseignements généraux: Horaire: Mardi 18h30-19h30 et Vendredi 11h30-13h30

Plus en détail

Guide Référent Et Equipe pédagogique Version.1

Guide Référent Et Equipe pédagogique Version.1 Guide Référent Et Equipe pédagogique Version.1 1 Sommaire page 1- Introduction 3 2- Connexion 4 3- Tableau de bord 5 4- Gérer les demandes d admissions 7 5- Les blocs 8 6- Création d un cours 10 7- Mise

Plus en détail


POURQUOI PRENDRE DES NOTES? LA PRISE DE NOTES La prise de notes Manuel de cours Savoir Plus Outils et méthodes de travail intellectuel Raymond Robert Tremblay et Yvan Perrier Chapitre 4 Savoir prendre des notes, pages 71 à 81 LA

Plus en détail

Utiliser un logiciel libre de gestion bibliographique : Zotero 2.0

Utiliser un logiciel libre de gestion bibliographique : Zotero 2.0 Utiliser un logiciel libre de gestion bibliographique : Zotero 2.0 David Vivarès URFIST Strasbourg 1.Définition Les logiciels de gestion bibliographiques sont des outils spécialisés permettant de gérer

Plus en détail

Bibliothèque Atelier : Les essentiels de la recherche

Bibliothèque Atelier : Les essentiels de la recherche Bibliothèque Atelier : Les essentiels de la recherche Accès aux outils de recherche de la bibliothèque Accès au Collège o À partir du site du CLG, cliquer sur l onglet bleu «Bibliothèque». o À partir du

Plus en détail

EXATICE Centre de formation bureautique & Pack Office vous présente le PCIE

EXATICE Centre de formation bureautique & Pack Office vous présente le PCIE EXATICE Centre de formation bureautique & Pack Office vous présente le PCIE Vous désirez Connaître le niveau réel en bureautique de vos collaborateurs? Accroitre le retour sur investissement de votre action

Plus en détail


INF 1250 INTRODUCTION AUX BASES DE DONNÉES. Guide d étude INF 1250 INTRODUCTION AUX BASES DE DONNÉES Guide d étude Sous la direction de Olga Mariño Télé-université Montréal (Québec) 2011 INF 1250 Introduction aux bases de données 2 INTRODUCTION Le Guide d étude

Plus en détail

Licence ProDon standard

Licence ProDon standard LIICENCE ET MODULES DIISPONIIBLES Le logiciel ProDon existe depuis 1992. Comme il est utilisé par des fondations et des organismes de toutes envergures, plusieurs modules ont été développés pour combler

Plus en détail



Plus en détail

Inscriptions administratives en ligne. Sciences Po - Inscriptions administratives en ligne

Inscriptions administratives en ligne. Sciences Po - Inscriptions administratives en ligne Accéder à votre inscription en ligne Identifiez-vous sur votre espace Sciences Po : Cliquer sur «Espace étudiant Accueil administratif» : Vos ID utilisateur et code confidentiel

Plus en détail

CmapTools Guide de démarrage rapide

CmapTools Guide de démarrage rapide CmapTools Guide de démarrage rapide Principes de base Le logiciel CmapTools permet de construire et de partager des cartes conceptuelles (désignées ci-après par le terme «Cmap»). Ces cartes conceptuelles

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

Plan du cours FDO. Fondement Des Ordinateurs STO100 Informatique Générale 1ere Année

Plan du cours FDO. Fondement Des Ordinateurs STO100 Informatique Générale 1ere Année Plan du cours FDO (1 è année, Trimestre 1, 2012-2013) Informations générales Titre Code Disciplines Niveau Durée Enseignant et coordonnées E-Mail Fondement Des Ordinateurs STO100 Informatique Générale

Plus en détail

Formation continue des personnels URCA. Offre de la Bibliothèque Universitaire

Formation continue des personnels URCA. Offre de la Bibliothèque Universitaire Formation continue des personnels URCA Offre de la Bibliothèque Universitaire Année 2012-2013 Bibliothèque Universitaire Formation continue pour le personnel de l URCA Modalités o Public : personnels de

Plus en détail

Module des Technologies de l'information et de la Communication en Education

Module des Technologies de l'information et de la Communication en Education CENTRES REGIONAUX DES METIERS DE L EDUCATION ET DE LA FORMATION Module des Technologies de l'information et de la Communication en Education Unité Centrale de la Formation des Cadres Juillet 2012 Introduction

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Remettre un devoir sur Moodle. La procédure. Sylvie Guérard, support technique 1/23/2014. Collège Éducacentre College 2014 Tous droits réservés.

Remettre un devoir sur Moodle. La procédure. Sylvie Guérard, support technique 1/23/2014. Collège Éducacentre College 2014 Tous droits réservés. Remettre un devoir sur Moodle La procédure Sylvie Guérard, support technique 1/23/2014 Message : En suivant un cours en ligne sur Moodle, vous devez déposer des devoirs et/ou des travaux. Voici la procédure

Plus en détail


ANNEXE G ADDENDA AU RAPPORT PRÉALABLE À L INSPECTION POUR LES ÉCOLES EN LIGNE 2015-2016 ANNEXE G ADDENDA AU RAPPORT PRÉALABLE À L INSPECTION POUR LES ÉCOLES EN LIGNE 2015-2016 Une école offrant en ligne une partie ou la totalité de ses cours doit soumettre l addenda au rapport préalable à

Plus en détail

Règlement du concours de fiches pédagogiques dans le cadre du projet intitulé «Tous pour TICE. TICE TICE pour chacun»

Règlement du concours de fiches pédagogiques dans le cadre du projet intitulé «Tous pour TICE. TICE TICE pour chacun» Règlement du concours de fiches pédagogiques dans le cadre du projet intitulé «Tous pour TICE TICE pour chacun» Ce concours est organisé par l'association Hongroise des Enseignants de Français en partenariat

Plus en détail



Plus en détail

SOMMAIRE. Voir le travail à faire Afficher le contenu des cours Consulter les ressources pédagogiques

SOMMAIRE. Voir le travail à faire Afficher le contenu des cours Consulter les ressources pédagogiques SOMMAIRE Partie 1 PRÉSENTATION Voir l essentiel Accéder à une rubrique Se connecter depuis son mobile 1/2 Se connecter depuis son mobile 2/2 Liste des éditions PDF et des impressions possibles Partie 2

Plus en détail

Manuel d utilisation du PTS : Protein Tracking System. Version Février 2012. 2012 by AgileBio. & www.labcollector.

Manuel d utilisation du PTS : Protein Tracking System. Version Février 2012. 2012 by AgileBio. & www.labcollector. Manuel d utilisation du PTS : Protein Tracking System Version Février 2012 2012 by AgileBio. & Sommaire 1- INTRODUCTION... 3 2- INSTALLATION... 4 3- GENERALITES...

Plus en détail

L espace étudiant : les services numériques et le Bureau Virtuel Mode d emploi à destination des étudiants en formation à distance

L espace étudiant : les services numériques et le Bureau Virtuel Mode d emploi à destination des étudiants en formation à distance L espace étudiant : les services numériques et le Bureau Virtuel Mode d emploi à destination des étudiants en formation à distance Inscrit(e) comme étudiant(e) à l Université Michel de Montaigne Bordeaux

Plus en détail

Soutien technique en informatique

Soutien technique en informatique Service de formation aux adultes Soutien technique en informatique PLAN DE COURS Utilisation et création de bases de données 420-B64-GR 2-2-2 75 heures Session automne 2010 NOM DE L ENSEIGNANT : JIE YANG

Plus en détail


LA CARTE D'IDENTITÉ ET MICROSOFT OFFICE LA CARTE D'IDENTITÉ ET MICROSOFT OFFICE Ce manuel s adresse aux utilisateurs qui veulent signer des documents Word et Excel avec la nouvelle carte d identité. Dans ce manuel, nous vous expliquons rapidement

Plus en détail

ETN-1001 Exercices méthodologiques

ETN-1001 Exercices méthodologiques ETN-1001 Exercices méthodologiques SONIA LÉGER CONSEILLÈRE À LA DOCUMENTATION ETHNOLOGIE AUTOMNE 2012 Au terme de cette présentation, vous serez en mesure de : Connaître la différence entre le catalogue

Plus en détail

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires).

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Objectifs de la fiche : 1. Ouvrir des séquences (ADN ou protéine). 2. Changer de règle de numérotation & faire apparaître

Plus en détail

1. L initiation aux problématiques bioinformatiques liées à l'émergence des nouvelles biotechnologies

1. L initiation aux problématiques bioinformatiques liées à l'émergence des nouvelles biotechnologies LICENCE PROFESSIONNELLE BIOTECHNOLOGIE OPTION BIOINFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean- François Zagury

Plus en détail



Plus en détail

Guide préparatif «Automatiser sa vigie sur Twitter avec R» 1

Guide préparatif «Automatiser sa vigie sur Twitter avec R» 1 Guide préparatif «Automatiser sa vigie sur Twitter avec R» 1 Date : Jeudi 25 juin 2015 Horaire : 9h à 16h Local : C-2059 Adresse : Université de Montréal Pavillon Lionel Groulx 3150, rue Jean-Brillant

Plus en détail

Directives pour la préparation des candidatures au Prix de réalisation en éducation de l ATC

Directives pour la préparation des candidatures au Prix de réalisation en éducation de l ATC Directives pour la préparation des candidatures au Prix de réalisation en éducation de l ATC Les directives qui suivent s appliquent à la préparation des candidatures au Prix de réalisation en éducation

Plus en détail

L intelligence documentaire Au service de l expertise Comptable

L intelligence documentaire Au service de l expertise Comptable Groupe Locasystem International L intelligence documentaire Au service de l expertise Comptable Externalisation du processus de Saisie des Pièces Comptables et de génération des écritures à la norme de

Plus en détail

SyMeTRIC. projet régional pour le développement de la Médecine Systémique.

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. SyMeTRIC projet régional pour le développement de la Médecine Systémique portage scientifique : Jérémie Bourdon (LINA), Richard Redon (Inst. du Thorax) Systems Medicine Développer

Plus en détail

Dématérialisez, classez et partagez facilement vos documents d entreprise

Dématérialisez, classez et partagez facilement vos documents d entreprise Open Bee Scan Portal TM Dématérialisez, classez et partagez facilement vos documents d entreprise 85 kg de papier sont aujourd hui consommés par employé de bureau et par an (soit près de trois ramettes

Plus en détail



Plus en détail

IFT6251 : Sujets spéciaux en génie logiciel

IFT6251 : Sujets spéciaux en génie logiciel IFT6251 : Sujets spéciaux en génie logiciel Yann-Gaël Guéhéneuc Professeur adjoint, local 2345 Département d informatique et de recherche opérationnelle Université de Montréal

Plus en détail

Office national de l énergie Dossier : OF-AF-SAC-01 Demande de renseignements n o Gr2 COM 1

Office national de l énergie Dossier : OF-AF-SAC-01 Demande de renseignements n o Gr2 COM 1 Page 1 sur 5 Crescent Point Energy Corp. (CPEC) : d approbation des processus et mécanisme envisagés pour le prélèvement des fonds de cessation d exploitation de pipelines Déposée le 30 mai 2013 Office

Plus en détail

Échéancier Hiver 2014

Échéancier Hiver 2014 Département de langues modernes Échéancier Hiver 2014 Cours : Anglais 604-TE2-SH Anglais langue seconde, Formation générale propre au programme: niveau II (2-1-3) 2 Unités Groupes : 6724, 6725, 6726, 6727

Plus en détail

Outil pédagogique d orientation scolaire et professionnelle Réalisé par : Geneviève Lemay, CISEP Janvier 2011

Outil pédagogique d orientation scolaire et professionnelle Réalisé par : Geneviève Lemay, CISEP Janvier 2011 Mon choix après le Collège Français Outil pédagogique d orientation scolaire et professionnelle Réalisé par : Geneviève Lemay, CISEP Janvier 2011 1 Plan de la présentation La documentation relative à la

Plus en détail

Gestion, classement et rédaction efficaces des courriels

Gestion, classement et rédaction efficaces des courriels Gestion, classement et rédaction efficaces des courriels Pour passer rapidement de la surcharge à la maîtrise de ses courriels Introduction Le courriel est rapide, instantané, il voyage à faible coût et

Plus en détail

Guichet-étudiant/Info campus INTRODUCTION AU LOGICIEL WORD 2010

Guichet-étudiant/Info campus INTRODUCTION AU LOGICIEL WORD 2010 Guichet-étudiant/Info campus INTRODUCTION AU LOGICIEL WORD 2010 Conçu par : Olivier Gingras, animateur d activités étudiantes Juillet 2014 TABLE DES MATIÈRES 1. ONGLET FICHIER... 3 1.1. Localisation de

Plus en détail

Laboratoire 4 Développement d un système intelligent

Laboratoire 4 Développement d un système intelligent DÉPARTEMENT DE GÉNIE LOGICIEL ET DES TI LOG770 - SYSTÈMES INTELLIGENTS ÉTÉ 2012 Laboratoire 4 Développement d un système intelligent 1 Introduction Ce quatrième et dernier laboratoire porte sur le développement

Plus en détail

Connectiques et Utilisation d un disque dur multimédia MMEMUP

Connectiques et Utilisation d un disque dur multimédia MMEMUP Date : TP : Disque dur multimédia MMEMUP Nom : Prénom : Classe : Groupe : Bac Pro SEN Hazebrouck Enseignement PROFESSIONNEL. Lycée Saint Joseph Connectiques et Utilisation d un disque dur multimédia MMEMUP

Plus en détail



Plus en détail


GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS GUIDE D UTILISATION DE LA PLATEFORME D ENVOI DE COURRIELS Table des matières Présentation de la plateforme d envoi de courriels... 4 1- Gestion des contacts... 5 1.1. Base de données... 5 1.1.1- Création

Plus en détail

Les grands reliefs du Canada

Les grands reliefs du Canada Les grands reliefs du Canada Aperçu général Dans cette leçon, les élèves identifient, décrivent et expliquent les processus qui ont formé les grands reliefs du Canada. Ils dressent une carte de ces grands

Plus en détail

Plan de formation ADP Workforce Now pour les praticiens en ressources humaines

Plan de formation ADP Workforce Now pour les praticiens en ressources humaines Plan de formation ADP Workforce Now pour les praticiens en ressources humaines Voici le plan de formation recommandé, basé selon votre rôle. Vous pouvez suivre tout ou une partie de la formation cidessous.

Plus en détail

Banque des intervenants SAT. Guide d utilisation externe

Banque des intervenants SAT. Guide d utilisation externe Banque des intervenants SAT Guide d utilisation externe Février 2014 Table des matières TABLE DES MATIÈRES 1. INTRODUCTION... 1 2. ACCÈS À L APPLICATION... 2 3. CRÉATION D UN COMPTE... 3 3.1. INTERVENANTS

Plus en détail

La création d un jeu de sauvegarde (backup set) consiste à déterminer les données qui doivent être sauvegardées sur les serveurs Eurobackup.

La création d un jeu de sauvegarde (backup set) consiste à déterminer les données qui doivent être sauvegardées sur les serveurs Eurobackup. Création du jeu de sauvegarde La création d un jeu de sauvegarde (backup set) consiste à déterminer les données qui doivent être sauvegardées sur les serveurs Eurobackup. Etape 1 : introduire son identification

Plus en détail

IFT2251 Introduction au génie logiciel Hiver 2006 (4 crédits) Prof. : Julie Vachon. Plan de cours

IFT2251 Introduction au génie logiciel Hiver 2006 (4 crédits) Prof. : Julie Vachon. Plan de cours IFT2251 Introduction au génie logiciel Hiver 2006 (4 crédits) Prof. : Julie Vachon ** Début des cours : le lundi 9 janvier 2006 ** Plan de cours 1. Introduction Les exigences et les attentes à l égard

Plus en détail