DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL"

Transcription

1 6 LE TEST

2 DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après grossesse 7 Selon Bodurtha J, Strauss JF III. N Engl J Med 2012;366:64-73.

3 DIAGNOSTIC PRÉNATAL NON INVASIF ADN fœtal libre plasmatique 1997 Découverte ADN fœtal plasmatique 2001 Diagnostic de sexe fœtal 2002 Génotypage rhésus D? 2011 Test génétique non invasif de la trisomie 21 8

4 DIAGNOSTIC PRÉNATAL NON INVASIF : CHALLENGE LE «BACKGROUND» ADN MATERNEL Fraction fœtale : 5-10 % âge gestationnel body mass index BMI anomalie chromosomique chez le fœtus ethnie? Fetal cell Cell isolation ADN maternel ADN fœtal 9 Selon Bodurtha J, Strauss JF III. N Engl J Med 2012;366:64-73.

5 ANALYSE DE L ADN FŒTAL CIRCULANT : LE «BACKGROUND» ADN MATERNEL ADN fœtal ADN fœtal Analyse qualitative (Recherche de marqueurs fœtaux absents du génome maternel ) Détermination du sexe fœtal Génotypage RHD, Ce et Kell Achondroplasie, hypochondroplasie et nanisme thanatophore (de novo) Analyse quantitative (Marqueurs fœtaux spécifiques ou non) Aneuploïdies 10

6 ANALYSE QUANTITATIVE NON SPÉCIFIQUE! Challenge : exemple d un fœtus féminin 46,XX ADN fœtal 47,XX,+21 ADN fœtal 90 ADN maternel 10 ADN fœtal 21 ADN fœtal autre 90 ADN maternel 15 ADN fœtal 21 ADN fœtal autre Chromosome 21 : 1.35% -> 1.45% 11

7 DOSAGE CHROMOSOMIQUE FŒTAL! Quantification par «Massively Parallel Sequencing (MPS)» 18 patientes (terme médian: 18 semaines) Tous les cas (9) correctement identifiés 14 patientes (terme médian : 14 semaines) Tous les cas (9) correctement identifiés 12

8 SÉQUENÇAGE À HAUT DÉBIT : UNE RUPTURE TECHNOLOGIQUE Par run Séquençage SANGER Séquençage MPS Petit débit Séquençage MPS Haut débit Ratio Instrument ABI3130XL Illumina MiSeq Illumina 1500 Taille des fragments 500bp 27bp 27bp Durée 6h 5h 34h Nombre de reads millions (single reads 36bp) 1.5 milliards (single reads 27bp) Capacité 50KB ( ) 15GB (5 10+9) 300GB ( ) X 300 X Génome humain 3GB Exome humain 30MB AUDI A1 105CH ARIANE CH 13

9 ANALYSE QUANTITATIVE NON SPÉCIFIQUE! Concept Quantité attendue pour le chromosome 21 Chromosome 21 en excès Fan HC, Quake SR. Sensitivity of noninvasive prenatal detection of fetal aneuploidy from maternal plasma using shotgun sequencing is 14 limited only by counting statistics. PLoS One May 3;5(5):e10439

10 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 1 Préparation de l échantillon Délai entre prélèvement sanguin et préparation du plasma Double centrifugation du plasma Extraction de l ADN plasmatique Purification compatible avec les réactions enzymatiques ultérieures (biais)! Stabiliser l ADN fœtal! Conserver la fraction fœtale! Enrichir en ADN fœtal 15 J0

11 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 2 Séquençage (part 1) Préparation de la «librairie» Réparation des extrémités Adénylation des extrémités Ligation des adaptateurs (+index) Enrichissement de la «librairie»! Préparer les fragments d ADN à être séquencés 16 J1

12 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 2 Séquençage (part 2) Qualification de la «librairie» Quantification de la «librairie» Normalisation de la «librairie» Multiplexage Hybridation sur flow cell Clusterisation! Traiter un grand nombre d échantillons! Transférer sur le support final de séquence 17 J2

13 J2 18

14 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 2 Séquençage (part 3) Séquençage > 10 millions de cluster par ligne (X8 par flow cell) 300GB 19 J2 J5

15 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 3 Analyse bioinformatique Par run machine >1 Terabyte! Transformer les images en séquence ADN! Analyser les séquences! Faire les calculs 20 J0 J5

16 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT% x9 10+6/échantillon Calcul de la fraction chromosomique =% de l échantillon par rapport au total des chromosomes Calcul du Z-score =% sample-mean% référence/sd médiane% référence Interprétation 21

17 DOSAGE CHROMOSOMIQUE FŒTAL PAR MPS 21-3,00 0,00 3,00 6,00 9,00 12,00 15,00 18,00 21,00 24,00 27,00 30, ,00 0,00 3,00 6,00 9,00 12,00 15,00 18,00 21,00 24,00 27,00 30, ,00 0,00 3,00 6,00 9,00 12,00 15,00 18,00 21,00 24,00 27,00 30,00 22 Un Z-score de 3 signifie que la valeur mesurée est distante de 3 écarts-types de la valeur cible. La probabilité de trouver une valeur à l extérieur est de 0,17% pour une distribution normale. Si une valeur est à l extérieur, cela ne peut s expliquer par les simples fluctuations statistiques.

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21

ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 ANALYSE DE L ADN FŒTAL DANS LE SANG MATERNEL: APPLICATION A LA TRISOMIE 21 JM Costa 5èmes Journées de Biologie Praticienne Mazagan, 4-5 Avril 2014 LABORATOIRE CERBA, Laboratoire du réseau DIAGNOSTIC PRÉNATAL

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

On en vient maintenant au test lui-même.

On en vient maintenant au test lui-même. On en vient maintenant au test lui-même. 6 Avant d envisager la technologie elle-même, quelques mots sur le diagnostic prénatal non invasif qui est réalisé historiquement à partir du sang maternel. On

Plus en détail

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité PARIS ILE-DE-FRANCE OUEST Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité Françoise Muller Hôpital Robert Debré Le contexte Le dépistage prénatal de la trisomie 21 repose sur

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France

Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Dépistage Non Invasif de la T21 Oùen sommes nous? Alexandra Benachi, Jean-Marc Costa Hôpital Antoine Béclère. Clamart-France Laboratoire CERBA-France Pr Alexandra Benachi Exerçant au CHU Antoine Béclère,

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Qu'est-ce que nukleo?

Qu'est-ce que nukleo? Qu'est-ce que nukleo? nukleo est un test prénatal non invasif qui permet de dépister la trisomie 21 et d autres anomalies chromosomiques chez le fœtus. nukleo est réalisé à partir d'une simple prise de

Plus en détail

Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant

Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant Place de la PCR digitale dans le dépistage non invasif des aneuploïdies à partir de l ADN fœtal circulant Dr Laïla El Khattabi Service de Cytogénétique, Hôpital Cochin, Paris DPNT21 en France aujourd hui

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

21.09.2015. Sujets. L histoire de l ADN fœtal libre. Il faut savoir que. La technique: Femme normale. Découvertes à la base des tests NIPT

21.09.2015. Sujets. L histoire de l ADN fœtal libre. Il faut savoir que. La technique: Femme normale. Découvertes à la base des tests NIPT Dépistage Prénatal non invasif(dpni;nipt): possibilités et limites des nouveaux tests Dr. Giuditta Filippini FAMH génétique médicale European clinical laboratory geneticist Sujets Découvertes à la base

Plus en détail

Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel. Notice d information à l attention des parents

Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel. Notice d information à l attention des parents Dépistage prénatal des aneuploïdies fœtales par analyse de l ADN plasmatique maternel Notice d information à l attention des parents Madame, Monsieur, Le diagnostic prénatal de la trisomie 21 est organisé

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Quelques messages et points clés.

Quelques messages et points clés. Quelques messages et points clés. 40 On répétera que ce test n est pas un caryotype, que c est un test qui est réalisé à partir d un ADN qui provient de cellules trophoblastiques, donc on s attend dans

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Diagnostic prénatal non invasif (DPNI)

Diagnostic prénatal non invasif (DPNI) Diagnostic prénatal non invasif (DPNI) Etat des lieux des applications Charles COUTTON PHU, Génétique Chromosomique Colloque Médical du Jeudi 05 Mars 2015 Pourquoi? DPN: nécessite un geste invasif pour

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

POUR UNE GROSSESSE PLUS SEREINE...

POUR UNE GROSSESSE PLUS SEREINE... POUR UNE GROSSESSE PLUS SEREINE... Être parent change profondément une vie et constitue l une des plus belles expériences qui soit. Cette grande aventure apporte également d importantes responsabilités,

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif.

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif. 1 Normalement, chaque individu a dans chacune de ces cellules 23 paires de chromosomes numérotées de 1 à 22, la 23ème paire étant la paire des chromosomes sexuels. Une des anomalies chromosomiques les

Plus en détail

La médecine fœtale est une discipline

La médecine fœtale est une discipline Quel avenir pour le diagnostic prénatal? RÉSUMÉ : Le formidable essor des techniques de diagnostic prénatal a permis sans cesse des progrès depuis les années 80, dans la qualité du dépistage et du diagnostic

Plus en détail

Dépistage prénatal non-invasif des trisomies 13, 18 et 21

Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Le nouveau test de dépistage prénatal des trisomies sur prise de sang maternel Qu est-ce que le DPNI par Biomnis? Le DPNI est un examen innovant

Plus en détail

SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004

SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004 SUIVI PRENATAL ET INTRAPARTUM PROF. ROBERT J.I. LEKE MAI 2004 SOINS PRENATAUX (1) Soins prénataux constituent une avance significative dans les soins obstétricaux. Soins prénataux sont une pratique universelle.

Plus en détail

L année en gynécologie-obstétrique. 1. Un peu d histoire

L année en gynécologie-obstétrique. 1. Un peu d histoire L année en gynécologie-obstétrique Une étape supplémentaire a été de quantifier l ensemble de l ADN circulant et d identifier une différence en cas de fœtus aneuploïde, grâce à une méthode de quantification

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Dépistage / Diagnostic de la trisomie 21 en période prénatale

Dépistage / Diagnostic de la trisomie 21 en période prénatale Lyon Neuroscience Research Center Dépistage / Diagnostic de la trisomie 21 en période prénatale Damien Sanlaville Journée mondiale de la trisomie 21 Lyon, le 22 mars 2014 Un point crucial Bien comprendre

Plus en détail

-CN seuil à 3,5 mm. -MSM2T + CN -MSM2T sans mesure de CN - Signes Echographiques ET2 et ET3. -CN (seuil à 3,5 mm) et ET2 et ET3? -Suppression des MSM?

-CN seuil à 3,5 mm. -MSM2T + CN -MSM2T sans mesure de CN - Signes Echographiques ET2 et ET3. -CN (seuil à 3,5 mm) et ET2 et ET3? -Suppression des MSM? Quel dépistage de la trisomie 21 fœtale en 2015 : Marqueurs sériques maternels ou tests génétiques non invasifs? Françoise Muller et ABA Biochimie Prénatale Hôpital Robert Debré Francoise.muller@rdb.aphp.fr

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Dépistage prénatal 11 e -14 e semaine

Dépistage prénatal 11 e -14 e semaine 23 Dépistage prénatal 11 e -14 e semaine Brochure d information Pour vous, pour la vie Quelques faits. La grande majorité des bébés naissent normaux ;. Toutes les femmes, quelque soit leur âge, présentent

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique

La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique La valeur d un dépistage prénatal non invasif (DPNI). Supplément pour le document interactif d un conseiller en génétique Les DPNI utilisent l ADN acellulaire (cfdna). Échantillon de sang maternel cfdna

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique»

Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique» Résumés des projets de recherche financés dans le cadre de l appel d offre 2013 «AMP, diagnostic préimplantatoire et diagnostic génétique» Chercheur Sujet de recherche Subvention allouée BUJAN Louis DE

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES. LABORATOIRE CERBA, Laboratoire du réseau

TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES. LABORATOIRE CERBA, Laboratoire du réseau TEST GÉNÉTIQUE NON INVASIF DE LA TRISOMIE 21 ET AUTRES ANEUPLOÏDIES FŒTALES 1 LABORATOIRE CERBA, Laboratoire du réseau QU EST-CE QU EST LA TRISOMIE 21? } Syndrome de Down } Maladie génétique } Maladie

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

DATATION de la GROSSESSE

DATATION de la GROSSESSE DATATION de la GROSSESSE Julia BEGLER-FONNIER Maternité CHU CAREMEAU Intérêts Améliorer le pronostic de la grossesse: Déterminer la date d accouchement; Évaluer la croissance fœtale Pouvoir interpréter

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Dépistage prénatal non-invasif des trisomies 13, 18 et 21

Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Dépistage prénatal non-invasif des trisomies 13, 18 et 21 Le nouveau test de dépistage prénatal des trisomies sur prise de sang maternel Qu est-ce que le DPNI par Biomnis? Le DPNI est un examen innovant

Plus en détail

Collège de Gynécologie CVL

Collège de Gynécologie CVL Docteur Laurence GOT Docteur Béatrice LAUDIER Pôle Biopathologie CHR d Orléans 31 mai 2012 DEPISTAGE vs DIAGNOSTIC PRENATAL Dépistage : détermine si le fœtus a un risque augmenté d être porteur d une pathologie

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

Cours sur l anémie hémolytique du nouveau-né

Cours sur l anémie hémolytique du nouveau-né Cours sur l anémie hémolytique du nouveau-né né Dr Marie-José STELLING Musée des grenouilles à Estavayer-le-Lac Anémie hémolytique du nouveau-né né Trois conditions doivent être réunies: présence d un

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire.

Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire. Voyons maintenant les résultats du test qui est entièrement réalisé au sein du laboratoire. 23 Je vais vous présenter trois types de résultats. Le premier groupe de résultats consiste en une comparaison

Plus en détail

La géné'que médicale et les applica'ons du séquençage à haut- débit

La géné'que médicale et les applica'ons du séquençage à haut- débit La géné'que médicale et les applica'ons du séquençage à haut- débit Dr. Marco Belfiore FAMH en énétique Médicale Division de énétique et Infertilité ML-Laboratoires Médicaux / enesupport ARL, 02.10.2014

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

VALIDATION ANALYTIQUE DU TEST

VALIDATION ANALYTIQUE DU TEST 23 LES RÉSULTATS VALIDATION ANALYTIQUE DU TEST } Cerba vs laboratoire de référence : comparaison externe ü 176 échantillons traités en aveugle (single test) ü Mise en contrôle : 4 (taux de non rendu 2,3%)

Plus en détail

Prénatal Non Invasif. Dépistage Avancé Non Invasif dans le Plasma Maternel

Prénatal Non Invasif. Dépistage Avancé Non Invasif dans le Plasma Maternel Dépistage Avancé Non Invasif dans le Plasma Maternel Dépistage Diagnostic Avancé Prénatal Non Invasif NIPD: Non invasive prenatal diagnosis NIPT: Non invasive prenatal testing NIAPS: Non invasive advanced

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille

Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille ROBOTS DE NOUVELLE GÉNÉRATION POUR LE SÉQUENÇAGE (NGS): LES IMPLICATIONS Avant (1991-2005): les étapes du séquençage (ADN)

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Recommandations de l ACLF pour le de pistage non invasif des anomalies chromosomiques fœtales

Recommandations de l ACLF pour le de pistage non invasif des anomalies chromosomiques fœtales Recommandations de l ACLF pour le de pistage non invasif des anomalies chromosomiques fœtales Version 1-2015 1 Résumé Le DPNI est validé par la technique de MPS mais d autres techniques sont en cours de

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 «Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 COUTTON Charles Etude du Génome Cytogénétique Cytogénétique moléculaire Biologie moléculaire

Plus en détail

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise!

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise! Diagnostic moléculaire des tumeurs solides, l'expérience Rennaise Bioinformaticien, Biologiste moléculaire, Biostatisticien, Biologiste B. Ndiaye, M. de Tayrac, J. & A. Mosser Le#séquençage#à#haut#débit#NGS#dans#le#cadre#du#diagnos9c##

Plus en détail

OPINION DE COMITÉ DE LA SOGC

OPINION DE COMITÉ DE LA SOGC N 287, février 2013 État actuel du dépistage prénatal non effractif du syndrome de Down, de la trisomie 18 et de la trisomie 13 au moyen d ADN acellulaire se trouvant dans le plasma maternel La présente

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques 12 Où puis-je avoir plus d information sur les anomalies chromosomiques? Anomalies chromosomiques Ceci est un guide succinct sur les anomalies chromosomiques. Pour de plus amples informations vous pouvez

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

ADN ADN. "Tests génétiques, mythes et réalités" ADN dans la cellule. Tests génétiques : mythes et réalités. Application médicom

ADN ADN. Tests génétiques, mythes et réalités ADN dans la cellule. Tests génétiques : mythes et réalités. Application médicom "Tests génétiques, mythes et réalités" Docteur Romano La Harpe Institut de médecine légale Unité de médecine forensique Tests génétiques : ADN mythes et réalités Application médicalem Application médicom

Plus en détail

Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité. Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba

Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité. Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba Diagnostic de l enfant à naître dans le sang maternel : du rêve à la réalité Jean-Marc COSTA Génétique Moléculaire Laboratoire Cerba Paris le 13 avril 2013 Madame ABD, conductrice d hémophilie A sévère

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

LES EXAMENS BIOLOGIQUES EXPLIQUÉS

LES EXAMENS BIOLOGIQUES EXPLIQUÉS LES EXAMENS BIOLOGIQUES EXPLIQUÉS On vient de vous diagnostiquer une leucémie myéloïde chronique (LMC). Il se peut que vous ayez eu une analyse sanguine de routine demandée par votre médecin traitant ou

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL GENETIQUE MOLECULAIRE ANNEE :2015

RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL GENETIQUE MOLECULAIRE ANNEE :2015 RAPPORT ANNUEL DES ACTIVITES DE DIAGNOSTIC PRENATAL ANNEE :2015 Note relative au remplissage de ce rapport : Si vous rencontrez des difficultés à remplir ce rapport ou si des questions vous paraissent

Plus en détail

Les dispositifs médicaux de diagnostic in vitro SPLIT 06/11/06

Les dispositifs médicaux de diagnostic in vitro SPLIT 06/11/06 Les dispositifs médicaux de diagnostic in vitro Directive européenne 98/79/CE du 27/10/98 relative aux DMDIV OBJECTIFS Directive dite «Nouvelle approche» - Harmonisation des réglementations nationales

Plus en détail

Analyses - Liste des analyses à accompagner d'une attestation de consultation

Analyses - Liste des analyses à accompagner d'une attestation de consultation Analyses - Liste des analyses à accompagner d'une attestation de consultation Libellé Document a joindre au prelevement Acétylcholinestérase - liquide amniotique attestation de consultation et consentement

Plus en détail

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA 09 Octobre 2015 5 Mb Principe de la CGH array Nanotechnologie

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Facteurs Maternels Facteurs fœtaux Facteurs placentaires Facteurs externes Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Combien et lesquels? Quand? Comment?

Plus en détail

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier OneSeq : SNV CNV détection simultanée de CNV et de SNV en attendant le séquençage génome entier Nicolas Chatron 1,2, Marc Le Lorc h 3, Eudeline Alix 1, Matthieu Egloff 3, Didier Goidin 4, Jean-Philippe

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

GROSSESSE Ne rien oublier. 2. Suivi de la grossesse: le calendrier

GROSSESSE Ne rien oublier. 2. Suivi de la grossesse: le calendrier GROSSESSE Ne rien oublier 2. Suivi de la grossesse: le calendrier A / LE DEPISTAGE DU RISQUE DE TRISOMIE 21 Introduction: risque de l amniocentese Taux de dépistage Nombre de T21 dépistés Les faux positifs

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Catalogue des prestations et services

Catalogue des prestations et services PLATEFORME GÉNOME-TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Responsables des sites : Cestas

Plus en détail

La consultation de déclaration de grossesse

La consultation de déclaration de grossesse La consultation de déclaration de grossesse Dr Muriel Doret Maître de conférence universitaire - Praticien hospitalier Gynécologie Obstétrique Hôpital Femme-Mère-Enfant Les Jeudi de l Europe 38ième Forum

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Grossesse normale. Besoins nutritionnels d une femme enceinte (16) Professeur Marc Gamerre Mai 2005

Grossesse normale. Besoins nutritionnels d une femme enceinte (16) Professeur Marc Gamerre Mai 2005 Grossesse normale. Besoins nutritionnels d une femme enceinte (16) Professeur Marc Gamerre Mai 2005 1. Définition La grossesse se définit comme étant l état de la femme enceinte. La fécondation se fait

Plus en détail

Laboratoires TESTS DANS ENTIER.

Laboratoires TESTS DANS ENTIER. NIFTY est un test sanguin sécuritaire et facile qui détecte avec précision certaines conditions génétiques telles que le syndrome de Down, dès la 10 e semaine de votre grossesse. PLUS DE 600 000 TESTS

Plus en détail