Maintenabilité d un parc applicatif

Dimension: px
Commencer à balayer dès la page:

Download "Maintenabilité d un parc applicatif"

Transcription

1 1 Maintenabilité d un parc applicatif Une méthode pour évaluer les charges de maintenance 13/06/01 Jean-François Bailliot

2 2 Maintenabilité d un parc applicatif Maintenance / Développement importance relative des charges spécificités de la maintenance peu d études sur le sujet Objectif : auditer une maintenance existante dimensionner une équipe de TMA Méthode : questionnaires sur les applications utilisation d une base de données de maintenance et d un «modèle prédictif» des charges de maintenance attendues

3 3 Modèle d estimation Fondé sur : la taille de l application mesurée en points de fonction un certain nombre de paramètres : ancienneté, criticité, nombre de versions, d installations, expérience des équipes, quantité et qualité de la documentation, quantité et qualité des normes, etc.

4 4 Les étapes 1 collecte des éléments de taille ; mesure ou évaluation de la taille des applications en points de fonction 2 collecte des éléments de mesure des charges actuelles de maintenance 3 collecte des réponses au questionnaire 4 comparaison par rapport à la base de données de maintenance 5 rapport

5 5 Évaluation de la taille Méthodes de «backfiring» Entrées : éléments de taille : programmes, écrans, lignes de code, états, etc. Utilisation d une base de données d expérience Résultat : évaluation de la taille en points de fonction

6 6 Évaluation de la taille d une application Application A Application A : 500 points de fonction Application B Application B : 1200 points de fonction

7 7 Évaluation de la taille d un parc applicatif AA - xxxxxxxxxxxxxx BB - xxxxxxxxxxx A2 - xxxxxxxxx B1 - xxxxxxxx B2 - xxxxxxxxxx A1 - xxxxxxxx A3 B3 - xxxxxxx A4 - xxxxxxxxxx A5 - xxxxxxxxxx A6 - xxxxxxxxxxxxxx A7 - xxxxxxxxxxx CC - xxxxxxxx A8 - xxxxxx xxxxxx A9 - xxxxx AA AB C1 - xxxxxxxxxxxxx DD - xxxxxxxxxxx D1 - xxxxxx xxxxxxx D2 - xxxx xxxxxxxxx EE - xxxxxxxxxx E1 - xxxxxxx E2 - xxxxx E3 FF - xxxxxxxxxxx E4 - xxxxxxx F1 - xxxxxxx xxxxxxx F2 - xxxxxxxxx GG - xxxxxxxxxxx F3 - xxxxxxxxx F4 - xxxxxx G1 - xxxxxxxxxxxxxxx F5 F6 - xxxxxxxx G2 - xxxxxxxxxxxxxxxx G3 - xxxxxxxx xxxxx

8 8 Mesure de la charge charge globale en jours annuels, et décomposée en : maintenance de fonctionnement (corrective, préventive) assistance fonctionnelle évolutions (mineures et majeures) gestion

9 9 Paramètres du questionnaire exemple : ancienneté (1 à 4) depuis la première mise en place, ou depuis la dernière réécriture : 1 - moins de 3 ans 2 - entre 3 et 5 ans 3 - entre 6 et 10 ans 4 - plus de 10 ans

10 10 10 Modèle de maintenance Par exemple : Les applications de la base de données ayant la valeur 1 pour le paramètre «ancienneté» montrent une charge de fonctionnement moyenne de xm jours annuels par millier de points de fonction 50% de ces applications ont une charge comprise entre x1 et x2 jours annuels par millier de points de fonction. influence de l'ancienneté x2 intervalle à 50% charge de maintenance de fonctionnement xm moyenne x valeur du paramètre

11 11 11 Évaluation de la charge d une application (exemple) charges globales de maintenance du domaine AA intervalle à 50% moyenne global criticité origine interfaces ancienneté cplx alg cplx cod cplx dat nb versions plus. sources politique nb generateurs exper fonct exper techn qté doc qual normes qté normes jours annuels observé

12 12 12 Évaluation de la charge d une application (exemple) fonctionnement assistance évolution gestion

13 13 13 Interprétation ATTENTION! Le modèle n indique pas «la charge de maintenance idéale» Cette méthode ne peut être utilisée que pour identifier les applications pour lesquelles un complément d information est nécessaire

2 mois pour augmenter le chiffre d affaire

2 mois pour augmenter le chiffre d affaire Le courant passe Véronique Bessonnat, formatrice Georges Fourcade Directeur Commercial 2 mois pour augmenter le chiffre d affaire Entrepreneurs, commerciaux, Venez faire grimper votre chiffre avec nous!

Plus en détail

Manuel fournisseur : procédure pour prendre connaissance d une consultation en ligne et soumettre une offre. Version de février 2014 SNCF

Manuel fournisseur : procédure pour prendre connaissance d une consultation en ligne et soumettre une offre. Version de février 2014 SNCF Manuel fournisseur : procédure pour prendre connaissance d une consultation en ligne et soumettre une offre Version de février 2014 SNCF Introduction Ce document a pour objectif : De vous présenter, pas

Plus en détail

AIDE A LA TRANSMISSION DES SAVOIR- FAIRE

AIDE A LA TRANSMISSION DES SAVOIR- FAIRE FONDATION VMF 93 rue de l Université 75007 PARIS www.fondationvmf.org PAYS : DÉPARTEMENT (si France) : RÉGION (si étranger) : AIDE A LA TRANSMISSION DES SAVOIR- FAIRE NOM DE L ORGANISME PRÉSENTÉ : xxxxxxxxxxxxxxxxxxxxxxxxxxx

Plus en détail

DIAGNOSTIC DE L ETAT DES INSTALLATIONS INTERIEURES D ELECTRICITE DES IMMEUBLES A USAGE D HABITATION

DIAGNOSTIC DE L ETAT DES INSTALLATIONS INTERIEURES D ELECTRICITE DES IMMEUBLES A USAGE D HABITATION DIAGNOSTIC DE L ETAT DES INSTALLATIONS INTERIEURES D ELECTRICITE DES IMMEUBLES A USAGE D HABITATION Conformément au Code de la Construction et de l Habitation : articlel134, la LOI n 2006-872 du 13 juillet

Plus en détail

SUR OUVRAGE (D.I.U.O.)

SUR OUVRAGE (D.I.U.O.) INDE Prévention des risques d'accident du travail Coordination SPS 15 Rue St Marien- 89520- FONTENOY Tel: 09-75-91-11-78 Fax: 09-70-06-78-43 Site internet: sps-pro.com siret: 390 494 417 00053 affaire

Plus en détail

Sommaire. Problématique client et gains attendus Réponse IBM à la problématique du client Démarche de mise en œuvre Les leçons du projet

Sommaire. Problématique client et gains attendus Réponse IBM à la problématique du client Démarche de mise en œuvre Les leçons du projet Sommaire Problématique client et gains attendus Réponse IBM à la problématique du client Démarche de mise en œuvre Les leçons du projet Problématique client et gains attendus L objectif global du projet

Plus en détail

La Télédéclaration des Organismes de Formation

La Télédéclaration des Organismes de Formation La Télédéclaration des Organismes de Formation Ecran d accueil des TéléDéclarations site: https://www.declarationof.travail.gouv.fr/ Menu du site Pour s inscrire et se connecter sur le site Lien pour mettre

Plus en détail

UTILISATION DU WEB-FFS SUR FFSSKI (Dépôt des épreuves et inscription des concurrents)

UTILISATION DU WEB-FFS SUR FFSSKI (Dépôt des épreuves et inscription des concurrents) Création d un compte depuis FFSSKI : UTILISATION DU WEB-FFS SUR FFSSKI (Dépôt des épreuves et inscription des concurrents) A partir de la page d accueil du logiciel de course FFSSKI cliquez sur «Aucune

Plus en détail

CSP Comptabilité Fournisseurs. Cahier des charges Fournisseurs

CSP Comptabilité Fournisseurs. Cahier des charges Fournisseurs CSP Comptabilité Fournisseurs Cahier des charges Fournisseurs Formalisme des factures adressées à la SNCF Suivi des modifications Date de la modification Version Commentaires 10/09/2009 1 Rédaction du

Plus en détail

PREDURA TMS PREvention DURAble des TMS Programme de suivi des entreprises exposées au risque de TMS. Journées Marcel Marchand 23 novembre 2013

PREDURA TMS PREvention DURAble des TMS Programme de suivi des entreprises exposées au risque de TMS. Journées Marcel Marchand 23 novembre 2013 PREDURA TMS PREvention DURAble des TMS Programme de suivi des entreprises exposées au risque de TMS Journées Marcel Marchand 23 novembre 2013 Constat Les TMS continuent d augmenter. Nos actions touchent

Plus en détail

Yphise optimise en Coût Valeur Risque l informatique d entreprise

Yphise optimise en Coût Valeur Risque l informatique d entreprise Gérer le risque opérationnel ORM - Operational Risk Management Juin 2008 Xavier Flez yphise@yphise.com Propriété Yphise GM Gouvernance PR Projets IS Systèmes d Information SO Service Management 1 Le risque

Plus en détail

Convention de portage salarial Référence : XXXXX 2014

Convention de portage salarial Référence : XXXXX 2014 Convention de portage salarial Référence : XXXXX 2014 La convention est conclue entre les soussignés : Advizium 37, rue de Neuilly 92110 Clichy RCS Nanterre 499 404 390 Représentée par Monsieur Bertrand

Plus en détail

CAHIER DES CHARGES DE REALISATION DE SITE INTERNET

CAHIER DES CHARGES DE REALISATION DE SITE INTERNET CAHIER DES CHARGES DE REALISATION DE SITE INTERNET Nom de lʼentreprise : XXXX Adresse : xxxxxxxxxxxxxxx Tel : xxxxxxxxxxxxxx Email : xxxxxxxxxxxxxxxx Personne à contacter dans lʼentreprise : xxxxxxxx 1.

Plus en détail

Contrainte de flot pour RCPSP avec temps de transfert

Contrainte de flot pour RCPSP avec temps de transfert Contrainte de flot et x-rcpsc T 1 Contrainte de flot pour RCPSP avec temps de transfert PS temp, s ij Cmax BENOIST Thierry BOUYGUES/e-Lab DIAMANTINI Maurice ENSTA/LMA Contrainte de flot et x-rcpsc T Présentation

Plus en détail

PROCÈS VERBAL DE CONSTAT D'ÉTAT DES LIEUX

PROCÈS VERBAL DE CONSTAT D'ÉTAT DES LIEUX Maître N d'étude : Tél. : Fax : email : @ PROCÈS VERBAL DE CONSTAT D'ÉTAT DES LIEUX Référence du dossier : xxxxxxxxxxxxxx Page 1/8 PROCÈS VERBAL DE CONSTAT L'AN DEUX MILLE DOUZE ET LE VENDREDI NEUF NOVEMBRE

Plus en détail

TRAITE DE FUSION. Agissant au nom, pour le compte et en qualité de Président de ladite association, dûment habilité à

TRAITE DE FUSION. Agissant au nom, pour le compte et en qualité de Président de ladite association, dûment habilité à TRAITE DE FUSION En l absence de mention obligatoire à insérer dans les traités de fusion entre associations, leurs contenus sont à adapter au contexte! La bonne prise en compte des particularités des

Plus en détail

SOUS SOL PANOPLIE EF. MAITRISE D'OUVRAGE la justice du Burundi Bujumbura Tel. +257 22 27 51 05. Architectes mandataires Atelier D MAITRISE D'OEUVRE

SOUS SOL PANOPLIE EF. MAITRISE D'OUVRAGE la justice du Burundi Bujumbura Tel. +257 22 27 51 05. Architectes mandataires Atelier D MAITRISE D'OEUVRE 486 487 SOUS SOL 9 8 7 6 5 4 3 2 1 PANOPLIE EF 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Circulation détenus 7.28 m² 8 7 6 5 4 3 2 1 LEGENDE 488 MAITRISE D'OUVRAGE la justice du Burundi Bujumbura Tel. +257 22

Plus en détail

Jeux de caracte res et encodage (par Michel Michaud 2014)

Jeux de caracte res et encodage (par Michel Michaud 2014) Jeux de caracte res et encodage (par Michel Michaud 2014) Les ordinateurs ne traitent que des données numériques. En fait, les codages électriques qu'ils conservent en mémoire centrale ne représentent

Plus en détail

GYMNASE DE NYON T R A V A I L D E M A T U R I T E

GYMNASE DE NYON T R A V A I L D E M A T U R I T E GYMNASE DE NYON T R A V A I L D E M A T U R I T E T A B L E D E S M A T I E R E S 1. Généralités... 3 2. Contenu d un travail de maturité... 4 3. Page de titre... 4 4. Table des matières... 5 4.1. Fonction

Plus en détail

Paiement des véhicules : La procédure

Paiement des véhicules : La procédure Paiement des véhicules : La procédure 1. Le message d offre gagnante... 2 2. Encodage de la demande de paiement par l expert... 3 3. Le document «demande de paiement du véhicule»... 8 4. La réception du

Plus en détail

BAREME DES TRAITEMENTS AU 1 ER JANVIER 2013

BAREME DES TRAITEMENTS AU 1 ER JANVIER 2013 FF I CC HH EE PP RR AA TT I QQ UU EE CC DD GG 55 00 BAREME DES TRAITEMENTS AU 1 ER JANVIER 2013 NOUVEAUX MONTANTS A PRENDRE EN COMPTE A PARTIR DU 1 ER JANVIER 2013 F O N D E M E N T J U R I D I Q U E Décret

Plus en détail

Pour la gestion manuelle de quelques tablettes

Pour la gestion manuelle de quelques tablettes Pour la gestion manuelle de quelques tablettes Ce modèle est utilisé dans les écoles qui disposent d un petit nombre de tablette. Il offre certains avantages : La souplesse d utilisation, c est- à- dire

Plus en détail

SOLUTIONS TECHNOLOGIQUES Fiche activité élève

SOLUTIONS TECHNOLOGIQUES Fiche activité élève SOLUTIONS TECHNOLOGIQUES Fiche activité élève Nom : Prénom : 2 MDM BEP Date : deuxième trimestre Objectif: Etre capable de reconnaître les différents types de travaux rencontrés sur la veste Julie. Prérequis

Plus en détail

N UTILISEZ PAS L ATTESTATION RECUE DE L URSSAF : CETTE DERNIERE NE TIENT PAS COMPTE DE LA CRDS NON DEDUCTIBLE.

N UTILISEZ PAS L ATTESTATION RECUE DE L URSSAF : CETTE DERNIERE NE TIENT PAS COMPTE DE LA CRDS NON DEDUCTIBLE. AAPL74 1) CAS DE REMBOURSEMENT DE COTISATIONS «REGULARISATION DE COTISATIONS 2010» METHODE PRATIQUE DE CALCUL POUR DETERMINER LA CSG-CRDS DE L EXERCICE 2011 A PARTIR D EXEMPLE CHIFFRE SELON MODELES CI-APRES

Plus en détail

Rapport de synthese. xxxxcédric 2ème Année Bac Pro Sen Alarme L.P Tony Garnier de Bron

Rapport de synthese. xxxxcédric 2ème Année Bac Pro Sen Alarme L.P Tony Garnier de Bron xxxxcédric 2ème Année Bac Pro Sen Alarme L.P Tony Garnier de Bron Rapport de synthese 1ère PFMP* : Entreprise : xxxxxxxxxxxxxxx Date de la 1ère PFMP : 27/11/06 au 22/12/06 Nom du Responsable : Gilbert

Plus en détail

NOTICE DE REFERENCE. Gamme Telium. Application 567 19 xx. Consultation Garantie Chèque / Image Chèque (CHPN/CHPR) EFT30 EFTSmart ELC10

NOTICE DE REFERENCE. Gamme Telium. Application 567 19 xx. Consultation Garantie Chèque / Image Chèque (CHPN/CHPR) EFT30 EFTSmart ELC10 NOTICE DE REFERENCE Gamme Telium Application 567 19 xx Consultation Garantie Chèque / Image Chèque (CHPN/CHPR) EFT30 EFTSmart ELC10 ELC930 EFT930 251910541 3000113371 éd 03/802 Sommaire 1 Présentation

Plus en détail

CLUB TMS 23 OCTOBRE 2012

CLUB TMS 23 OCTOBRE 2012 CLUB TMS 23 OCTOBRE 2012 Actualité du Service Prévention Mr Bernard BOUDON, Ingénieur Conseil Régional Carsat LR 9 H 00/9 H 30 - Actualité du service Prévention Mr Bernard BOUDON, Ingénieur Conseil Régional

Plus en détail

CHAPITRE VI ALEAS. 6.1.Généralités.

CHAPITRE VI ALEAS. 6.1.Généralités. CHAPITRE VI ALEAS 6.1.Généralités. Lors de la synthèse des systèmes logique (combinatoires ou séquentiels), nous avons supposé, implicitement, qu une même variable secondaire avait toujours la même valeur

Plus en détail

Accidents sur Fontenay-sous-Bois

Accidents sur Fontenay-sous-Bois Accueil (/) / Mairies Val-de-Marne (/plan-mairie-94.html) / Mairie de Fontenay-sous-Bois (/mairie-fontenay-sous-bois-94120.html) / Accidents survenus sur la commune Accidents sur Fontenay-sous-Bois Liste

Plus en détail

Le certificat PEB. Bâtiment résidentiel existant. Brochure explicative. Cette brochure répond aux questions suivantes : Énergie

Le certificat PEB. Bâtiment résidentiel existant. Brochure explicative. Cette brochure répond aux questions suivantes : Énergie Le certificat PEB Bâtiment résidentiel existant Cette brochure répond aux questions suivantes : Un certificat PEB, c est quoi?... 2 Quand faut-il un rapport partiel?... 3 Quelle durée de validité?... 3

Plus en détail

Guide méthodologique Utilisation de l état de contrôle de la participation aux bénéfices C22

Guide méthodologique Utilisation de l état de contrôle de la participation aux bénéfices C22 Guide méthodologique Utilisation de l état de contrôle de la participation aux bénéfices C22 Les montants sont exprimés en milliers d euros et arrondis au millier d euros le plus proche. I. Utilisation

Plus en détail

4 Système de management de la qualité

4 Système de management de la qualité 4 Système de management de la qualité 4.1 Exigences générales 1 L'entreprise dispose-t-elle d'un organigramme? (organigramme ou description) 2 Toutes les unités organisationnelles pouvant avoir une influence

Plus en détail

Guide d utilisation. Gamme Telium. Application DINERS CLUB 027 03 4x

Guide d utilisation. Gamme Telium. Application DINERS CLUB 027 03 4x Guide d utilisation Gamme Telium Application DINERS CLUB 027 03 4x Ingenico 28/32 boulevard de Grenelle 75015 Paris Tel. 33(0)1 58 01 80 00 Fax. 33(0)1 58 01 91 35 ingenico@ingenico.com Nous vous remercions

Plus en détail

FR Instructions d utilisation de l outil Youthpass Action 1

FR Instructions d utilisation de l outil Youthpass Action 1 FR Instructions d utilisation de l outil Youthpass Action 1 Page 1 FR Instructions d utilisation de l outil Youthpass Action 1 Bienvenue dans Youthpass! Youthpass est une démarche européenne pour la validation

Plus en détail

Manuel d instruction

Manuel d instruction Manuel d instruction Code: D428885XA - Vers. 8.0 F SDD Manuel d instructions Francaise 2005 SILCA S.p.A - Vittorio Veneto Ce manuel a été rédigé par SILCA S.p.A. Tous droits réservés. Aucune partie de

Plus en détail

DOSSIER TECHNIQUE KIMONO «JADE»

DOSSIER TECHNIQUE KIMONO «JADE» DOSSIER TECHNIQUE KIMONO «JADE» DOSSIER TECHNIQUE Croquis et référence du produit : KIMONO «JADE» SOMMAIRE Pages Contenu Sauvegarde 1 2 3 4 5 6 7 et 8 9 dossier technique figurine et descriptif cahier

Plus en détail

Politique d Horodatage achatpublic.com. achatpublic.com

Politique d Horodatage achatpublic.com. achatpublic.com Politique d Horodatage achatpublic.com Version 1.0 1 Préambule 2 1.1 Glossaire et bibliographie 2 1.2 Objet du présent document 2 1.3 Les services d achatpublic.com achatpublic.com 2 1.4 Les marchés publics

Plus en détail

STATUTS D'UNE SOCIETE A RESPONSABILITE LIMITEE. Nom de la Société AU CAPITAL DE 10 000 DINARS

STATUTS D'UNE SOCIETE A RESPONSABILITE LIMITEE. Nom de la Société AU CAPITAL DE 10 000 DINARS STATUTS D'UNE SOCIETE A RESPONSABILITE LIMITEE Nom de la Société AU CAPITAL DE 10 000 DINARS Entre les soussignés 1) Monsieur xxxxxxxxxx, marié demeurant au xxxxxx de nationalité TUNISIENNE CIN n xxxxxx

Plus en détail

CONTRAT DE LOCATION. La surface habitable est de xx m2, la surface corrigée de xxx m2. La convention n xxxxxx a été signée le xx/xx/xxxx.

CONTRAT DE LOCATION. La surface habitable est de xx m2, la surface corrigée de xxx m2. La convention n xxxxxx a été signée le xx/xx/xxxx. CONTRAT DE LOCATION ENTRE GIRONDE HABITAT, Office Public d'habitat de la Gironde, dont le siège est situé 40 rue d Armagnac 33074 BORDEAUX CEDEX, représenté par sa Directrice Générale en exercice, domicilié

Plus en détail

Cahier de développement add-on SAP Business One

Cahier de développement add-on SAP Business One Page 1 / 13 Cahier de développement add-on SAP Business One OB1 Mobile Date du document : 31 mars 2010 Référence : OB1M-310310-BM Version : 1.0c OPTI-ONE 4, rue des Vieux Capucins 28000 CHARTRES Téléphone

Plus en détail

Alarme Sans Fil GSM. Manuel utilisateur. Préface

Alarme Sans Fil GSM. Manuel utilisateur. Préface Alarme Sans Fil GSM Référence A2M0 Manuel utilisateur Préface Nous vous remercions d'avoir fait lʼacquisition dʼune centrale dʼalarme sans fil GSM A2M0. Ce manuel indique comment faire fonctionner votre

Plus en détail

Partie 1. Fonctions plus complexes dans Excel. Fonctions Si(), Et(), Ou() et fonctions imbriquées. Opérateurs logiques. I.1.

Partie 1. Fonctions plus complexes dans Excel. Fonctions Si(), Et(), Ou() et fonctions imbriquées. Opérateurs logiques. I.1. Présentation Excel 7 Fonctions plus complexes dans Excel Partie 1 Sandra Michelet Département Informatique Pédagogique Université Stendhal, Grenoble III Fonctions Si(), Et(), Ou() et fonctions imbriquées

Plus en détail

Logiciel Sage paie ligne 100

Logiciel Sage paie ligne 100 Votre partenaire expert de la rémunération salariale Logiciel Sage paie ligne 100 Objectifs de la formation Maîtriser l ensemble des fonctions du logiciel, Etre autonome dans le paramétrage et le traitement

Plus en détail

SYNTHESE AUDIT JURIDIQUE

SYNTHESE AUDIT JURIDIQUE SYNTHESE AUDIT JURIDIQUE REALISER UN PLANNING DU PROJET ( échéances juridiques, durée du projet, ) Début du Bail Immeuble A DATE de DECISION Préavis avant cette date Fin du Bail Immeuble A Début du Bail

Plus en détail

RÉPERTOIRE DES ENTREPRISES CONTRÔLÉES MAJORITAIREMENT PAR L'ÉTAT au 31 décembre 1988

RÉPERTOIRE DES ENTREPRISES CONTRÔLÉES MAJORITAIREMENT PAR L'ÉTAT au 31 décembre 1988 RÉPERTOIRE DES ENTREPRISES CONTRÔLÉES MAJORITAIREMENT PAR L'ÉTAT au 31 décembre 1988 Nicole Chabanas SYSTEME PRODUCTIF N 25, avril 1990 n 60 RÉPUBLIQUE FRANÇAISE Ministère de l'économie, des finances

Plus en détail

Le Raid c est quoi? Comment ca marche? Les différents modes RAID :

Le Raid c est quoi? Comment ca marche? Les différents modes RAID : Le Raid c est quoi? Redundant Array of Inexpensive Disks: ensemble redondant de disques peu chers. Le RAID est une technologie qui a été dévellopée en 1988 pour améliorer les performances des unités de

Plus en détail

HERVÉ SCHAUER CONSULTANTS Cabinet de Consultants en Sécurité Informatique depuis 1989 Spécialisé sur Unix, Windows, TCP/IP et Internet

HERVÉ SCHAUER CONSULTANTS Cabinet de Consultants en Sécurité Informatique depuis 1989 Spécialisé sur Unix, Windows, TCP/IP et Internet HERVÉ SCHAUER CONSULTANTS Cabinet de Consultants en Sécurité Informatique depuis 1989 Spécialisé sur Unix, Windows, TCP/IP et Internet Flux réseaux : Analyse après compromission d'un pot de miel OSSIR

Plus en détail

Création et animation de réseaux d entreprises. Guide méthodologique à l usage des CCI

Création et animation de réseaux d entreprises. Guide méthodologique à l usage des CCI Création et animation de réseaux d entreprises Guide méthodologique à l usage des CCI Février 2012 Guide Méthodologique sur les réseaux d'entreprises SOMMAIRE INTRODUCTION 2 I. RÉSEAUX D ENTREPRISES :

Plus en détail

Excusés : Jean François Nicol (membre du Forum Citoyen) ; Marie Louise Conreux (membre du Forum Citoyen)

Excusés : Jean François Nicol (membre du Forum Citoyen) ; Marie Louise Conreux (membre du Forum Citoyen) Compte rendu de la réunion sur la mise en place d un SEL sur le territoire «Leff Ar Mor» à l initiative du Forum Citoyen Leff Ar Mar 28 juin 2013 Longère de Blanchardeau Lanvollon Liste des participants

Plus en détail

Opérations Arithmétiques

Opérations Arithmétiques 1 Addition en Binaire 1.1 Principe Opérations Arithmétiques L addition de deux nombres binaires est réalisée de la même façon que l addition décimale. L addition est l opération qui consiste à effectuer

Plus en détail

Codage des nombres. Eric Cariou. Université de Pau et des Pays de l'adour Département Informatique. Eric.Cariou@univ-pau.fr

Codage des nombres. Eric Cariou. Université de Pau et des Pays de l'adour Département Informatique. Eric.Cariou@univ-pau.fr Codage des nombres Eric Cariou Université de Pau et des Pays de l'adour Département Informatique Eric.Cariou@univ-pau.fr 1 Représentation de l'information Un ordinateur manipule des données Besoin de coder

Plus en détail

CHARTE GRAPHIQUE. de l académie de Dijon. Guide d utilisation des logotypes Applications au rectorat MINISTÈRE DE L ÉDUCATION NATIONALE

CHARTE GRAPHIQUE. de l académie de Dijon. Guide d utilisation des logotypes Applications au rectorat MINISTÈRE DE L ÉDUCATION NATIONALE CHARTE GRAPHIQUE de l académie de Dijon Guide d utilisation des logotypes Applications au rectorat académie Dijon MINISTÈRE DE L ÉDUCATION NATIONALE MINISTÈRE DE L ENSEIGNEMENT SUPÉRIEUR ET DE LA RECHERCHE

Plus en détail

Caisse Nationale de l'assurance Maladie des Travailleurs Salariés Sécurité Sociale

Caisse Nationale de l'assurance Maladie des Travailleurs Salariés Sécurité Sociale Caisse Nationale de l'assurance Maladie des Travailleurs Salariés Sécurité Sociale Circulaire Mmes et Mrs les Directeurs Date : des Caisses Primaires d'assurance Maladie 12/07/89 des Caisses Générales

Plus en détail

CONSEILS -EN - PATRIMOINE

CONSEILS -EN - PATRIMOINE CONSEILS -EN - PATRIMOINE BILAN DE TRANSMISSION à l attention de M. et Mme XXXXXXXXXXX réalisé le XXXX par XXXXXXXXXX Préambule Ermont, le XXXXXXXXXXXXXX Bien gérer votre patrimoine, optimiser sa fiscalité

Plus en détail

Réforme Tests & Simulations

Réforme Tests & Simulations Réforme Tests & Simulations des Classements Niveaux et Séries de Classement. Les niveaux de jeu N (National), R (Régional), D (Départemental), P (Promotion) sont subdivisés en séries: N1 N2 N3, R4 R5 R6,

Plus en détail

Circulaire 2013/xy Distribution de placements collectifs. Distribution au sens de la législation sur les placements collectifs de capitaux

Circulaire 2013/xy Distribution de placements collectifs. Distribution au sens de la législation sur les placements collectifs de capitaux Banques Groupes et congl. financiers Autres intermédiaires Assureurs Groupes. et congl. d assur. Intermédiaires d assur. Bourses et participants Négociants en valeurs mob. Directions de fonds SICAV Sociétés

Plus en détail

Baies serveur CATALOGUE DES PRODUITS DE ZPAS GROUPE. ZPAS-ESTCI 7, rue de l industrie 68360 SOULTZ 03 89 62 56 40 contact@estci.fr

Baies serveur CATALOGUE DES PRODUITS DE ZPAS GROUPE. ZPAS-ESTCI 7, rue de l industrie 68360 SOULTZ 03 89 62 56 40 contact@estci.fr Baies serveur CATALOGUE DES PRODUITS DE ZPAS GROUPE ZPAS-ESTCI, rue de l industrie 0 SOULTZ 0 9 2 0 contact@estci.fr SZB SE 19 " BAIE SERVEUR BÂTI ASSURANT LA PROTECTION DU MATÉRIEL INSTALLÉ DANS LES SALLES

Plus en détail

Validation probabiliste d un Système de Prévision d Ensemble

Validation probabiliste d un Système de Prévision d Ensemble Validation probabiliste d un Système de Prévision d Ensemble Guillem Candille, janvier 2006 Système de Prévision d Ensemble (EPS) (ECMWF Newsletter 90, 2001) Plan 1 Critères de validation probabiliste

Plus en détail

Office of the Auditor General / Bureau du vérificateur général

Office of the Auditor General / Bureau du vérificateur général Office of the Auditor General / Bureau du vérificateur général AUDIT OF MOONLIGHTING AND CORPORATE RISK ISSUES - TRAFFIC OPERATIONS DIVISION 2008 VÉRIFICATION - DEUXIÈME EMPLOI ET RISQUE DE CONFLITS DE

Plus en détail

Plan de Continuité des Activités Disneyland Resort Paris. Préparé par Karine Poirot/Paul Chatelot 26 mars 2009

Plan de Continuité des Activités Disneyland Resort Paris. Préparé par Karine Poirot/Paul Chatelot 26 mars 2009 Plan de Continuité des Activités Disneyland Resort Paris Préparé par Karine Poirot/Paul Chatelot 26 mars 2009 Agenda Contexte-justification Démarche adoptée Bilan phase 1 - Business Impact Analysis Bilan

Plus en détail

Mme Rapport de mission Présentation des SCPI. Le 29 mai 2015. Olivier JANQUIN Conseil en Stratégie Patrimoniale

Mme Rapport de mission Présentation des SCPI. Le 29 mai 2015. Olivier JANQUIN Conseil en Stratégie Patrimoniale Rapport de mission Présentation des SCPI Le 29 mai 2015 Olivier JANQUIN Conseil en Stratégie Patrimoniale ATTESTATION DE RECEPTION Nous soussignés,, né le à, demeurant à (), Reconnais avoir reçu, Du cabinet

Plus en détail

MODIFIER LES CARACTÈRES D'UN PC POUR AFFICHER RUSSE, ARABE, GREC, ETC. (*)

MODIFIER LES CARACTÈRES D'UN PC POUR AFFICHER RUSSE, ARABE, GREC, ETC. (*) 229 COMMENT MODIFIER LES CARACTERES D'UN PC POUR AFFICHER RUSSE, ARABE, GREC, ETC. (*) Si la forme des caractères qui s'affichent sur l'écran de votre PC ne vous convient pas, si vous souhaitez en créer

Plus en détail

GUIDE D INSTALLATION INTERNET haute vitesse

GUIDE D INSTALLATION INTERNET haute vitesse GUIDE D INSTALLATION INTERNET haute vitesse Version 2012-09 1 800 567-6353 1 Table des matières 4....3 Avant de vous connecter à un réseau sans fil...3 4.1 Connexion à un réseau sans fil sur Windows XP...5

Plus en détail

La Presse Le conflit étudiant

La Presse Le conflit étudiant La Presse Le conflit étudiant Vague 2-22 au 25 mai 2012 - Méthodologie La collecte de données en ligne s est déroulée du 22 au 25 mai 2012 par le biais d un panel web. Un total de 1 500 questionnaires

Plus en détail

Nouvelle procédure de demande d'intervention Retail Helpdesk Engineering

Nouvelle procédure de demande d'intervention Retail Helpdesk Engineering Nouvelle procédure de demande d'intervention Retail Helpdesk Engineering Kuwait Petroleum North-West Europe Version 1.3 Version Date Auteur Changements 1.0 18.10.2009 Vanessa Première version Vierstraete

Plus en détail

Qu est-ce qu un système d Information? 1

Qu est-ce qu un système d Information? 1 Qu est-ce qu un système d Information? 1 Une définition du système d information «Tout moyen dont le fonctionnement fait appel à l électricité et qui est destiné à élaborer, traiter, stocker, acheminer,

Plus en détail

CONSEIL DE LA CONSOMMATION AVIS

CONSEIL DE LA CONSOMMATION AVIS C.C. 302 CONSEIL DE LA CONSOMMATION AVIS sur un projet d'arrêté royal portant certaines mesures d'exécution de la loi instaurant un service bancaire de base. Bruxelles, 7 avril 2003 Le Conseil de la Consommation,

Plus en détail

Formation SCRIBE EAD

Formation SCRIBE EAD Formation SCRIBE EAD I. Documentations SOMMAIRE II. Architecture des réseaux III. Filtrations AMON (pédagogique) IV. SCRIBE V. Questions I. Documentations Sites de diffusion académique http://diff.ac-nice.fr/

Plus en détail

Appel à projet Territoire zéro déchet zéro gaspillage

Appel à projet Territoire zéro déchet zéro gaspillage Appel à projet Territoire zéro déchet zéro gaspillage Document d aide pour compléter et déposer votre dossier sur la plateforme appelsaprojets.ademe.fr Préambule Pour ouvrir un dossier, vous devez accéder

Plus en détail

Le centre de gestion a le plaisir de vous adresser les statistiques professionnelles élaborées à partir des dossiers de gestion 2013

Le centre de gestion a le plaisir de vous adresser les statistiques professionnelles élaborées à partir des dossiers de gestion 2013 Statistiques 2013 3, rue de Lyon B.P. 531 71010 MACON CEDEX Tél. 03.85.21.90.60 Télécopie 03.85.21.90.69 E-mail : contact@cgai-macon.fr Agrément de la Direction Régionale des Impôts n 1.02.710 du 6 mars

Plus en détail

Étude des formes de pratiques de la gymnastique sportive enseignées en EPS à l école primaire

Étude des formes de pratiques de la gymnastique sportive enseignées en EPS à l école primaire Étude des formes de pratiques de la gymnastique sportive enseignées en EPS à l école primaire Stéphanie Demonchaux To cite this version: Stéphanie Demonchaux. Étude des formes de pratiques de la gymnastique

Plus en détail

IBM Software Group. Migration vers Tivoli Workload Scheduler. Philippe TESSIER ptessier@setd.fr. 2009 IBM Corporation

IBM Software Group. Migration vers Tivoli Workload Scheduler. Philippe TESSIER ptessier@setd.fr. 2009 IBM Corporation IBM Software Group Migration vers Tivoli Workload Scheduler Philippe TESSIER ptessier@setd.fr Sociétés Prodline ( 180 personnes ) Distributeur et intégrateur EGEN Expert Production Régie, Forfait, Infogérance,

Plus en détail

Mise à jour de la base de données des marques nationales du tourisme

Mise à jour de la base de données des marques nationales du tourisme Mise à jour de la base de données des marques nationales du tourisme Ce tutoriel a pour objectif d aider à la création et la mise à jour des fiches recensant les établissements qui obtiennent la marque

Plus en détail

Rapport d'expertise Thermographie infrarouge en bâtiment.

Rapport d'expertise Thermographie infrarouge en bâtiment. Rapport d'expertise Thermographie infrarouge en bâtiment. Expert Thermographe: Mme Sylvie Petit Préparé pour : : xxxxxxx xxxxxxx Adresse : xxx xxxxxxxxxx xxxxxxxxx xxx xxx Téléphone: xxx-xxx-xxxx extérieure

Plus en détail

Collection dirigée par Xavier Chiron

Collection dirigée par Xavier Chiron EXTRAIT Collection dirigée par Xavier Chiron Coordination : Françoise Rouaix Xavier Chiron Inspecteur d académie-inspecteur pédagogique régional d économie et gestion Stéphane Derocles Professeur agrégé

Plus en détail

QUESTIONNAIRE D IDENTIFICATION

QUESTIONNAIRE D IDENTIFICATION Initiative de renforcement des capacités institutionnels pour s s de DPE/DEPPE/EPE en Afrique QUESTIONNAIRE D IDENTIFICATION L ADEA, l UNESCO et l UNICEF lancent cette initiative en prélude au démarrage

Plus en détail

LE REFERENTIEL ACHAT APPLICABLE A COMPTER DU 1 ER JANVIER 2007 A destination des gestionnaires de laboratoires

LE REFERENTIEL ACHAT APPLICABLE A COMPTER DU 1 ER JANVIER 2007 A destination des gestionnaires de laboratoires 1 LE REFERENTIEL ACHAT APPLICABLE A COMPTER DU 1 ER JANVIER 2007 A destination des gestionnaires de laboratoires PREAMBULE Depuis le 1 er janvier 2007, le nouveau système d'information «Budgétaire, Financier

Plus en détail

Guide utilisateurs SYNel WEB MOBILE Version V100

Guide utilisateurs SYNel WEB MOBILE Version V100 Page 1 sur 25 Guide utilisateurs SYNel WEB MOBILE Version V100 1 INTRODUCTION... 3 2 ACCES A SYNEL WEB MOBILE... 4 3 AUTHENTIFICATION... 4 3.1 CONNEXION... 4 3.2 MULTI-CHEPTELS... 4 4 ACCUEIL... 5 5 IDENTIFICATION...

Plus en détail

Dossier de candidature à la VAE. Certificat visé INTITULE : CONSULTANT(E) QUALIFICATION LOGICIELLE

Dossier de candidature à la VAE. Certificat visé INTITULE : CONSULTANT(E) QUALIFICATION LOGICIELLE Nom : Prénom : Adresse : Téléphone : E-mail : Dossier de candidature à la VAE Certificat visé INTITULE : CONSULTANT(E) QUALIFICATION LOGICIELLE Organisme certificateur : FITEC Votre objectif est d obtenir

Plus en détail

PROVINCE DE QUÉBEC VILLE DE NICOLET. RÈGLEMENT n 23-2001. Règlement relatif au stationnement

PROVINCE DE QUÉBEC VILLE DE NICOLET. RÈGLEMENT n 23-2001. Règlement relatif au stationnement PROVINCE DE QUÉBEC VILLE DE NICOLET RÈGLEMENT n 23-2001 Règlement relatif au stationnement CONSIDÉRANT qu AVIS DE MOTION du présent règlement a dûment été donné lors de la séance spéciale du 30 avril 2001.

Plus en détail

Créer un publipostage avec Microsoft Word

Créer un publipostage avec Microsoft Word Créer un publipostage avec Microsoft Word Cette technique permet de créer un document type et de le fusionner avec une base de données. Si vous devez créer et envoyer un document à de nombreuses personnes,

Plus en détail

ATELIER GESTION ET CONDUITE DE PROJET CONCEVOIR STRUCTURER - GERER

ATELIER GESTION ET CONDUITE DE PROJET CONCEVOIR STRUCTURER - GERER ATELIERS THEMATIQUES UNIONS COMMERCIALES ATELIER GESTION ET CONDUITE DE PROJET CONCEVOIR STRUCTURER - GERER Synthèse de l atelier du 21&28 janvier 2013 à la CCI Bayonne Pays Basque Le défi à relever dans

Plus en détail

Nom de votre entreprise. Cahier des charges. Expertise en solution de gestion et rédaction de cahier des charges

Nom de votre entreprise. Cahier des charges. Expertise en solution de gestion et rédaction de cahier des charges Cahier des charges Nom de votre entreprise Expertise en solution de gestion et rédaction de cahier des charges Audit. Conseils. Cahier des charges. Sélection des solutions Reflex-erp.com Sommaire exécutif

Plus en détail

Introduction à la consultation du dossier étudiant

Introduction à la consultation du dossier étudiant Introduction à la consultation du dossier étudiant 1 Présentation générale APOGEE APOGEE : Application pour la gestion des étudiants et des enseignements APOGEE est un logiciel national élaboré par l'amue

Plus en détail

FICHES FISCALES. Mise à jour du 24-03-2014 SPF FINANCES - TRESORERIE SERVICE PAIEMENTS TRAITEMENTS & PENSIONS AVENUE DES ARTS, 30 1040 BRUXELLES

FICHES FISCALES. Mise à jour du 24-03-2014 SPF FINANCES - TRESORERIE SERVICE PAIEMENTS TRAITEMENTS & PENSIONS AVENUE DES ARTS, 30 1040 BRUXELLES FICHES FISCALES 2014 Mise à jour du 24-03-2014 SPF FINANCES - TRESORERIE SERVICE PAIEMENTS TRAITEMENTS & PENSIONS AVENUE DES ARTS, 30 1040 BRUXELLES www.traitements.fgov.be TABLE DES MATIERES 1. Fiche

Plus en détail

La transmission pour information du présent document dans sa présentation intégrale, le présent paragraphe compris, est autorisée.

La transmission pour information du présent document dans sa présentation intégrale, le présent paragraphe compris, est autorisée. ELECTRICITE DE STRASBOURG Référentiel Technique Proposition Technique et Financière pour le raccordement au réseau public de distribution d Électricité de Strasbourg d une installation consommateur HTA

Plus en détail

Les unités d'oeuvre en pratique

Les unités d'oeuvre en pratique Les unités d'oeuvre en pratique François PUPIER STERIA AQUITAINE Les unités d œuvre en pratique 1. Les enjeux 2. Panorama des méthodes mises en œuvre à Steria 3. Méthode d estimation par unités d œuvre

Plus en détail

Système Alarme GSM APPEL MOBILE

Système Alarme GSM APPEL MOBILE Système Alarme GSM APPEL MOBILE Manuel d Utilisation Merci de lire attentivement ce mode d emploi avant de mettre en service votre nouveau système d alarme. - 1 - Index Page 3 Page 4 Page 6 Page 7 Page

Plus en détail

Logo EPCI. Entre : D une part,

Logo EPCI. Entre : D une part, Logo EPCI COMMUNAUTE (DE COMMUNES, D AGGLOMÉRATION, URBAINE) DE XXX CONVENTION CADRE D ACTION FONCIÈRE Entre : La Communauté (de communes, d agglomération, urbaine) de, Établissement Public de Coopération

Plus en détail

CONCIERGE 400 MANUEL DE L UTILISATEUR SÉRIE PROFESSIONAL PÊNE DORMANT ÉLECTRONIQUE 01/2015

CONCIERGE 400 MANUEL DE L UTILISATEUR SÉRIE PROFESSIONAL PÊNE DORMANT ÉLECTRONIQUE 01/2015 CONCIERGE 400 SÉRIE PROFESSIONAL PÊNE DORMANT ÉLECTRONIQUE MANUEL DE L UTILISATEUR 01/2015 IMPORTANT : Avant la première utilisation, prière de lire la page 19 dans le manuel de l utilisateur pour des

Plus en détail

Compter à Babylone. L écriture des nombres

Compter à Babylone. L écriture des nombres Compter à Babylone d après l article de Christine Proust «Le calcul sexagésimal en Mésopotamie : enseignement dans les écoles de scribes» disponible sur http://www.dma.ens.fr/culturemath/ Les mathématiciens

Plus en détail

france u / angleterre u L équipe de France championne du monde remet son titre en jeu

france u / angleterre u L équipe de France championne du monde remet son titre en jeu mercredi 28 mai 2014 stade a. delaune reims 20h30 france u / angleterre u L équipe de France championne du monde remet son titre en jeu Comité régional du sport universitaire Chemin des rouliers UFR Sciences

Plus en détail

Audit de la stratégie Webmarketing par rapport aux dispositifs web en ligne

Audit de la stratégie Webmarketing par rapport aux dispositifs web en ligne Audit de la stratégie Webmarketing par rapport aux dispositifs web en ligne Le dossier de consultation est constitué de 5 parties : Règlement de la consultation, Cahier des charges, Echéancier, Demande

Plus en détail

Complétez, signez la Convention ci-après et paraphez les conditions générales,

Complétez, signez la Convention ci-après et paraphez les conditions générales, Réservé à la vente à distance C o m m e n tt s o u s c rr i rr e? Si vous n êtes pas déjà client du Crédit Coopératif 1 2 3 4 complétez la demande d'ouverture de compte veillez à bien remplir toutes les

Plus en détail

PROGRAMME DE FORMATION CONTINUE PROCÉDURE D ACCRÉDITATION

PROGRAMME DE FORMATION CONTINUE PROCÉDURE D ACCRÉDITATION PROGRAMME DE FORMATION CONTINUE PROCÉDURE D ACCRÉDITATION 4, place du Commerce, bureau 420, Île des Sœurs (Verdun), Québec H3E 1J4 Téléphone : (514) 767 4040 ou 1 (800) 640 4050 Courriel : info@iqpf.org

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

http://www.content-square.fr

http://www.content-square.fr http://www.content-square.fr Les intervenants 2 Interviendront sur le thème : "Big Data et Data Mining : le couple gagnant du E-commerce et de vos fiches produits!" Partez à la découverte du Big Data Mining

Plus en détail

Filière ITTI - Auxerre TC1 Modélisation des informations (partie 1)

Filière ITTI - Auxerre TC1 Modélisation des informations (partie 1) Filière ITTI - Auxerre TC1 Modélisation des informations (partie 1) Marie-Noëlle Terrasse Département IEM, Université de Bourgogne 12 novembre 2004 On appelle données simples les informations représentées

Plus en détail