Génie génétique et biotechnologie

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Génie génétique et biotechnologie"

Transcription

1 Génie génétique et biotechnologie

2 Acides nucléiques (rappel) Transcription ADN ARNm Traduction protéines Nucléotides Acides aminés

3 Acides nucléiques Nucléotides : Gr. Phosphate Campbell 2 e edition, fig. 5.29

4 Acides nucléiques Nucléotides : Gr. Phosphate Sucre (pentose) : Ribose pour ARN Désoxyribose pour ADN Campbell 2 e edition, fig. 5.29

5 Acides nucléiques Nucléotides : Ribose pour ARN Désoxyribose pour ADN Gr. Phosphate Campbell 2 e edition, fig. 5.29

6 Acides nucléiques Nucléotides : Ribose pour ARN Désoxyribose pour ADN Gr. Phosphate Différence au carbone 2 Campbell 2 e edition, fig. 5.29

7 Acides nucléiques Nucléotides : Base azotée Gr. Phosphate Sucre (pentose) : - Ribose pour ARN - Désoxyribose pour ADN

8 Acides nucléiques Bases azotées : 5 différentes qui sont regroupées en Purines Pyrimidines Adénine Guanine Cytosine Thymine Uracile Campbell 2 e edition, fig. 5.29

9 Acides nucléiques Bases azotées : 5 différentes qui sont regroupées en Purines Pyrimidines Adénine Guanine Cytosine Thymine Uracile Seulement ADN Seulement ARN Campbell 2 e edition, fig. 5.29

10 Acides nucléiques + + +

11 Acides nucléiques + Polymère: brin d ARN ou brin d ADN = + +

12 Acides nucléiques Dans le cas de l ADN + = Double hélice

13 Structure de l ADN Bases azotées Nucléotide

14 Structure de l ADN Bases azotées Bases azotées au centre A + T C + G Squelette phosphate à l extérieur

15 Troisième base Deuxième base Première base

16 Deuxième base Troisième base Ce code est UNIVERSEL Première base

17 Travail: Individuel Temps: 5 minutes À faire: Compléter l exercice sur la transcription et la traduction des notes de cours

18 Biotechnologie Application des techniques qui utilisent des êtres vivants sous leur forme naturelle ou modifiée à des fins pratiques ou industrielles

19 Génome humain

20 Génome humain But: Obtenir la séquence du génome humain Nombre de gènes prévu: Nombre de gènes réel:

21 Génome humain Conséquences : 1- Technologies de séquençage furent améliorées

22 Génome humain Conséquences : 1- Technologies de séquençage furent améliorées 2- Meilleure compréhension de certaines séquences

23 Génome humain Conséquences : 1- Technologies de séquençage furent améliorées 2- Meilleure compréhension de certaines séquences 3- Émergence de nouvelles sciences (bioinformatique et pharmacogénomique)

24 Génome humain Comment? Microréseaux d ADN

25 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction)

26 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction) ATTAAACGCCATATCGGGCCTTCGAGCTTAAAGGCCTTT

27 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction) ATTAAACGCCATATCGGGCCTTCGAGCTTAAAGGCCTTT

28 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction) ATTAAACGCCATATCGGGCCTTCGAGCTTAAAGGCCTTT 2- Ajouter une étiquette fluorescente aux fragments

29 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction) ATTAAACGCCATATCGGGCCTTCGAGCTTAAAGGCCTTT 2- Ajouter une étiquette fluorescente aux fragments

30 Génome humain Comment? Microréseaux d ADN Support avec séquences d ADN connues (sondes) 1- Couper le fragment d ADN inconnu (enzymes de restriction) ATTAAACGCCATATCGGGCCTTCGAGCTTAAAGGCCTTT 2- Ajouter une étiquette fluorescente aux fragments 3- Déposer les fragments sur la plaque (se lient aux séquences complémentaires)

31 Génome humain Comment? Microréseaux d ADN 4- Rincer et analyser les résultats à l aide d un ordinateur

32 Travail: Équipe de deux Temps: 10 minutes À faire: Compléter l exercice sur le séquençage du génome humain

33 Réponse ATTCGAGG

34 Transfert de gène (clonage) Clone: Organisme génétiquement identique à un autre

35 Transfert de gène (clonage) Buts: 1- Fabriquer beaucoup de copies d un gène particulier 2- Produire une protéine en grande quantité

36 Transfert de gène (clonage) À savoir : Plasmide ADN circulaire distinct du chromosome bactérien et capable de se répliquer

37 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) Reconnait une séquence d ADN spécifique = Site de restriction

38 Transfert de gène (clonage) Comment: Site de restriction Ex: Enzyme reconnait séquence 5 GAATTC 3 et coupe entre G et A

39 Travail: Individuel Temps: 5 minutes À faire: Compléter l exercice sur les enzymes de restriction

40 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase)

41 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) ADN ligase

42 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) ADN ligase

43 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) 3- Réintroduire le plasmide recombiné dans la bactérie

44 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) 3- Réintroduire le plasmide recombiné dans la bactérie

45 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) 3- Réintroduire le plasmide recombiné dans la bactérie 4- Étaler les bactéries sur des géloses nutritives et incubation

46 Transfert de gène (clonage) Comment: 1- Enzyme de restriction (couper le gène d intérêt et le plasmide) 2- Lier le gène dans le plasmide (ADN ligase) 3- Réintroduire le plasmide recombiné dans la bactérie 4- Étaler les bactéries sur des géloses nutritives et incubation

47 OGM qu en savez-vous?

48 OGM qu en savez-vous? Quel pays était le plus grand producteur d OGM en 2007? a) Canada b) Chine c) États-Unis d) Argentine Réponse: États-Unis avec 51% de la superficie mondiale

49

50 OGM qu en savez-vous? Vrai ou Faux. L insuline utilisée pour traiter le diabète est produite par des bactéries génétiquement modifiées? Réponse: Vrai

51 OGM qu en savez-vous? Le soja, le canola et le maïs génétiquement modifiés sont approuvés au Canada. Depuis quand? a) Les années 1980 b) Les années 1990 c) En 2003 d) Faux, ils ne sont pas approuvés au Canada Réponse: les années

52 OGM qu en savez-vous? En quelle année les fraises GM (ajout d un gène de poisson afin de résister au gel) furent-elles approuvées au Canada? a) Les années 1980 b) Les années 1990 c) En 2003 d) Faux, elles ne sont pas approuvés au Canada Réponse: Faux

53 Les OGM dans les aliments REPORTAGE

54 Exemples d OGM

55 Exemples d OGM Tomates résistantes au sel

56 Exemples d OGM Tomates résistantes au sel Riz produisant de la bêta-carotêne

57 Exemples d OGM Tomates résistantes au sel Riz produisant de la bêta-carotêne Résistance aux herbicides de certaines plantes

58 Les OGM qu en pensez-vous? À faire: Lire le texte sur les OGM dans vos notes de cours

59 Clonage Naturel

60 Clonage Naturel Artificiel Utiliser une cellule somatique d un organisme pour fabriquer un autre individu qui lui est génétiquement identique

61 Brebis donneuse de cellules mammaires

62 Brebis donneuse de cellules mammaires Culture des cellules mammaires dans un milieu pauvre en nutriments; arrêt du cycle cellulaire et dédifférenciation du noyau

63 Brebis donneuse d un ovocyte

64 Brebis donneuse d un ovocyte Retrait du noyau

65 Brebis donneuse d un ovocyte Fusion des cellules Retrait du noyau

66 Croissance des cellules en milieu de culture

67 Jeune embryon Croissance des cellules en milieu de culture

68 Croissance des cellules en milieu de culture Jeune embryon Implantation de l embryon dans l utérus d une brebis

69 Croissance des cellules en milieu de culture Jeune embryon Implantation de l embryon dans l utérus d une brebis Dolly

70 Clonage thérapeutique Création d un embryon en vue d obtenir des cellules souches embryonnaires qui seront utilisées à des fins médicales

71 Clonage thérapeutique REPORTAGE Découverte 18 avril 2004

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN I. STRUCTURE DE L ADN Le génome humain est contenu dans des NOYAUX (EUCARYOTES) Petite quantité d ADN en dehors du noyau dans la MITOCHONDRIE Sous

Plus en détail

CHAPITRE 5 : L ADN, SUPPORT UNIVERSEL DE L INFORMATION GENETIQUE

CHAPITRE 5 : L ADN, SUPPORT UNIVERSEL DE L INFORMATION GENETIQUE Sciences de la Vie et de la Terre lasse de 2 nde générale et technologique Thème 1 : La Terre dans l univers, la vie et l évolution du vivant La Terre, une planète habitée HAPITRE 5 : L ADN, SUPPORT UNIVERSEL

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS

Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS Cellule Toutes les cellules possèdent un ou des chromosomes qui renferment l information génétique et sont constituées

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est?

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est? LA BIOLOGIE SYNTHETIQUE Qu est-ce que c est? L ADN Qu est-ce: L ADN Molécule renfermant l'ensemble des informations nécessaires au développementet au fonctionnementd'un organisme. Support de l'hérédité:

Plus en détail

La Biologie moléculaire

La Biologie moléculaire La Biologie moléculaire Introduction La biologie moléculaire correspond à l étude de la vie à l échelle moléculaire. On s intéresse essentiellement aux acides nucléiques que sont les ADN et ARN, commandant

Plus en détail

Le support de l information génétique est constitué par une ou plusieurs molécules d ADN

Le support de l information génétique est constitué par une ou plusieurs molécules d ADN Le support de l information génétique est constitué par une ou plusieurs molécules d ADN Dr. R. Raynal, 2003 Les êtres vivants possèdent au sein de leurs cellules un "programme génétique" (donnant les

Plus en détail

Qu'est-ce que l'adn?

Qu'est-ce que l'adn? Structure Physico-chimique de l'adn Qu'est-ce que l'adn? L'ADN (acide désoxyribonucléique) est une macromolécule biologique formée par deux chaînes complémentaires qui s'emboîtent tout en s'enroulant l'une

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel

Plus en détail

Abderrahman Maftah Professeur à l université de Limoges. Jean-Michel Petit Professeur à l université de Limoges

Abderrahman Maftah Professeur à l université de Limoges. Jean-Michel Petit Professeur à l université de Limoges de biologie moléculaire ours + QM/QR Abderrahman Maftah rofesseur à l université de Limoges JeanMichel etit rofesseur à l université de Limoges Raymond Julien rofesseur émérite à l université de Limoges

Plus en détail

Nom : Groupe : L hérédité : Transmission des caractères des à leurs descendants.

Nom : Groupe : L hérédité : Transmission des caractères des à leurs descendants. Nom : Groupe : Date : THÉORIE UNIVERS VIVANT, ST-STE, 4 e secondaire LA GÉNÉTIQUE : C est la science qui étudie les gènes, leur transmission de génération en génération (l hérédité), ainsi que leur variation

Plus en détail

Examen 4F : Les biotechnologies, partie I

Examen 4F : Les biotechnologies, partie I Nom, Prénom : Corrigé 23.03.2015 Examen 4F : Les biotechnologies, partie I Durée 45 minutes. Total 49 points. 1. QCM (= questionnaire à choix multiples). Vous avez, pour chaque question, une ou plusieurs

Plus en détail

Cours de biochimie des acides nucléiques

Cours de biochimie des acides nucléiques Module de BI 121 Cours de biochimie des acides nucléiques (Enseignante : Eve de Rosny) Plan I - Introduction = présentation rapide Les acides nucléiques Rôle de l AD et de l AR Les nucléotides II Structure

Plus en détail

L expression génétique REVUE

L expression génétique REVUE L expression génétique REVUE 1. Donne trois différences entre l ADN et l ARN. L Adn est le matériel génétique qui contrôle la synthèse des protéines, alors que l ARN aide l Adn et participe à la synthèse

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel UV. /. Les gènes et les protéines Manuel, p. 390 à 39. Dites à quoi correspondent les définitions suivantes. a) Les unités de base de l ADN. Les nucléotides. b) Les «barreaux» dans la structure en double

Plus en détail

QCM Biologie Moléculaire

QCM Biologie Moléculaire QCM Biologie Moléculaire 1. Information génétique 1. L information génétique eucaryote est supportée par : A. De l ADN B. De l ARN C. Des molécules bicaténaires de polymères de nucléotides D. Des séquences

Plus en détail

Chapitre 2 LA NATURE DU VIVANT. Peut-on trouver des points communs aux molécules dont les êtres vivants sont constitués?

Chapitre 2 LA NATURE DU VIVANT. Peut-on trouver des points communs aux molécules dont les êtres vivants sont constitués? Chapitre 2 LA NATURE DU VIVANT Peut-on trouver des points communs aux molécules dont les êtres vivants sont constitués? I / A L ECHELLE MOLECULAIRE : UNE UNITE CHIMIQUE (AP # 3) A/ composition moléculaire

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p )

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p ) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail

Génome humain, hérédité et information génétique

Génome humain, hérédité et information génétique Diplôme d État Infirmier - Cycle de la vie et grandes fonctions UE 2.2 Génome humain, hérédité et information génétique Service de Biochimie & Génétique Moléculaire Jean-Pierre Rabès 23 septembre 2011

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Plan

Plus en détail

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies.

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. GENETIQUE La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. I- BASES BIOCHIMIQUES DE LA GENETIQUE L ADN est le support de l information génétique, c est à dire

Plus en détail

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Cours 1 Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Hélène Touzet La cellule 2 Que trouve-t-on dans une cellule? 30% ions,... 4% phospolipides

Plus en détail

Biologie moléculaire en 30 fiches

Biologie moléculaire en 30 fiches Philippe LETTA Biologie moléculaire en 0 fiches e édition Dunod, Paris, 00, 0 ISB --0-0- Table des matières Partie Structure Fiche onstituants Fiche Structure Fiche rganisation 0 Fiche ompaction Fiche

Plus en détail

Les protéines recombinantes

Les protéines recombinantes Les protéines recombinantes Produire des protéines de manière contrôlée et en grande quantité 1 Les cellules hôtes 2 Les vecteurs recombinants 3 Purification des protéines recombinantes 1 1 Les cellules

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

Chapitre 4: Les macromolécules

Chapitre 4: Les macromolécules Chapitre 4: Les macromolécules Molécules organiques complexes et de très grande taille Conservées dans tous les organismes 4 grands types: Glucides PROTÉINES Acides nucléiques Lipides polymères ne sont

Plus en détail

VOYAGE DANS LE MONDE DES GÈNES

VOYAGE DANS LE MONDE DES GÈNES 01 VOYAGE DANS LE MONDE DES GÈNES CORPS ORGANES TISSU CELLULES CHROMOSOME INFORMATION CELLULAIRE NOYAU CELLULAIRE ENVELOPPE CELLULAIRE ADN 02 LES GÉNES, BRIQUES DU VIVANT PROTÉINE STRUCTURALE : Détermine

Plus en détail

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction Structure secondaire (α-hélice, feuillet ß ) Structure primaire enchaînement Structure Tertiaire ---> fonction Protéines Fonction Structure tridimensionnelle Structure primaire = enchaînement d acides

Plus en détail

Comment créer un OGM? :

Comment créer un OGM? : Comment créer un OGM? : Dans cette partie, nous allons voir différents procédés qui permettent aujourd hui aux scientifiques d obtenir des organismes génétiquement modifiés. Cependant, la compréhension

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Université Mohamed Khider-Biskra Faculté des sciences exactes et des sciences de la nature et de la vie Département des sciences de la nature et de la vie Biologie moléculaire et Génie génétique Mr. BENSLAMA

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

TD3: support du cours/td

TD3: support du cours/td TD3: support du cours/td Auteur: P RAG D BRUANT Livres de complément: -Maillet (Biologie cellulaire) Masson -Alberts (la cellule) Médecine-science Flammarion -Koolman (Atlas de poche de biochimie) Médecinescience

Plus en détail

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Introduction : La démonstration par Watson et Crick en 1953, que l acide désoxyribonucléique avait une structure en double hélice est considérée

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Bilan-Projets de Memoires

Bilan-Projets de Memoires Bilan-Projets de Memoires 2 avec Pr Taleb 5 avec Pr Kadi et Benmekki sur simulateur SimClim for Arcgis (acquisition faite en septembre 2015): Simulation Climate + Marine 3 avec Dr Djemouai sur les aspects

Plus en détail

QCM Niveau Seconde (questions 1 à 29) niveau Première (30 à 35)

QCM Niveau Seconde (questions 1 à 29) niveau Première (30 à 35) QCM Niveau Seconde (questions 1 à 29) niveau Première (30 à 35) Répondez en cochant la ou les propositions exactes. L ADN : molécule support de l information génétique 1. Que signifie ADN 2. Que forme

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité? dans la cellule, où se trouve la substance responsable de l hérédité? Génétique acetabularia sp. Pr. R. Raynal Questions Si l'information était contenue dans le cytoplasme de l'ovule, de quelle couleur

Plus en détail

REFERENTIEL : GENOTYPE ET PHENOTYPE

REFERENTIEL : GENOTYPE ET PHENOTYPE REFERENTIEL : GENOTYPE ET PHENOTYPE CONNAITRE Du gène à la protéine La structure de l ADN La séquence codante Le code génétique Les niveaux de phénotypes O.G.M. Définition du gène Double chaîne de nucléotides

Plus en détail

COMPOSITION CHIMIQUE DE LA MATIERE VIVANTE

COMPOSITION CHIMIQUE DE LA MATIERE VIVANTE COMPOSITION CHIMIQUE DE LA MATIERE VIVANTE On distingue 2 grands groupes : Les substances organiques contiennent toutes du carbone. Les substances minérales sont composées surtout des autres éléments chimiques

Plus en détail

Mr. BENSLAMA A. 2016/2017

Mr. BENSLAMA A. 2016/2017 Université Mohamed Khider-Biskra Faculté des sciences exactes et des sciences de la nature et de la vie Département des sciences de la nature et de la vie Génie génétique Mr. BENSLAMA A. 2016/2017 Génie

Plus en détail

Les lipides, les protéines et les acides nucléiques

Les lipides, les protéines et les acides nucléiques Les lipides, les protéines et les acides nucléiques Les lipides Les lipides sont, dans le langage commun, des gras. Mais le monde de la graisse est beaucoup plus complexe qu on peut se l imaginer. Tout

Plus en détail

Biologie Moléculaire L2 (BIOL201) Poly Gautheret - V

Biologie Moléculaire L2 (BIOL201) Poly Gautheret - V Biologie Moléculaire L2 (BIOL201) Poly Gautheret - V. 2012.0 1 Réplication ADN Information centrale Réparation Transcription ARN messager Message codé Traduction PROTEINES Acides aminés décodés Cours de

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN L ADN des différents êtres vivants L ADN est la molécule universelle de l hérédité chromosomique : Même type de structure soit 2 brins chez tous les êtres vivants : ( animal, plante,

Plus en détail

occupent la même position sur des chromosomes homologues et gouvernent une même fonction.

occupent la même position sur des chromosomes homologues et gouvernent une même fonction. glossaire ADN : acide désoxyribonucléique : longue molécule double brin qui porte les gènes, elle est constituée de l enchaînement de nucléotides eux-mêmes constitués d une base (purique ou pyrimidique,

Plus en détail

Chapitre I. Structure des acides nucléiques

Chapitre I. Structure des acides nucléiques Chapitre I Structure des acides nucléiques 8 La biologie moléculaire en 12 étapes I. Nucléotides Les bases azotées Purines = Imidazopyrimidines Adénine (A) 6-aminopurine 1,6-dihydro-6-iminopurine Guanine

Plus en détail

Anatomie et physiologie I Techniques d analyses biomédicales SF

Anatomie et physiologie I Techniques d analyses biomédicales SF Anatomie et physiologie I Techniques d analyses biomédicales Les macromolécules Séance 2 Département de biologie et TBE Cégep de Sainte-Foy Objectifs pratiques Pouvoir reconnaître : 1) Glucides Un monosaccharide

Plus en détail

Notions de 2nde indispensables pour réussir en 1ère S

Notions de 2nde indispensables pour réussir en 1ère S Notions de 2nde indispensables pour réussir en 1ère S Schéma des types de cellules eucaryotes Membrane plasmique Mitochondrie Cytoplasme Noyau (contenant les chromosomes) Cellule animale Localisation et

Plus en détail

BIO 57 - Année Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne

BIO 57 - Année Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne BIO 57 - Année 2007-08 Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne Responsable : Professeur Keith DUDLEY - 2 - CONNAISSANCE ET TECHNIQUE

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Clonage et vecteur de clonage ou Technologie de l ADN recombinant

Clonage et vecteur de clonage ou Technologie de l ADN recombinant Clonage et vecteur de clonage ou Technologie de l ADN recombinant clonage d'un gène : opération consistant à isoler un gène, l introduire dans un vecteur et à le reproduire en grand nombre.!! A ne pas

Plus en détail

Indications de correction exercices du chapitre 7

Indications de correction exercices du chapitre 7 RI 2 RÉIVSIR Indications de correction exercices du chapitre ➊ a) L R messager est : l acide désoxyribonucléique messager l acide ribonucléique messager une molécule constituée de deux brins de nucléotides

Plus en détail

Variabilité et régulation de l expression génique

Variabilité et régulation de l expression génique BIOLOGIE CELLULAIRE - Stage de Pré-Rentrée UE1 - - 2010/2011 - Variabilité et régulation de l expression génique Objectifs Comprendre la séquence des différentes étapes menant du gène à la protéine Comprendre

Plus en détail

CHAPITRE I SERIE QCM N 4

CHAPITRE I SERIE QCM N 4 CHAPITRE I SERIE QCM N 4 Question n 1: Cocher la ou les affirmations exacte(s). Un kératinocyte : A. est repoussé vers la surface au fur et à mesure du temps. B. est une cellule différenciée qui fait partie

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Cours 30 août 2013 1 Les acides nucléiques Il existe plusieurs types d'acides nucléiques, mais essentiellement deux vont nous intéresser,

Plus en détail

STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme monophosphate.

STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme monophosphate. STRUCTURE DE L ADN I. STRUCTURE DE L ADN. II. STRUCTURE DE LA DOUBLE HELICE. III. ASPECT PHYSICO-CHIMIQUE DE L ADN. I. STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme

Plus en détail

Le noyau. Pr Edith CHEVRET Année

Le noyau. Pr Edith CHEVRET Année Le noyau Pr Edith CHEVRET Année 2016-2017 Plan Le noyau Image : Laboratoire de pathologie comparée, Saint Christol-lez-Alès Marc Ravallec / CNRS-INRA- Université Montpellier 2 2 Plan I. Définition II.

Plus en détail

CORRECTION TD GENETIQUE MOLECULAIRE

CORRECTION TD GENETIQUE MOLECULAIRE CORRECTION TD GENETIQUE MOLECULAIRE SÉANCE 1 : 1. Comment est le patrimoine génétique des cellules d un individu? Identique dans toutes ses cellules somatiques. 2. Quelle molécule est le support de ce

Plus en détail

Introduction à la génétique moléculaire. SBI4U L. Kutchaw 2013

Introduction à la génétique moléculaire. SBI4U L. Kutchaw 2013 Introduction à la génétique moléculaire SBI4U L. Kutchaw 2013 Résultat d apprentissage aujourd hui: Tu dois pouvoir résumer les principales découvertes ayant contribué au développement de la génétique

Plus en détail

Exercice 1 1) Identifier les bases présentes dans les structures suivantes :

Exercice 1 1) Identifier les bases présentes dans les structures suivantes : Exercice 1 1) Identifier les bases présentes dans les structures suivantes : 2) Parmi ces bases, lesquelles : a) contiennent du ribose. b) contiennent du désoxyribose. c) contiennent une purine. d) contiennent

Plus en détail

Les bases hétérocycliques ont des cycles insaturés composés d'azote et de carbone

Les bases hétérocycliques ont des cycles insaturés composés d'azote et de carbone Les acides nucléiques (intro et composition chimique) Les acides nucléiques 1. introduction l'étude des acides nucléiques est indispensable pour comprendre d'une part la biosynthèse des protéines (puisque

Plus en détail

Biologie Moléculaire

Biologie Moléculaire Biologie Moléculaire Sommaire Des liaisons chimiques à la structure des acides nucléiques La Transcription Maturation du transcrit La Traduction La Réplication Les Télomères 1 Des liaisons chimiques à

Plus en détail

La Cellule. Chapitre 1. Structure et fonction des macromolécules. -Glucose (sorte la + commune des monosaccharides)

La Cellule. Chapitre 1. Structure et fonction des macromolécules. -Glucose (sorte la + commune des monosaccharides) *Notes de cours basé sur le cours de biologie 1, au cégep Édouard-Montpetit, les références sont selon le livre BIOLOGIE, Neil A. Campbell, Richard Mathieu. **Ce travail est basé sur des notes de cours

Plus en détail

«Nb. Pour la correction contacter le site web :

«Nb. Pour la correction contacter le site web : L.S. Abdel Aziz Khouja Devoir de synthèse n Kélibia Sciences de la Vie et de la Terre Date : 07/0/008 Coef : Durée : h Cl: ème Sc Ex et Mr. Kordoghli M ed «Nb. Pour la correction contacter le site web

Plus en détail

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN RAPPELS : STRUCTURE DE L'ADN RAPPELS : STRUCTURE DE L'ADN Il existe différentes représentations possibles pour l'adn. Les

Plus en détail

Les acides nucléiques

Les acides nucléiques Les acides nucléiques 1. Introduction 2. Structure de l'adn 3. Structure des ARN 4. Techniques d'études Introduction Reproduction = propriété essentielle des êtres vivants Chaque génération une copie du

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre d introduction : Rappels Rappels : Les chromosomes présents

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

LES ACIDES NUCLEIQUES

LES ACIDES NUCLEIQUES LES ACIDES NUCLEIQUES INTRODUCTION Les acides nucléiques sont des macromolécules présentes dans toutes les cellules vivantes et également chez les virus. Ils constituent le support de l'information génétique

Plus en détail

La réplication de l ADN. SBI4U L. Kutchaw HBwyNrkYnp0 -qar5ib_6as

La réplication de l ADN. SBI4U L. Kutchaw  HBwyNrkYnp0  -qar5ib_6as La réplication de l ADN SBI4U L. Kutchaw http://www.youtube.com/watch?v= HBwyNrkYnp0 http://www.youtube.com/watch?v= -qar5ib_6as Le 3 théories de la réplication de l ADN La théorie conservatrice: la réplication

Plus en détail

La réplication de l ADN. SBI4U L. Kutchaw HBwyNrkYnp0 -qar5ib_6as

La réplication de l ADN. SBI4U L. Kutchaw  HBwyNrkYnp0  -qar5ib_6as La réplication de l ADN SBI4U L. Kutchaw http://www.youtube.com/watch?v= HBwyNrkYnp0 http://www.youtube.com/watch?v= -qar5ib_6as Le 3 théories de la réplication de l ADN La théorie conservatrice: la réplication

Plus en détail

Notions de 2nde indispensables pour réussir en 1ère S

Notions de 2nde indispensables pour réussir en 1ère S Notions de 2nde indispensables pour réussir en 1ère S Schéma des types de cellules eucaryotes Membrane plasmique Mitochondrie Cytoplasme Noyau (contenant les chromosomes) Cellule animale cytoplasme Paroi

Plus en détail

1-4 Les sucres (ou saccharides)

1-4 Les sucres (ou saccharides) 1-4 Les sucres (ou saccharides) Fonctions des sucres -Fonction énergétique (mono et poly) -Sucres rapides (mono et di) -Sucres de réserves (ex: glycogène) -Fonction structurale (poly) Ex: -paroi des

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Exercices : Cellule, ADN et division cellulaire

Exercices : Cellule, ADN et division cellulaire Nom : CORRIGÉ Date : Groupe : 32 33 Exercices : Cellule, ADN et division cellulaire 1. Qu est-ce qu un gène? C est un segment d ADN qui contient l information génétique nécessaire pour accomplie une tâche

Plus en détail

Chapitre VI : LE NOYAU

Chapitre VI : LE NOYAU Chapitre VI : LE NOYAU Le noyau est le plus gros organite cellulaire. Il a une forme sphérique ou ovale et entouré par une enveloppe membranaire qui le sépare du cytoplasme. Sa position dans la cellule

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Cloner des séquences d intérêt Le clonage d une séquence But

Plus en détail

LES SEMENCES OGM*: SOLUTION OU INCONVÉNIENT? OGM*: Organisme Génétiquement Modifié

LES SEMENCES OGM*: SOLUTION OU INCONVÉNIENT? OGM*: Organisme Génétiquement Modifié LES SEMENCES OGM*: SOLUTION OU INCONVÉNIENT? OGM*: Organisme Génétiquement Modifié Qu est ce qu un OGM? Un OGM, ou Organisme Génétiquement Modifié est un organisme vivant dont le patrimoine génétique a

Plus en détail

Organismes génétiquement modifiés (OGM): Modification dans une espèce

Organismes génétiquement modifiés (OGM): Modification dans une espèce Transgénique Organismes génétiquement modifiés (OGM): Modification dans une espèce Avant la disponibilité des technologies génétiques modernes, la modification d organismes a pu être accomplie grâce au

Plus en détail

Formation Biologie Moléculaire. Dakar Septembre 2006

Formation Biologie Moléculaire. Dakar Septembre 2006 Formation Biologie Moléculaire Dakar Septembre 2006 La naissance de la biologie moléculaire Les lois de l héréditl dité (Mendel, 1866) La théorie chromosomique de l héréditl dité (Morgan, 1910) Le codage

Plus en détail

BIOLOGIE Sujet d examen - SE1 Durée : 1h30 minutes

BIOLOGIE Sujet d examen - SE1 Durée : 1h30 minutes Date : 29 Septembre 2015 Prépa Scientifique, paramédical -MAESTRIS BIOLOGIE Sujet d examen - SE1 Durée : 1h30 minutes Partie 1 : QCM - Sélectionner la ou les réponses correctes pour chaque question - 13

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

Biologie Cellulaire Cours 1 Jacques ELION. COURS 1 - Introduction: Dimensions du vivant, les éléments de base de la cellule

Biologie Cellulaire Cours 1 Jacques ELION. COURS 1 - Introduction: Dimensions du vivant, les éléments de base de la cellule Biologie Cellulaire Cours 1 Jacques ELION 25/09/07 COURS 1 - Introduction: Dimensions du vivant, les éléments de base de la cellule I. LES ÊTRES DU VIVANT Information génétique Classe 1: Eucaryotes (org.

Plus en détail

MODULE DE GENETIQUE. FACULTE DE MEDECINE UNIVERSITE BADJI MOKHTAR CHARGE DE MODULE: N. Bentahar Afia

MODULE DE GENETIQUE. FACULTE DE MEDECINE UNIVERSITE BADJI MOKHTAR CHARGE DE MODULE: N. Bentahar Afia MODULE DE GENETIQUE FACULTE DE MEDECINE UNIVERSITE BADJI MOKHTAR CHARGE DE MODULE: N. Bentahar Afia 1.PROGRAMME INTRODUCTION A L ETUDE DE LA GENETIQUE Partie I GENETIQUE FORMELLE 1.1. TRANSMISSION D UN

Plus en détail

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène 5 A B C 3 ARNm ARNr ARNt Protéine fonctionnelle Flux de l information génétique

Plus en détail

Fiche d exercices 8 : Patrimoine génétique

Fiche d exercices 8 : Patrimoine génétique Fiche d exercices 8 : Patrimoine génétique Exercice 1 Patrimoine génétique 1/9 2/9 Exercice 3 I-Restitution de connaissances 1- La séquence d un polypeptide a) est déterminée par la séquence des nucléotides

Plus en détail

I- La relation gène / protéine

I- La relation gène / protéine ATTENTION : EN ENCADRE ROUGE = CE QUI EST A SAVOIR ABSOLUMENT Pb. Scientifique général du CHAP. 03 : Comment les gènes déterminent-ils la réalisation des caractères héréditaires? CHAPITRE 3 L EXPRESSION

Plus en détail