Informatique et biologie moléculaire

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Informatique et biologie moléculaire"

Transcription

1 UE 1B-biomolécules, génome, bioénergétique, métabolisme, méthodes d étude et analyse du génome II-le génome : sa structure, son expression Organisation, évolution et fonction du génome humain Approches pan-génomiques Bio-informatique PACES Pr Nicolas SEVENET Informatique et biologie moléculaire Avertissement Utilisation par le biologiste de l outil informatique Bases/banques de données Définition Développement des outils informatiques (science de l information) Permettant d extraire une signification biologique de résultats expérimentaux (science du vivant) Paradoxe Avec le développement des techniques pan-génomiques, le biologiste n est plus capable d interpréter seul le résultat de ses expériences (microarrays, NGS) 1

2 Les 2 sites de bioinformatique les plus importants au monde EBI (EMBL) European Bioinformatics Institute Cambridge, UK out_ebi/about_ebi.html NCBI National Center for Biotechnology Information, National Library of medicine, National Institutes of Health Bethesda, MD, USA Trier l information Masse de l information Retrouver des informations stockées en banque de données (interrogation (requête), soumission, maintenance) Dry lab (biologie sèche) Les banques de données en ligne les compilateurs de bases de données (méta-moteur; méta-banques de données) Entrez NCBI Genecards Genome Browser Le site de recherche bibliographique PubMed Les sites de données spécialisés Séquences des gènes (Refseq, GenBank) Variations polymorphes de l ADN (dbsnp) Séquences et fonctions des protéines (UniProt) 2

3 Listing des banques de données Pendant ce cours Générer l information : bio-informatique liée au NGS Analyses Fichiers de sortie Interprétation des résultats Stocker l information : Banques de données Diverses Objectif et utilisation respectifs Exemples Utiliser une information Trouver une séquence de référence Connaître la structure intron-exon d un gène Dessiner des oligonucléotides de PCR (amorces/primers) 3

4 Générer l information BIOINFORMATIQUE LIÉE AU NGS Enchaînement des étapes Item Analyse primaire Analyse secondaire Analyse tertiaire Visualisation PGM Ion torrent Life technologies Fichiers sortie de run.dat.cel Fichiers de séquence (base calling + Phred score) Alignement sur le génome de référence (par exemple BWA Picard tools) Détection des variants (par rapport au génome de référence) Annotation des variants SFF Fastq MiSeq Illumina Fastq Sam (Sequence Alignment/map) puis bam (format compressé binaire du précédent) Vcf (variant call format) Par exemple VEP (Variant Effect Predictor) ANNOVAR Par exemple IGV (Integrative Genome Viewer) Alamut (Interactive Biosoftware) 4

5 Stocker l information MÉTA-BANQUES DE DONNÉES Gène Le fil rouge du cours : RB1 RB1 : RetinoBlastoma 1 Code une protéine impliquée dans le contrôle du cycle cellulaire (entrée en phase S après la phase G1) Retrouvé muté dans les rétinoblastomes (tumeurs oculaires de l enfant) certains sarcomes 5

6 Diapo 40 cours UE2 JB Corcuff contrôle moléculaire du cycle cellulaire, contrôle de la transition G1/S Entrez NCBI 6

7 Contenu Les banques de données universelles en génétique Génome Gène, localisation chromosomique, séquence génomique Transcrits Protéine description localisation Anticorps Fonctions, voies fonctionnelles, classification «ontologique» Dysfonction, pathologies Références bibliographiques Genecards 7

8 UCSC Genome Browser Outil de cartographie du génome Rentrer RB1 dans cette fenêtre UCSC Genome Browser Fenêtre de localisation du gène demandé (RB1) Exons 8

9 BIBLIOGRAPHIE PubMed 9

10 Les publications sont classées en ordre décroissant de leur date de sortie (les plus récentes en premier (haut de liste)) SITES SPÉCIALISÉS 10

11 Nucléotides Banques de données primaires 3 dans le monde DDBJ (Japon) European Nucleotide Archive (Europe) GenBank (NCBI, USA) Banque de données spécialisées RefSeq (NCBI) fournir, à une position nucléotidique couverte par plusieurs séquences primaires, un identifiant unique Genatlas (France) structure intron-exon d un gène European Nucleotide Archive 11

12 dbsnp Banque de données de polymorphismes Polymorphisme définition Le polymorphisme correspond à une variation d une à quelques bases de l ADN sans retentissement sur la structure, la fonction ou l expression de la protéine Définit un allèle (version alternative d un gène) Polymorphisme simple de nucléotide (Single Nucleotide Polymorphism) Seul un nucléotide varie à une position donnée Exon 4 gène RB1 Rentrer RB1 dans cette fenêtre 12

13 Résultats SNP RB1 Protéines - UniProt Rentrer RB1 dans cette fenêtre 13

14 RB1 Uniprot Quelle protéine de référence choisir? retour à genecards 14

15 Genecards permet de choisir la bonne référence protéique Fiche Uniprot RB1 15

16 Objectif : Banques de dépôt Déposer le résultat d expériences D autres équipes peuvent alors les télécharger et traiter avec leurs outils ce résultat partage Partage de données et comparaison validation in silico 2 bases essentiellement GEO (Gene Expression Omnibus) Array-express Rentrer RB1 dans cette fenêtre 16

17 Résultat requête RB1 La plateforme où a été faite l expérimentation (biopuce) Le code de la série expérimentale pour le sujet donné (biopuces) Les résultats de chaque manip d hybridation Utiliser l information APPLICATIONS PRATIQUES 17

18 ADN Que faire? Trouver une séquence de référence RefSeq Connaître la structure intron-exon d un gène Genatlas Dessiner des amorces de PCR Primer 3 Pathologies Savoir si un gène est muté dans certaines pathologies COSMIC : Catalogue Of Somatic Mutation in Cancer OMIM : Online Mendelian Inheritance in Men Savoir qui, en France, peut prendre en charge une pathologie rare, ou le diagnostic mutationnel d un gène? Orphanet : portail des maladies orphelines Trouver la séquence de référence d un gène? Etape 1 : RefSeq (NCBI) Etape 2 Search : NUCLEOTIDE et nom du gène 959 résultats! 18

19 Trouver la séquence de référence d un gène? Restreindre à - Homo Sapiens (167) - Refseq (227) - 37 séquences Tri par accession number Contigs : ensemble de séquences assemblées, localisées sur le chromosome, qui ont servir à déduire la RefSeq RefSeq génomique Gènes comprenant RB1 dans leur titre mais n ayant rien à voir avec RB1 RefSeq ARN messager 19

20 Connaître l organisation intron/exon d un gène?? Geneatlas Puis Rentrer RB1 dans Symbol Name 20

21 Cliquer sur see the exons Codage des RefSeq et longueur des fragments des RefSeq Intron-exons : L ADN intronique est en bleu et minuscules, la séquence exonique en noir et majuscules (noir caractères gras = séquence codante) 21

22 Trouver des amorces de PCR??? Objectif : cribler et/ou séquencer un gène (un exon) à la recherche de mutations ponctuelles délétères (diagnostic mutationnel/biologique) Rechercher des amorces déjà publiées PubMed avec comme mot d entrée, le nom du gène Créer de nouvelles amorces in silico Primer3 Les primers créés sont-ils spécifiques? Alignement de séquences (Blast) Permet de voir si les séquences retrouvées par Blast après alignement des primers sont réellement spécifiques Matrice + Thermocycleur 22

23 Départ 1 copie de l exon 1 du gène b Après 1 cycle copies (2 1 ) Après 2 cycles 4 copies (2 2 ) zone amplifiée Après 3 cycles Après n cycles 8 copies (2 3 ) 2 n copies 23

24 Exemple primer 3 On copie la séquence de l exon 4 avec les séquences introniques adjacentes Des symboles <> sont placés de part et d autre de la séquence exonique (en majuscule) pour interdire que les primers soient dans cette zone (qu on voudra analyser après PCR) Résultats primer 3 Primer forward La séquence qui avait été encadrée de <> est marquée de X symbolisant une zone d exclusion de choix de primers Primer reverse 24

25 Alamut La représentation du gène dans sa totalité La séquence nucléotidique avec le dénombrement des nucléotides depuis le A de l ATG (base 1) RB1 exon 4 La traduction protéique avec le dénombrement des codons (AA) depuis le 1 er (ATG = Met) Les polymorphismes connus Les mutations délétères rapportées dans les bases de données La conservation phylogénétique 25

26 Les séquences introniques encadrant l exon 4 de RB1 Intron 3 Intron 4 Blast Vérification Comparaison de séquences Principe Exemple d utilisation Aligner la séquence de chacun des primers afin de voir si la bonne séquence nucléotidique est retrouvée. Adresse du site internet 26

27 On copie la séquence du primer forward dans la fenêtre de requête Blast en cours 27

28 Résultat 1 ère requête Blast Code couleur des scores d alignement Le classement se fait par ordre décroissant de similarité (score d alignement) Suite résultats Blast 28

29 Blast primer reverse GenBank RB1 Primer forward Primer reverse 29

30 Catalogue des mutations du gène RB1 /genetics/cgp/cosmic/ Rentrer RB1 dans cette fenêtre Résultat requête RB1 Cliquer sur RB1 30

31 Résultat requête RB1 La répartition des mutations le long de la séquence codante de RB1 Répartition des mutations RB1 dans les cancers humains Quelles sont les mutations contenues dans l exon 4 de RB1? Comme on connaît les AA de l exon 4 fenêtre de recherche limitée aux AA 127 à 167 inclus 31

32 Pathologies liées à RB1 Online Mendelian Inheritance in Men (OMIM) Rentrer RB1 dans cette fenêtre 32

33 Résultat requête RB1 Cliquer sur RB1 TEXT Cloning Gene structure Mapping Gene Function Evolution Molecular Genetics Retinoblastoma Small Cell Lung cancer Allelic variants (28) Rapporte certaines mutations remarquables References (80) Contributors Creation date Edit history (de la fiche!) 33

34 Trouver une consultation en Europe concernant le rétinoblastome consor4.01/www/cgibin/index.php?lng=fr Rentrer RB1 dans cette fenêtre 34

35 Trouver une consultation en Europe concernant le rétinoblastome consor4.01/www/cgibin/index.php?lng=fr Rentrer Rétinoblastome dans cette fenêtre Cliquer sur Rétinoblastome 35

36 Cliquer sur «centres experts», sélectionner «France» puis «consultations et conseil génétique» Aquitaine - rétinoblastome Pas de consultation spécialisée, mais 5 consultations de conseil génétique 36

37 Que retenir du cours? Les grandes voies de recherche d information Bibliographie ADN protéines Applications pratiques quel site permet de trouver quelle information? Les principes sous-jacents des banques lorsqu ils sont énoncés Les noms généraux des sites (ex : Pubmed, OMIM,.) Ne pas retenir les détails Pour chaque site internet concernant la requête précise RB1 Les adresses internet! 37

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

La base de données MEDLINE

La base de données MEDLINE La base de données MEDLINE La base de données MEDLINE est produite par la National Library of Medicine (NLM) aux Etats-Unis. Elle couvre tous les domaines biomédicaux : médecine, biologie, toxicologie,

Plus en détail

Bases de données et outils bioinformatiques utiles en génétique

Bases de données et outils bioinformatiques utiles en génétique Bases de données et outils bioinformatiques utiles en génétique Collège National des Enseignants et Praticiens de Génétique Médicale C. Beroud Date de création du document 2010-2011 Table des matières

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Véronique Giudicelli LIGM, IGH, UPR CNRS 1142 141 rue de la Cardonille 34296 Montpellier

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Yvan Le Bras, Projet e-biogenouest, CNRS UMR 6074 IRISA-INRIA, Rennes I. Informations globales

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

Les anticorps : un outil pour la biologie moléculaire

Les anticorps : un outil pour la biologie moléculaire Master 2-Biotechnologies Parcours Cytologie Moléculaire Appliquée UE Immunoinformatique-Immunotechnologies Les anticorps : un outil pour la biologie moléculaire Ounissa AÏT AHMED Institut de Génétique

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM

Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Alignement de séquences, manipula3on, contrôle- qualité et analyse de fichiers SAM/BAM Stéphanie Le Gras DU Dijon Objec3fs Préparer les données avant de faire l analyse de variants Comprendre à quoi sert

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

Outils de gestion des ressources biologiques

Outils de gestion des ressources biologiques Le Cahier des Techniques de l INRA 2015 (84) N 1 Outils de gestion des ressources biologiques Frédéric Sanchez 1 *, Tou Cheu Xiong 1 Résumé. Les recherches en biologie génèrent un grand nombre d échantillons

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan M Bioinformatique, Connaissances et Données Année 24-25 GMIN206 Info. Biologique et Outils bioinformatiques Banques de données biologiques (3h de Cours +,5h de TD + 4h de TP) Elodie Cassan Anne-Muriel

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

! Séquence et structure des macromolécules. " Séquences protéiques (UniProt) " Séquences nucléotidiques (EMBL / ENA, Genbank, DDBJ)

! Séquence et structure des macromolécules.  Séquences protéiques (UniProt)  Séquences nucléotidiques (EMBL / ENA, Genbank, DDBJ) Introduction à la Bioinformatique Introduction! Les bases de données jouent un rôle crucial dans l organisation des connaissances biologiques.! Nous proposons ici un tour rapide des principales bases de

Plus en détail

Éditeur Elsevier Langue(s) Multilingue

Éditeur Elsevier Langue(s) Multilingue Science Direct Type Périmètre d'abonnement Articles en ligne, Livres électroniques Freedom Collection, intégralité des archives des revues, série de livres électroniques en génétique Domaine Public Pluridisciplinaire

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 Analyse de Séquences M1 BIBS 2 e partie http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 1 Les programmes Génome 2 Les programmes Génome Préhistoire Séquençage de Sanger Avant le séquençage d organismes:

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs?

Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs? Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs? Dr Xavier Manival, Laboratoire IMoPA, CR, CNRS Françoise Tisserand-Bedri, Documentaliste, Inist-CNRS

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Séminaire d Animation de l Axe 1 du Cancéropole Nord-Ouest :

Séminaire d Animation de l Axe 1 du Cancéropole Nord-Ouest : Séminaire d Animation de l Axe 1 du Cancéropole Nord-Ouest : «Le Séquençage de Nouvelle Génération dans le Cancéropole Nord-Ouest : Evolution, Résultats, Projets» 1 INTRODUCTION Pierre FORMSTECHER Le Président

Plus en détail

Réplication de l ADN. Dr Annie M. Bérard Dr Nicolas Sévenet. Avertissement

Réplication de l ADN. Dr Annie M. Bérard Dr Nicolas Sévenet. Avertissement Année 2013-2014 UE 1 Atomes, biomolécules, génome, bioénergétique, métabolisme III-le génome : sa structure, son expression Organisation, évolution et fonction du génome humain Réplication de l ADN Dr

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques QUELQUES MOTS SUR LA BIOINFO Cours d'introduction à la bioinformatique et de présentation des banques de séquences. Connaissances 1 ère partie Equipe Bonsai (2014)

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques Cours d'introduction à la bioinformatique et de présentation des banques de séquences. 1 ère partie Equipe Bonsai (2014) QUELQUES MOTS SUR LA BIOINFO Connaissances

Plus en détail

La santé des sols: Présentation LEM du 30 avril et du 1er mai 2014

La santé des sols: Présentation LEM du 30 avril et du 1er mai 2014 La santé des sols: Opportunités et applications des nouvelles technologies de biologie moléculaire et de séquençage Laboratoire d écologie microbienne (IRDA) Présentation LEM du 30 avril et du 1er mai

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Formation Python. Sandra Dèrozier & Franck Samson 13 Juin 2014

Formation Python. Sandra Dèrozier & Franck Samson 13 Juin 2014 Formation Python Sandra Dèrozier & Franck Samson 13 Juin 2014 Programme Présentation rapide de Python Présentation d Eclipse Gestion de fichiers Fonctions Utilisation des exceptions Expressions régulières

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

Formation Génomique et élevage. Glossaire de génétique moléculaire (animale)

Formation Génomique et élevage. Glossaire de génétique moléculaire (animale) Formation Génomique et élevage Rennes 21-23 novembre 2005 Glossaire de génétique moléculaire (animale) Version 1.1 Français (anglais) Les mots soulignés sont des entrées de ce glossaire ADN (DNA) : acide

Plus en détail

Recherche et veille documentaire scientifique

Recherche et veille documentaire scientifique Recherche et veille documentaire scientifique Élodie Chattot BU Médecine Pharmacie juin 2006 Introduction Le but de cet atelier est de vous initier à la méthodologie de recherche documentaire scientifique,

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire UE09s Méthodes d étude et analyse du génome Applications des techniques du génie génétique à la thérapie des maladies acquises Exemples en cancérologie Thérapie ciblée Théranostique Plan du cours Introduction

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Fouille de données/machine Learning/

Fouille de données/machine Learning/ Fouille de données/machine Learning/ Big Data Qu'est-ce que c'est? Ouvrages : Bioinformatics: The Machine Learning Approach, Second Edition (Adaptive Computation and Machine Learning) 2001 par Pierre Baldi

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Le point de vue du biologiste : L activité des plateformes de génétique moléculaire

Le point de vue du biologiste : L activité des plateformes de génétique moléculaire Le point de vue du biologiste : L activité des plateformes de génétique moléculaire Institut de Cancérologie de Lorraine Service de Biopathologie CNRS UMR7039 CRAN Université de Lorraine Jean-Louis Merlin

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail