Validation probabiliste d un Système de Prévision d Ensemble

Dimension: px
Commencer à balayer dès la page:

Download "Validation probabiliste d un Système de Prévision d Ensemble"

Transcription

1 Validation probabiliste d un Système de Prévision d Ensemble Guillem Candille, janvier 2006 Système de Prévision d Ensemble (EPS) (ECMWF Newsletter 90, 2001)

2 Plan 1 Critères de validation probabiliste d un système de prévision d ensemble (EPS) 2 Mesures probabilistes 3 Comparaison objective de 2 EPS : méthodes bootstrap 4 Conclusions et perspectives

3 Principes probabilistes de validation d un EPS Oublier les concepts de validation déterministe 1 prévision = distribution de probabilités (PDF) vs. 1 vérification = 1 valeur numérique Validation des EPS par accumulation statistique. 2 critères : la fiabilité et la résolution. Xo

4 Critère d évaluation : Fiabilité Cohérence statistique entre les prévisions et les observations correspondantes. Xo f est la PDF prévue. f 1 et f 2 sont 2 distributions de x o quand f est prévue. L EPS est parfaitement fiable si et seulement si f = f. tout système peut être rendu fiable par une calibration statistique a posteriori. La fiabilité est un critère nécessaire mais non suffisant : cf. e.g. un système climatologique.

5 Critère d évaluation : Résolution Capacité de séparer les prévisions menant à des distributions d observations correspondantes (DOC) bien distinctes. système climatologique système déterministe Exemples DOC allant d une résolution minimale nulle pour le système climatologique à une résolution maximale pour le système déterministe. X 1 X 2 (la courbe rouge représente ici la distribution de toutes les observations : distribution climatologique)

6 Critères probabilististes : résumé La fiabilité et la résolution sont 2 propriétés qui déterminent la qualité et l utilité d un système de prévision probabiliste. Un EPS doit être capable de séparer a priori les prévisions en classes suffisamment variées afin que les observations correspondantes représentent des situations bien distinctes.

7 Continuous Ranked Probability Score (CRPS) Le CRPS mesure la qualité globale d un EPS : [ ] CRPS = E (F p (ξ) H(ξ x o )) 2 dξ Ω (1) F p est la distribution cumulative de probabilités (CDF) associée à l ensemble prévu et H est la distribution de Heaviside associée à la vérification. cas continu cas réel (discret) 1 verification CDF 1 verification CDF ε ε σ CRPS σ CRPS 0 mean ξ 0 mean ξ

8 Décomposition du CRPS Le CRPS se décompose en 2 composantes permettant de mesurer la fiabilité et la résolution. On utilise ici la décomposition proposée par H. Hersbach 1 : CRPS = Reli + CRPS pot (2) où Reli mesure la fiabilité et CRPS pot mesure la résolution. 1 Hersbach 2000 : Decomposition of the continuous ranked probability score for ensemble prediction systems, in Weather and Forecasting (15), pp

9 Composante fiabilité du CRPS : Reli A chaque réalisation du système, on définit des valeurs pour chaque intervalle [x i, x i+1 ] selon la position de la vérification et la taille de l intervalle. 1 verification CDF = Après accumulation sur l ensemble des réalisations du système, on peut définir la CDF observée correspondante et la comparer à la moyenne des CDF prévues. 1 predicted observed Reli 0 X1 X2... X(n 1) Xn 0

10 Composante résolution du CRPS : CRPS pot CRPS pot serait la valeur potentielle du CRPS si l EPS était fiable, i.e. Reli = 0. CRPS pot = uncertainty Resol 1 1 class of predicted CDF CRPS pot F(σ) σ Σ uncertainty F(Σ) 0 CDF over all observations Resol F(Σ σ) Plus σ << Σ, meilleure la résolution est.

11 Reduced Centered Random Variable (RCRV) La RCRV permet de détailler les caractéristiques de la fiabilité en terme de biais (b) et dispersion (d). A chaque réalisation, on considère la moyenne m et la dispersion σ de l ensemble, ainsi que l observation o et l erreur d observation σ o. La RCRV se définit alors : y = o m σ 2 + σ 2 o (3) On cherche ainsi à vérifier si l observation peut être considérée comme une réalisation indépendante de la loi de probabilité définie par l ensemble la moyenne de y (b) mesure le biais pondéré de l ensemble et la variance de y (d) mesure la dispersion comparée des ensembles et des observations.

12 Comment améliorer la fiabilité d un EPS? Pour un EPS fiable, on a : b = 0 et d = 1 On considère un EPS non fiable sous-dispersif et 2 corrections possibles : d Var ( ɛ σ ) > 1 verification ensemble mean members plus de dispersion verification ensemble mean members moins d erreur verification ensemble mean members ε ε σ ε σ σ

13 Méthode de comparaison Vérifications effectuées avec des observations de radio-sondages réparties sur tout le globe (Chantal Côté). Comparaison des performances de 2 EPS mesurée par les différences en terme de CRPS et RCRV. Limitation de la validation due à la taille de l échatillon sur lequel les statistiques sont calculées estimation d intervalle de confiance par des techniques de ré-échantillonnage bootstrap 2. 2 Efron and Tibshirani, 1993 : An introduction to the bootstrap

14 Technique bootstrap S : score CRPS ou RCRV X : échantillon de données X 1 = (x 5, x 3,..., x 9 ) : S(X 1 ) S(X ) : X = (x 1, x 2,..., x n ) X 2 = (x 4, x n,..., x n ) : S(X 2 ) X nb = (x 2, x 7,..., x 2 ) : S(X nb )

15 Intervalle de confiance : propriétés (1) Le ré-échantillonnage s effectue seulement parmi les jours de prévision et non aussi parmi les différentes stations d observations cela évite de donner trop de poids à des situations extrêmes journalières et d ainsi sous-évaluer la taille de l intervalle de confiance. CRPS CRPS(A) - CRPS(B) C.I. C.I. spatial correlation day. Température à 850 hpa pour la période du 12 septembre au 5 novembre 2005 EPS A = EPS opérationnel EPS B = EPS parallèle

16 Intervalle de confiance : propriétés (2) Risque de sous-évaluation de la taille des intervalles de confiance à cause de l auto-corrélation temporelle des erreurs de prévision, surtout à moyenne échéance autocorrelation ρ(t,t+1) ρ(t,t+2) ρ(t,t+3) ρ(t,t+4) ρ(t,t+5) CRPS CRPS(A) - CRPS(B) C.I. 1-day independent C.I. 2-days independent C.I. 3-days independent C.I. 4-days independent C.I. 5-days independent day day Les intervalles de confiance traduisent les incertitudes liées aux auto-corrélations des erreurs de prévision. Calcul des intervalles de confiance en ré-échantillonnant par séquences de 3 jours.

17 Comparaison : décomposition du CRPS Amélioration globale (CRPS) pour l EPS parallèle. Reli CRPS pot 0.1 Reli(A) - Reli(B) 0.1 CRPS pot (A) - CRPS pot (B) Reli 0.04 CRPS pot day day Amélioration significative de la fiabilité. Amélioration significative de la résolution jusqu au jour 6.

18 Comparaison : décomposition de la fiabilité Amélioration significative de la fiabilité pour l EPS parallèle. biais dispersion b(a) - b(b) d(A) - 1-d(B) bias day dispersion day Amélioration non significative du biais. Amélioration significative de la dispersion.

19 Comparaison : changement neutre Construction de 2 EPS thériquement équivalents : EPS A = EPS oper. jours pairs + EPS para. jours impairs EPS B = EPS oper. jours impairs + EPS para. jours pairs 0.08 CRPS(A') - CRPS(B') 0.06 CRPS Pas de différence significative day

20 Résumé Développement d outils de validation probabiliste objective pour la comparaison de la performance de 2 EPS : vérification contre observations. mesure globale CRPS avec décomposition fiabilité-résolution et caractérisation de la fiabilité par la RCRV. définition d intervalle de confiance par des techniques de ré-échantillonnage bootstrap. Amélioration significative avec l EPS parallèle, surtout en terme de fiabilité, qui est devenu l EPS opérationnel le 12 décembre 2005.

21 La suite... Transfert des outils de validation/comparaison probabiliste en mode opérationnel inclus dans une boite à outils de vérification plus générale (Barbara Casati). Développer les techniques de ré-échantillonnage pour d autres mesures probabilistes telles que le score de Brier. Prévision déterministe et prévision d ensemble : liens entre les incertitudes de prévision déterministe et la dispersion des ensembles? liens entre la discrimination (courbe ROC, valeur économique) et la fiabilité-résolution?

22 Merci Questions?

Introduction à l approche bootstrap

Introduction à l approche bootstrap Introduction à l approche bootstrap Irène Buvat U494 INSERM buvat@imedjussieufr 25 septembre 2000 Introduction à l approche bootstrap - Irène Buvat - 21/9/00-1 Plan du cours Qu est-ce que le bootstrap?

Plus en détail

CALCUL D UN SCORE ( SCORING) Application de techniques de discrimination LES OBJECTIFS DU SCORING

CALCUL D UN SCORE ( SCORING) Application de techniques de discrimination LES OBJECTIFS DU SCORING CALCUL D UN SCORE ( SCORING) Application de techniques de discrimination LES OBJECTIFS DU SCORING SÉLECTION DES RISQUES PRÉVISION DES DÉFAUTS SUIVI ET CONTRÔLE Pierre-Louis GONZALEZ Différents types de

Plus en détail

Statistique : Résumé de cours et méthodes

Statistique : Résumé de cours et méthodes Statistique : Résumé de cours et méthodes 1 Vocabulaire : Population : c est l ensemble étudié. Individu : c est un élément de la population. Effectif total : c est le nombre total d individus. Caractère

Plus en détail

L analyse discriminante

L analyse discriminante L analyse discriminante À Propos de ce document... Introduction... La démarche à suivre sous SPSS... 2. Statistics... 2 2. Classify... 2 Analyse des résultats... 3. Vérification de l existence de différences

Plus en détail

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7 Table des matières Préface Public 1 Structure de l ouvrage 1 Caractéristiques de l ouvrage 3 Contenu 3 Pédagogie 4 Remarques sur l adaptation française 4 Ressources numériques 5 Biographie 6 PREMIÈRE PARTIE

Plus en détail

Real-time Monitoring and forecast of IntraSeasonal Variability over Africa (MISVA)

Real-time Monitoring and forecast of IntraSeasonal Variability over Africa (MISVA) Real-time Monitoring and forecast of IntraSeasonal Variability over Africa (MISVA) R. Roehrig 1,*, F. Couvreux 1, E. Poan 1, P. Peyrillé 1, J.-P. Lafore 1, O. Ndiaye 2, A. Diongue-Niang 2, F. Favot 1,

Plus en détail

Le bootstrap expliqué par l exemple

Le bootstrap expliqué par l exemple Le bootstrap expliqué par l exemple 1 Le bootstrap expliqué par l exemple 1. Les concepts du bootstrap 2. Des variantes adaptées au contexte 3. Comparaison des différentes méthodes 4. Les cas sensibles

Plus en détail

Le risque Idiosyncrasique

Le risque Idiosyncrasique Le risque Idiosyncrasique -Pierre CADESTIN -Magali DRIGHES -Raphael MINATO -Mathieu SELLES 1 Introduction Risque idiosyncrasique : risque non pris en compte dans le risque de marché (indépendant des phénomènes

Plus en détail

Principe d un test statistique

Principe d un test statistique Biostatistiques Principe d un test statistique Professeur Jean-Luc BOSSON PCEM2 - Année universitaire 2012/2013 Faculté de Médecine de Grenoble (UJF) - Tous droits réservés. Objectifs pédagogiques Comprendre

Plus en détail

Tâche 03 Approche hybride De la correction des erreurs à la sélection de variables

Tâche 03 Approche hybride De la correction des erreurs à la sélection de variables 31 décembre 2013 Georges-Marie Saulnier, William Castaings, Anne Johannet, Gérard Dreyfus Tâche 03 Approche hybride De la correction des erreurs à la sélection de variables Sommaire 1. INTRODUCTION...

Plus en détail

Développements récents de la méthode des scores de la Banque de France

Développements récents de la méthode des scores de la Banque de France Développements récents de la méthode des scores de la Banque de France Au cours de la décennie quatre-vingt et au début des années quatre-vingt-dix, devant la multiplication des défaillances d entreprises,

Plus en détail

Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés

Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés Professeur Patrice Francour francour@unice.fr Une grande partie des illustrations viennent

Plus en détail

Impact de la configuration du traitement sur l estimation troposphérique par GNSS

Impact de la configuration du traitement sur l estimation troposphérique par GNSS Impact de la configuration du traitement sur l estimation troposphérique par GNSS Anne-Lise LAVAUX (L2G) Laurent MOREL (L2G) François FUND (CNES) Frédéric DURAND (L2G) Contexte Stratégie de traitement

Plus en détail

TD1 Signaux, énergie et puissance, signaux aléatoires

TD1 Signaux, énergie et puissance, signaux aléatoires TD1 Signaux, énergie et puissance, signaux aléatoires I ) Ecrire l'expression analytique des signaux représentés sur les figures suivantes à l'aide de signaux particuliers. Dans le cas du signal y(t) trouver

Plus en détail

Post-processing of multimodel hydrological forecasts for the Baskatong catchment

Post-processing of multimodel hydrological forecasts for the Baskatong catchment + Post-processing of multimodel hydrological forecasts for the Baskatong catchment Fabian Tito Arandia Martinez Marie-Amélie Boucher Jocelyn Gaudet Maria-Helena Ramos + Context n Master degree subject:

Plus en détail

chargement d amplitude variable à partir de mesures Application à l approche fiabiliste de la tolérance aux dommages Modélisation stochastique d un d

chargement d amplitude variable à partir de mesures Application à l approche fiabiliste de la tolérance aux dommages Modélisation stochastique d un d Laboratoire de Mécanique et Ingénieriesnieries EA 3867 - FR TIMS / CNRS 2856 ER MPS Modélisation stochastique d un d chargement d amplitude variable à partir de mesures Application à l approche fiabiliste

Plus en détail

Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing

Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing Gilbert Saporta Chaire de Statistique Appliquée, CNAM ActuariaCnam, 31 mai 2012 1 L approche statistique

Plus en détail

(51) Int Cl.: H04L 29/06 (2006.01) G06F 21/55 (2013.01)

(51) Int Cl.: H04L 29/06 (2006.01) G06F 21/55 (2013.01) (19) TEPZZ 8 8 4_A_T (11) EP 2 838 241 A1 (12) DEMANDE DE BREVET EUROPEEN (43) Date de publication: 18.02.1 Bulletin 1/08 (1) Int Cl.: H04L 29/06 (06.01) G06F 21/ (13.01) (21) Numéro de dépôt: 141781.4

Plus en détail

Relation entre deux variables : estimation de la corrélation linéaire

Relation entre deux variables : estimation de la corrélation linéaire CHAPITRE 3 Relation entre deux variables : estimation de la corrélation linéaire Parmi les analyses statistiques descriptives, l une d entre elles est particulièrement utilisée pour mettre en évidence

Plus en détail

Quantification Scalaire et Prédictive

Quantification Scalaire et Prédictive Quantification Scalaire et Prédictive Marco Cagnazzo Département Traitement du Signal et des Images TELECOM ParisTech 7 Décembre 2012 M. Cagnazzo Quantification Scalaire et Prédictive 1/64 Plan Introduction

Plus en détail

LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING»

LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING» LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING» Gilbert Saporta Professeur de Statistique Appliquée Conservatoire National des Arts et Métiers Dans leur quasi totalité, les banques et organismes financiers

Plus en détail

Mesure agnostique de la qualité des images.

Mesure agnostique de la qualité des images. Mesure agnostique de la qualité des images. Application en biométrie Christophe Charrier Université de Caen Basse-Normandie GREYC, UMR CNRS 6072 Caen, France 8 avril, 2013 C. Charrier NR-IQA 1 / 34 Sommaire

Plus en détail

Logiciel XLSTAT version 7.0. 40 rue Damrémont 75018 PARIS

Logiciel XLSTAT version 7.0. 40 rue Damrémont 75018 PARIS Logiciel XLSTAT version 7.0 Contact : Addinsoft 40 rue Damrémont 75018 PARIS 2005-2006 Plan Présentation générale du logiciel Statistiques descriptives Histogramme Discrétisation Tableau de contingence

Plus en détail

1. Vocabulaire : Introduction au tableau élémentaire

1. Vocabulaire : Introduction au tableau élémentaire L1-S1 Lire et caractériser l'information géographique - Le traitement statistique univarié Statistique : le terme statistique désigne à la fois : 1) l'ensemble des données numériques concernant une catégorie

Plus en détail

Baccalauréat ES Polynésie (spécialité) 10 septembre 2014 Corrigé

Baccalauréat ES Polynésie (spécialité) 10 septembre 2014 Corrigé Baccalauréat ES Polynésie (spécialité) 10 septembre 2014 Corrigé A. P. M. E. P. Exercice 1 5 points 1. Réponse d. : 1 e Le coefficient directeur de la tangente est négatif et n est manifestement pas 2e

Plus en détail

Baccalauréat ES/L Métropole La Réunion 13 septembre 2013 Corrigé

Baccalauréat ES/L Métropole La Réunion 13 septembre 2013 Corrigé Baccalauréat S/L Métropole La Réunion 13 septembre 2013 Corrigé A. P. M.. P. XRCIC 1 Commun à tous les candidats Partie A 1. L arbre de probabilité correspondant aux données du problème est : 0,3 0,6 H

Plus en détail

Acquisition de données et pilotage d instruments avec LABVIEW

Acquisition de données et pilotage d instruments avec LABVIEW W 2009 PROJET LABVIEW Acquisition de données et pilotage d instruments avec LABVIEW Projet Linel LABVIEW (70h) L Besoin logiciel et matériel : (par poste) 1 PC + le logiciel LABVIEW version (8.2) + le

Plus en détail

Utilisation des réseaux bayésiens et de l approche de Fenton pour l estimation de probabilité d occurrence d événements

Utilisation des réseaux bayésiens et de l approche de Fenton pour l estimation de probabilité d occurrence d événements Utilisation des réseaux bayésiens et de l approche de Fenton pour l estimation de probabilité d occurrence d événements Rapport LAAS-CNRS Numéro N o 13077 Quynh Anh DO HOANG, Jérémie GUIOCHET, Mohamed

Plus en détail

Projet de traitement d'image - SI 381 reconstitution 3D d'intérieur à partir de photographies

Projet de traitement d'image - SI 381 reconstitution 3D d'intérieur à partir de photographies Projet de traitement d'image - SI 381 reconstitution 3D d'intérieur à partir de photographies Régis Boulet Charlie Demené Alexis Guyot Balthazar Neveu Guillaume Tartavel Sommaire Sommaire... 1 Structure

Plus en détail

Déroulement d un projet en DATA MINING, préparation et analyse des données. Walid AYADI

Déroulement d un projet en DATA MINING, préparation et analyse des données. Walid AYADI 1 Déroulement d un projet en DATA MINING, préparation et analyse des données Walid AYADI 2 Les étapes d un projet Choix du sujet - Définition des objectifs Inventaire des données existantes Collecte, nettoyage

Plus en détail

Quelques analyses simples avec R en écologie des communautés

Quelques analyses simples avec R en écologie des communautés Jérôme Mathieu janvier 2007 Quelques analyses simples avec R en écologie des communautés 1 Visualisation des données... 2 Aperçu rapide d'un tableau de données... 3 Visualiser les corrélations entre des

Plus en détail

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE UE4 : Biostatistiques Chapitre 3 : Principe des tests statistiques d hypothèse José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Plan I. Introduction

Plus en détail

WEKA, un logiciel libre d apprentissage et de data mining

WEKA, un logiciel libre d apprentissage et de data mining Approche Data Mining par WEKA WEKA, un logiciel libre d apprentissage et de data mining Yves Lechevallier INRIA-Rocquencourt E_mail : Yves.Lechevallier@inria.fr Yves Lechevallier Dauphine 1 1 WEKA 3.4

Plus en détail

Théorie des graphes pour l analyse de réseaux d intéractions

Théorie des graphes pour l analyse de réseaux d intéractions Théorie des graphes pour l analyse de réseaux d intéractions Bertrand Jouve Laboratoire ERIC - IXXI - Université Lyon 2 SMAI 2013 Plan 1 Introduction 2 Décomposition en Clans Exemple d étude : modélisation

Plus en détail

Baccalauréat ES/L Amérique du Sud 21 novembre 2013

Baccalauréat ES/L Amérique du Sud 21 novembre 2013 Baccalauréat ES/L Amérique du Sud 21 novembre 2013 A. P. M. E. P. EXERCICE 1 Commun à tous les candidats 5 points Une entreprise informatique produit et vend des clés USB. La vente de ces clés est réalisée

Plus en détail

GUIDE DU DATA MINER. Scoring - Modélisation. Data Management, Data Mining, Text Mining

GUIDE DU DATA MINER. Scoring - Modélisation. Data Management, Data Mining, Text Mining GUIDE DU DATA MINER Scoring - Modélisation Data Management, Data Mining, Text Mining 1 Guide du Data Miner Scoring - Modélisation Le logiciel décrit dans le manuel est diffusé dans le cadre d un accord

Plus en détail

Techniques de DM pour la GRC dans les banques Page 11

Techniques de DM pour la GRC dans les banques Page 11 Techniques de DM pour la GRC dans les banques Page 11 II.1 Introduction Les techniques de data mining sont utilisé de façon augmentaté dans le domaine économique. Tels que la prédiction de certains indicateurs

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail

UML Diagramme de classes (class diagram) pour le recueil et l analyse des besoins. Emmanuel Pichon 2013 V1.1

UML Diagramme de classes (class diagram) pour le recueil et l analyse des besoins. Emmanuel Pichon 2013 V1.1 UML Diagramme de classes (class diagram) pour le recueil et l analyse des besoins 2013 V1.1 Objectif Diagramme de classes (class diagram) pour le recueil des besoins et l analyse Présenter un ensemble

Plus en détail

Chapitre 2 L actualisation... 21

Chapitre 2 L actualisation... 21 III Table des matières Avant-propos Remerciements.... Les auteurs... XI XII Chapitre 1 L intérêt.... 1 1. Mise en situation.... 1 2. Concept d intérêt... 1 2.1. L unité de temps... 2 2.2. Le taux d intérêt...

Plus en détail

Séminaire Valorisation des Instruments Complexes 09/03/2012

Séminaire Valorisation des Instruments Complexes 09/03/2012 Du Bon Usage de la Valorisation Eric Benhamou Séminaire Valorisation des Instruments Complexes 09/03/2012 Plan Méthode de valorisation Problématiques actuelles Analyse de Cas Réconciliation avec d autres

Plus en détail

Maintenabilité d un parc applicatif

Maintenabilité d un parc applicatif 1 Maintenabilité d un parc applicatif Une méthode pour évaluer les charges de maintenance 13/06/01 Jean-François Bailliot 2 Maintenabilité d un parc applicatif Maintenance / Développement importance relative

Plus en détail

Cours 7 : Exemples. I- Régression linéaire simple II- Analyse de variance à 1 facteur III- Tests statistiques

Cours 7 : Exemples. I- Régression linéaire simple II- Analyse de variance à 1 facteur III- Tests statistiques Cours 7 : Exemples I- Régression linéaire simple II- Analyse de variance à 1 facteur III- Tests statistiques Exemple 1 : On cherche à expliquer les variations de y par celles d une fonction linéaire de

Plus en détail

Expérience 3 Formats de signalisation binaire

Expérience 3 Formats de signalisation binaire Expérience 3 Formats de signalisation binaire Introduction Procédures Effectuez les commandes suivantes: >> xhost nat >> rlogin nat >> setenv DISPLAY machine:0 >> setenv MATLABPATH /gel/usr/telecom/comm_tbx

Plus en détail

Introduction aux Statistiques et à l utilisation du logiciel R

Introduction aux Statistiques et à l utilisation du logiciel R Introduction aux Statistiques et à l utilisation du logiciel R Christophe Lalanne Christophe Pallier 1 Introduction 2 Comparaisons de deux moyennes 2.1 Objet de l étude On a mesuré le temps de sommeil

Plus en détail

1- Le cadre et la problématique

1- Le cadre et la problématique PFI ACTOR, 23/03/2011 Des critères aux schèmes d actions L ergonomie dans une conception orientée objet des produits logiciels D une démarche «centrée utilisateur» vers une démarche «fondée sur les situations»

Plus en détail

Température corporelle d un castor (une petite introduction aux séries temporelles)

Température corporelle d un castor (une petite introduction aux séries temporelles) Température corporelle d un castor (une petite introduction aux séries temporelles) GMMA 106 GMMA 106 2014 2015 1 / 32 Cas d étude Temperature (C) 37.0 37.5 38.0 0 20 40 60 80 100 Figure 1: Temperature

Plus en détail

Mortalité observée et mortalité attendue au cours de la vague de chaleur de juillet 2006 en France métropolitaine

Mortalité observée et mortalité attendue au cours de la vague de chaleur de juillet 2006 en France métropolitaine Mortalité observée et mortalité attendue au cours de la vague de chaleur de uillet en France métropolitaine FOUILLET A 1, REY G 1, JOUGLA E, HÉMON D 1 1 Inserm, U75, Villeuif, France. Inserm CépiDc, IFR9,

Plus en détail

Projet de Traitement du Signal Segmentation d images SAR

Projet de Traitement du Signal Segmentation d images SAR Projet de Traitement du Signal Segmentation d images SAR Introduction En analyse d images, la segmentation est une étape essentielle, préliminaire à des traitements de haut niveau tels que la classification,

Plus en détail

Pour le renouvellement de la sémiologie de la carte de flux

Pour le renouvellement de la sémiologie de la carte de flux Thème 3 : la sémiologie usages et renouveau Pour le renouvellement de la sémiologie de la carte de flux Françoise Bahoken Représenter sur une carte toute l information disponible dans une matrice de flux,

Plus en détail

TP oscilloscope et GBF

TP oscilloscope et GBF TP oscilloscope et GBF Ce TP est évalué à l'aide d'un questionnaire moodle. Objectif : ce travail a pour buts de manipuler l oscilloscope et le GBF. A l issu de celui-ci, toutes les fonctions essentielles

Plus en détail

données en connaissance et en actions?

données en connaissance et en actions? 1 Partie 2 : Présentation de la plateforme SPSS Modeler : Comment transformer vos données en connaissance et en actions? SPSS Modeler : l atelier de data mining Large gamme de techniques d analyse (algorithmes)

Plus en détail

Plan du cours. Vocabulaire. Définitions d un projet. Les cinq phases de la Gestion de Projets. 1- Conception

Plan du cours. Vocabulaire. Définitions d un projet. Les cinq phases de la Gestion de Projets. 1- Conception Plan du cours Vocabulaire Définitions d un projet Les cinq phases de la Gestion de Projets 1- Conception Planification du Projet Ingénierie du projet Ordonnancement des activités Estimation des durées

Plus en détail

De la mesure à l analyse des risques

De la mesure à l analyse des risques De la mesure à l analyse des risques Séminaire ISFA - B&W Deloitte Jean-Paul LAURENT Professeur à l'isfa, Université Claude Bernard Lyon 1 laurent.jeanpaul@free.fr http://laurent.jeanpaul.free.fr/ 0 De

Plus en détail

Problématiques dans trading à haute fréquence

Problématiques dans trading à haute fréquence Extrait de la présentation de Charles-Albert Lehalle, Atelier Trading & Micro-structure, Collège de France, 10 Décembre 2008. mdang@cheuvreux.com Recherche Quantitative, Séminaire de la finance, VNFinance

Plus en détail

De la mesure à l analyse des risques

De la mesure à l analyse des risques De la mesure à l analyse des risques Séminaire FFA Jean-Paul LAURENT Professeur à l'isfa jean-paul.laurent@univ-lyon1.fr http://laurent.jeanpaul.free.fr/ 0 De la la mesure à l analyse des risques! Intégrer

Plus en détail

ANALYSE MULTI CAPTEUR DE SIGNAUX TRANSITOIRES ISSUS DES SYSTEMES ELECTRIQUES

ANALYSE MULTI CAPTEUR DE SIGNAUX TRANSITOIRES ISSUS DES SYSTEMES ELECTRIQUES ANALYSE MULTI CAPTEUR DE SIGNAUX TRANSITOIRES ISSUS DES SYSTEMES ELECTRIQUES Bertrand GOTTIN Directeurs de thèse: Cornel IOANA et Jocelyn CHANUSSOT 03 Septembre 2010 Problématique liée aux Transitoires

Plus en détail

Etudier l influence de différents paramètres sur un phénomène physique Communiquer et argumenter en utilisant un vocabulaire scientifique adapté

Etudier l influence de différents paramètres sur un phénomène physique Communiquer et argumenter en utilisant un vocabulaire scientifique adapté Compétences travaillées : Mettre en œuvre un protocole expérimental Etudier l influence de différents paramètres sur un phénomène physique Communiquer et argumenter en utilisant un vocabulaire scientifique

Plus en détail

Lois de probabilité à densité Loi normale

Lois de probabilité à densité Loi normale DERNIÈRE IMPRESSIN LE 31 mars 2015 à 14:11 Lois de probabilité à densité Loi normale Table des matières 1 Lois à densité 2 1.1 Introduction................................ 2 1.2 Densité de probabilité

Plus en détail

Baccalauréat ES Antilles Guyane 12 septembre 2014 Corrigé

Baccalauréat ES Antilles Guyane 12 septembre 2014 Corrigé Baccalauréat ES Antilles Guyane 12 septembre 2014 Corrigé EXERCICE 1 5 points Commun à tous les candidats 1. Réponse c : ln(10)+2 ln ( 10e 2) = ln(10)+ln ( e 2) = ln(10)+2 2. Réponse b : n 13 0,7 n 0,01

Plus en détail

Introduction au datamining

Introduction au datamining Introduction au datamining Patrick Naïm janvier 2005 Définition Définition Historique Mot utilisé au départ par les statisticiens Le mot indiquait une utilisation intensive des données conduisant à des

Plus en détail

Cours de méthodes de scoring

Cours de méthodes de scoring UNIVERSITE DE CARTHAGE ECOLE SUPERIEURE DE STATISTIQUE ET D ANALYSE DE L INFORMATION Cours de méthodes de scoring Préparé par Hassen MATHLOUTHI Année universitaire 2013-2014 Cours de méthodes de scoring-

Plus en détail

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population.

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population. Première STMG1 2014-2015 progression. - 1 Table des matières Fil rouge. 3 Axes du programme. 3 Séquence : Proportion d une sous population dans une population. 3 Information chiffrée : connaître et exploiter

Plus en détail

Copyright / 2014 Éditions Stratégies et développement Siège Social 20 Rue du Béguinage 59154 Crespin

Copyright / 2014 Éditions Stratégies et développement Siège Social 20 Rue du Béguinage 59154 Crespin A Lire : Très Important Cet E-book ne peut être utilisé que pour un usage privé uniquement. Vous n avez pas le droit de l offrir ni de le revendre sans accord de l auteur. Toutes reproductions, partielles

Plus en détail

Statistiques Appliquées à l Expérimentation en Sciences Humaines. Christophe Lalanne, Sébastien Georges, Christophe Pallier

Statistiques Appliquées à l Expérimentation en Sciences Humaines. Christophe Lalanne, Sébastien Georges, Christophe Pallier Statistiques Appliquées à l Expérimentation en Sciences Humaines Christophe Lalanne, Sébastien Georges, Christophe Pallier Table des matières 1 Méthodologie expérimentale et recueil des données 6 1.1 Introduction.......................................

Plus en détail

Application de la télédétection à la cartographie de l enneigement du Haut Atlas de Marrakech à partir d images SPOT VEGETATION et LANDSAT TM.

Application de la télédétection à la cartographie de l enneigement du Haut Atlas de Marrakech à partir d images SPOT VEGETATION et LANDSAT TM. Projet de recherche franco-marocain : Fonctionnement et ressources hydro-écologiques en région semi-aride (Tensift, Maroc) : Caractérisation, modélisation et prévision Application de la télédétection à

Plus en détail

Table des matières. Avant-propos. Chapitre 2 L actualisation... 21. Chapitre 1 L intérêt... 1. Chapitre 3 Les annuités... 33 III. Entraînement...

Table des matières. Avant-propos. Chapitre 2 L actualisation... 21. Chapitre 1 L intérêt... 1. Chapitre 3 Les annuités... 33 III. Entraînement... III Table des matières Avant-propos Remerciements................................. Les auteurs..................................... Chapitre 1 L intérêt............................. 1 1. Mise en situation...........................

Plus en détail

DETERMINATION DE L INCERTITUDE DE MESURE POUR LES ANALYSES CHIMIQUES QUANTITATIVES

DETERMINATION DE L INCERTITUDE DE MESURE POUR LES ANALYSES CHIMIQUES QUANTITATIVES Agence fédérale pour la Sécurité de la Chaîne alimentaire Administration des Laboratoires Procédure DETERMINATION DE L INCERTITUDE DE MESURE POUR LES ANALYSES CHIMIQUES QUANTITATIVES Date de mise en application

Plus en détail

Séminaire OPEN DATA de l AFIA et du RMT Modelia du 7 janvier 2015 Paris

Séminaire OPEN DATA de l AFIA et du RMT Modelia du 7 janvier 2015 Paris Diagnostic en santé végétale : Comment optimiser la collecte et le traitement de l information technique et scientifique? Action du Réseau Mixte Technologique «Diagnostic en santé végétale» VEGDIAG Labellisé

Plus en détail

Exercices - Polynômes : corrigé. Opérations sur les polynômes

Exercices - Polynômes : corrigé. Opérations sur les polynômes Opérations sur les polynômes Exercice 1 - Carré - L1/Math Sup - Si P = Q est le carré d un polynôme, alors Q est nécessairement de degré, et son coefficient dominant est égal à 1. On peut donc écrire Q(X)

Plus en détail

PROGRAMME (Susceptible de modifications)

PROGRAMME (Susceptible de modifications) Page 1 sur 8 PROGRAMME (Susceptible de modifications) Partie 1 : Méthodes des revues systématiques Mercredi 29 mai 2013 Introduction, présentation du cours et des participants Rappel des principes et des

Plus en détail

Royaume du Maroc Secrétariat d État auprès du Ministère de l Énergie, des Mines, de l Eau et de l Environnement, Chargé de l Eau et de l Environnement Direction de la Météorologie Nationale Variabilité

Plus en détail

Comment ne pas construire un score-titanic

Comment ne pas construire un score-titanic Comment ne pas construire un score-titanic Mon mailing Olivier Decourt ABS Technologies / Educasoft Formations 1- Les principes 2- Un premier exemple : les vins de France 3- Mise en œuvre sous SAS 4- Un

Plus en détail

ASSURER LA QUALITE DES RESULTATS D ESSAI ET D ETALONNAGE Assuring the quality of test and calibration results

ASSURER LA QUALITE DES RESULTATS D ESSAI ET D ETALONNAGE Assuring the quality of test and calibration results ASSURER LA QUALITE DES RESULTATS D ESSAI ET D ETALONNAGE Assuring the quality of test and calibration results Soraya Amarouche Armelle Picau Olivier Pierson Raphaël Deal Laboratoire National de Métrologie

Plus en détail

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p.

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p. STATISTIQUE THÉORIQUE ET APPLIQUÉE Tome 2 Inférence statistique à une et à deux dimensions Pierre Dagnelie TABLE DES MATIÈRES Bruxelles, De Boeck, 2011, 736 p. ISBN 978-2-8041-6336-5 De Boeck Services,

Plus en détail

Réussir. un projet de site web. 6 e édition. Groupe Eyrolles, 2003, 2004, 2005, 2006, 2008 et 2010 pour la présente édition, ISBN : 978-2-212-12742-3

Réussir. un projet de site web. 6 e édition. Groupe Eyrolles, 2003, 2004, 2005, 2006, 2008 et 2010 pour la présente édition, ISBN : 978-2-212-12742-3 N i c o l a s C h u Réussir un projet de site web 6 e édition Groupe Eyrolles, 2003, 2004, 2005, 2006, 2008 et 2010 pour la présente édition, ISBN : 978-2-212-12742-3 annexe D Les indicateurs de pilotage

Plus en détail

Exploitation et analyse des données appliquées aux techniques d enquête par sondage. Introduction.

Exploitation et analyse des données appliquées aux techniques d enquête par sondage. Introduction. Exploitation et analyse des données appliquées aux techniques d enquête par sondage. Introduction. Etudes et traitements statistiques des données : le cas illustratif de la démarche par sondage INTRODUCTION

Plus en détail

1. Les tests passés lors de la Journée Défense et Citoyenneté (JDC)

1. Les tests passés lors de la Journée Défense et Citoyenneté (JDC) LES JEUNES FACE A L ECRIT UN NOUVEAU DISPOSITIF D EVALUATION MASSIVE DE LEURS PERFORMANCES EN LECTURE Thierry Rocher* * DEPP, thierry.rocher@education.gouv.fr Mots-clés : illettrisme, test automatisé,

Plus en détail

K. Ammar, F. Bachoc, JM. Martinez. Séminaire ARISTOTE - 23 octobre 2014 - Palaiseau

K. Ammar, F. Bachoc, JM. Martinez. Séminaire ARISTOTE - 23 octobre 2014 - Palaiseau Apport des modèles de krigeage à la simulation numérique K Ammar, F Bachoc, JM Martinez CEA-Saclay, DEN, DM2S, F-91191 Gif-sur-Yvette, France Séminaire ARISTOTE - 23 octobre 2014 - Palaiseau Apport des

Plus en détail

AFIM EONOS 5 RAPPORT ANNUEL. Exercice clos le 31 décembre 2014. Société de gestion : AVENIR FINANCE INVESTMENT MANAGERS

AFIM EONOS 5 RAPPORT ANNUEL. Exercice clos le 31 décembre 2014. Société de gestion : AVENIR FINANCE INVESTMENT MANAGERS AFIM EONOS 5 RAPPORT ANNUEL Exercice clos le 31 décembre 2014 Code ISIN : Part B : FR0010789784 Part C : FR0010800300 Dénomination : AFIM EONOS 5 Forme juridique : FCP de droit français Compartiments/nourricier

Plus en détail

Projet SINF2275 «Data mining and decision making» Projet classification et credit scoring

Projet SINF2275 «Data mining and decision making» Projet classification et credit scoring Projet SINF2275 «Data mining and decision making» Projet classification et credit scoring Année académique 2006-2007 Professeurs : Marco Saerens Adresse : Université catholique de Louvain Information Systems

Plus en détail

Optimisation du rééchantillonnage dans un logiciel d Amélioration des Plantes

Optimisation du rééchantillonnage dans un logiciel d Amélioration des Plantes Optimisation du rééchantillonnage dans un logiciel d Amélioration des Plantes Baradat P. INRA-Département EFPA UMR AMAP 34398 Montpellier Cedex 5 FRANCE baradat@ensam.inra.fr Labbé T. INRA-Département

Plus en détail

Simulations et Méthodes de Monte Carlo

Simulations et Méthodes de Monte Carlo Simulations et Méthodes de Monte Carlo Kam Yuen CHU Ezzoubir KODAD Responsable : Thierry RONCALLI 1 EXO 1 : Risque de marché library pgraph; @Exo1: Risque de marché@ let So=100 150 ; let theta = 1 1; let

Plus en détail

Projet ANR. Bruno Capra - OXAND. 04/06/2015 CEOS.fr - Journée de restitution (Paris) B. CAPRA

Projet ANR. Bruno Capra - OXAND. 04/06/2015 CEOS.fr - Journée de restitution (Paris) B. CAPRA Projet ANR Bruno Capra - OXAND MEFISTO : Maîtrise durable de la fissuration des infrastructures en bétons Contexte Problématique des Maîtres d Ouvrages Evaluation et prédiction de la performance des ouvrages

Plus en détail

Application des courbes ROC à l analyse des facteurs pronostiques binaires

Application des courbes ROC à l analyse des facteurs pronostiques binaires Application des courbes ROC à l analyse des facteurs pronostiques binaires Combescure C (1), Perneger TV (1), Weber DC (2), Daurès J P (3), Foucher Y (4) (1) Service d épidémiologie clinique et Centre

Plus en détail

OUTILS STATISTIQUES ET NUMÉRIQUES

OUTILS STATISTIQUES ET NUMÉRIQUES UNIVERSITÉ D ORLEANS Année universitaire 211-212 UFR Sciences Master FAC et SAE, 2ème année OUTILS STATISTIQUES ET NUMÉRIQUES POUR LA MESURE ET LA SIMULATION T. Dudok de Wit Université d Orléans 16 septembre

Plus en détail

Notice de sélection pour Consultant Individuel IC-UPS/021/2013

Notice de sélection pour Consultant Individuel IC-UPS/021/2013 Notice de sélection pour Consultant Individuel IC-UPS/021/2013 Date: 15 Février 2013 Pays Intitulé de la mission : République Démocratique du Congo RDC Sélection d un consultant Chef d équipe pour l élaboration

Plus en détail

Statistiques Descriptives à une dimension

Statistiques Descriptives à une dimension I. Introduction et Définitions 1. Introduction La statistique est une science qui a pour objectif de recueillir et de traiter les informations, souvent en très grand nombre. Elle regroupe l ensemble des

Plus en détail

COURS DE STATISTIQUE APPLIQUÉE

COURS DE STATISTIQUE APPLIQUÉE UNIVERSITE PROTESTANTE AU CONGO CENTRE CONGOLAIS-ALLEMAND DE MICROFINANCE COURS DE STATISTIQUE APPLIQUÉE Professeur Daniel MUKOKO Samba daniel_mukoko@yahoo.fr Quelques références Droesbeke, Jean-Jacques,

Plus en détail

Principe d évaluation des tests diagnostiques

Principe d évaluation des tests diagnostiques Principe d évaluation des tests diagnostiques Dr Sandra DAVID TCHOUDA Cellule d évaluation médico-économique des innovation, CHUG sdavidtchouda@chu-grenoble.fr Plan Objectif et contexte de ces études visant

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Intérêt du découpage en sous-bandes pour l analyse spectrale

Intérêt du découpage en sous-bandes pour l analyse spectrale Intérêt du découpage en sous-bandes pour l analyse spectrale David BONACCI Institut National Polytechnique de Toulouse (INP) École Nationale Supérieure d Électrotechnique, d Électronique, d Informatique,

Plus en détail

Nombres, mesures et incertitudes en sciences physiques et chimiques. Groupe des Sciences physiques et chimiques de l IGEN

Nombres, mesures et incertitudes en sciences physiques et chimiques. Groupe des Sciences physiques et chimiques de l IGEN Nombres, mesures et incertitudes en sciences physiques et chimiques. Groupe des Sciences physiques et chimiques de l IGEN Table des matières. Introduction....3 Mesures et incertitudes en sciences physiques

Plus en détail

TEPZZ 6Z786 A_T EP 2 607 862 A1 (19) (11) EP 2 607 862 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G01F 1/56 (2006.01) F23N 5/18 (2006.

TEPZZ 6Z786 A_T EP 2 607 862 A1 (19) (11) EP 2 607 862 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G01F 1/56 (2006.01) F23N 5/18 (2006. (19) TEPZZ 6Z786 A_T (11) EP 2 607 862 A1 (12) DEMANDE DE BREVET EUROPEEN (43) Date de publication: 26.06.13 Bulletin 13/26 (1) Int Cl.: G01F 1/6 (06.01) F23N /18 (06.01) (21) Numéro de dépôt: 114470.

Plus en détail

Econométrie Appliquée Séries Temporelles

Econométrie Appliquée Séries Temporelles Chapitre 1. UFR Economie Appliquée. Cours de C. Hurlin 1 U.F.R. Economie Appliquée Maîtrise d Economie Appliquée Cours de Tronc Commun Econométrie Appliquée Séries Temporelles Christophe HURLIN Chapitre

Plus en détail

Profils de soins infirmiers

Profils de soins infirmiers HEALTH.FGOV.BE Profils de soins infirmiers NRG sur base du DI-RHM DG GS Datamanagement 29/09/2014 Version 2.3 1 Sommaire I. Introduction... 3 II. Définir les NRG... 4 1. Pondération des scores des items

Plus en détail

Rôle des nuages dans l'anomalie de température de l'hiver 2007 en Europe

Rôle des nuages dans l'anomalie de température de l'hiver 2007 en Europe Rôle des nuages dans l'anomalie de température de l'hiver 2007 en Europe Meriem Chakroun Marjolaine Chiriaco (1) Sophie Bastin (1) Hélène Chepfer (2) Grégory Césana (2) Pascal Yiou (3) (1): LATMOS (2):

Plus en détail

Filtrage - Intégration - Redressement - Lissage

Filtrage - Intégration - Redressement - Lissage PCSI - Stanislas - Electrocinétique - TP N 3 - Filtrage - Intégration - Redressement - Lissage Filtrage - Intégration - Redressement - Lissage Prenez en note tout élément pouvant figurer dans un compte-rendu

Plus en détail

Tests d indépendance en analyse multivariée et tests de normalité dans les modèles ARMA

Tests d indépendance en analyse multivariée et tests de normalité dans les modèles ARMA Tests d indépendance en analyse multivariée et tests de normalité dans les modèles ARMA Soutenance de doctorat, sous la direction de Pr. Bilodeau, M. et Pr. Ducharme, G. Université de Montréal et Université

Plus en détail