Difficulté de la technique

Save this PDF as:

Dimension: px
Commencer à balayer dès la page:

Download "Difficulté de la technique"


1 Difficulté de la technique Le tissu dans 95% des cas, tissu fixé l ADN est de mauvaise qualité (cassé, modifié chimiquement par les fixateurs) artefacts au séquençage. Si un artefact est suspecté, il faut refaire la PCR et le séquençage Problématique technique

2 Au sein du réseau CONTICANET (Connective tissue cancer network) 11 laboratoires participants 50 échantillons analysés Chaque échantillon est analysé par 4 groupes différents Au total, 200 rapports de mutation

3 Au sein du réseau CONTICANET KIT PDGFRA centre Sample 1 c.1676t>g c.1988g>t c.2446g>c 5, 6* Imatinib treatment Sample 36 c.1664a>g c.1955g>c 11 Primary tumor Sample 40 c.1669_1674del 8 Imatinib treatment Sample 35 c.1679_1714del 7 5 out of 8 samples Sample 31 c.1504_1509dup 8 Primary tumor Sample 29 c.1669_1725del 7 Primary tumor Sample 24 c.1678_1680del 1 Imatinib treatment Sample 22 c.1663_1719del 7 primary tumor In italic : the mutation that was not detected * : centre 5 and 6 didn t detect respectively KIT exon 17 and 13 mutation.

4 KIT PDGFRA centre Sample 1 c.1676t>g c.1988g>t c.2446g>c 5, 6* Imatinib treatment Sample 36 c.1664a>g c.1955g>c 11 Primary tumor Sample 40 c.1669_1674del 8 Imatinib treatment Sample 35 c.1679_1714del 7 Sample 31 c.1504_1509dup 8 Primary tumor 5 out of 8 samples Sample 29 c.1669_1725del 7 Primary tumor Sample 24 c.1678_1680del 1 Imatinib treatment Sample 22 c.1663_1719del 7 primary tumor

5 PROBLEMES MAJEURS 8 sur 50 échantillons: la mutation n est pas détectée»16% de résultats faux négatifs Faux negatifs par laboratoire (6/11) 0% à 15% (moyenne=4.5%) Faux positif? (1 cas)

6 Problèmes sans implication thérapeutique Polymorphisme non détecté Absence d amplification de produit de PCR Erreur dans le rapport

7 Mutation rapportée c.1656_1670del p.tyr553_trp557del c.2524_2535del p.asp842_his845del c.1670_1678del p.trp557_val560delinsphe Mutation c.1655_1669del p.met552_trp557delinsarg c.2526_2537del p.ile843_asp846del c.1670_1675del p.trp557_val559delinsphe c.1669_1671del p.trp557del c.1667_1669del p.gln556_trp557delinsarg c.1668_1673del p.trp557_val559del) c.1668_1676del p.gln556_val559delinshis

8 L expérience germanique 6 laboratoires Analyse de KIT EX9, KIT EX10, PDGFRA EX18 Etude de la reproductibilité: 6 laboratoires 10 échantillons extraits de FFPE» 5 échantillons discordants» 3 mutés détectés WT dont 2 cas par le même laboratoire 1 cas mutés KIT ex11 mal retranscrit 1 cas mute PDGFRA ex18 délétion WT, erreur de retranscription, muté ex11, mutation ponctuelle ex18


10 2 ème round 6 laboratoires et 12 échantillons

11 Contrôle qualité UKNEQAS Mise en place en 2011 du contrôle qualité pour la recherche des mutations dans les GIST au catalogue Cas1: Un homme de 48 ans présentant une anémie avec déficience en fer et une tumeur gastrique proximale mesurant 55mm. La tumeur ne montre pas d immuno positivité pour le CD117 ni pour DOG1. L analyse des mutations a été demandée pour confirmer ou non le diagnostic de GIST KIT

12 PDGFRA Conclusion: Absence de détection de mutations en défaveur d un diagnostic de GIST

13 Cas2: Homme de 66 ans presentant une douleur abdominale et une tumeur gastrique distale de 120 mmm. La tumeur est diagnostiquée comme étant un GIST mais son exérèse est incomplète et le traitement par imatinib est envisagé. L analyse des mutations est demandée PDGFRA EX18 p.asp842val Conclusion: Détection d une mutation dans l exon 18 du gène PDGFRA. Cette mutation est résistante à l imatinib.

14 Cas3: Un homme de 67 ans précédemment opéré pour une GIST de l estomac présentent des métastases au foie. Le traitement par imatinib est envisagé et la recherche des mutations a été demandée sur la tumeur primitive KIT exon 11 TAC AGTGGAAGGTTGTTGAGGTATAAATGGAAACAATTATGTTT.CACAACTTCC TAC CACAACT TCCTT Conclusion: détection d une mutation dans l exon 11 de KIT(p.Gln556_Thr574delinsPro) sensibilisante à l imatinib

15 Recommandations Pour qu un laboratoire recherche les mutations de KIT et PDGFRA il faut: un nombre suffisant de cas analysés/an une expérience de l analyse moléculaire à partir de tissus fixés il faut une personne dédiée à cette activité

16 DECOUVERTE DE DISCORDANCES Découverte de quelques cas dicordants wave/séquence Vérification de tous les GIST WT ( 12V/86WT) Quelques cas intéressants : Cas 1 : F11 no wave / del séquence Cas 2: F11 no wave / del homozygote Cas 3 : B9 V wave / no séquence

17 T no Vérif GIST WT X wave F11 54 C T muté profil normal CAS X séquence : mutation homozygote c.1727t>c (p.leu576pro)

18 Vérif GIST WT Y T no T muté Cas Y wave F11 54 C profil normal Cas Y séquence : délétion hétérozygote c dup (p.val560dup)

19 CAS 1 (muté en exon11) 06/04/09 : PCR wave normal (ADN dilué 1/10) 08/04/09 : PCR séquence = délétion homozygote (ADN 1/10) 11/05/09 : PCR séquence = normal (ADN 1/10) Test à plusieurs dilutions d ADN : 20/05/09 : PCR séquence ADN 1/10 : ni ADN 1/100 : ni ADN 1/200 : del hétérozygote 27/05/09 : PCR séquence ADN 1/10 : séquence normal ADN 1/100 : ni Test en gamme de dilutions ADN Comparaison avec 2 techniques d extraction d ADN (kit Wizard et kit FFPE)

20 CAS 1 (c.1669_1672delinsg) PCR du 18/06/09 ADN extrait avec le kit wizard : dilutions successives - ADN 1/5 = del hétérozygote (allèle muté minoritaire) 1/5 - ADN 1/10 = del hétérozygote (allèle muté majoritaire) - ADN 1/20 = normal - ADN 1/50 = normal - ADN 1/100 = ni - ADN 1/200 = normal 1/20 1/10 ADN extrait avec le kit FFPE : dilutions successives FFPE 1/5 -ADN 1/5 = del hétérozygote (50/50) - ADN 1/10 = del hétérozygote (allèle muté minoritaire) -ADN 1/20 = del hétérozygote FFPE 1/10 - ADN 1/50 = del hétérozygote - ADN 1/100 = del homozygote - ADN 1/200 = ni FFPE 1/100 FFPE 1/20

21 T No Cas 2 CAS 2 (muté exon 11) T muté wave F11 54 C = profil normal (ADN 1/100) séquence = del hétérozygote c.1657_1674del (ADN 1/5)

22 CAS 2 (c.1657_1674del) PCR du 31/08/09 : dilutions successives ADN 1/5 T No ADN 1/5 ADN 1/10 ADN 1/10 ADN 1/100 T muté ADN 1/100 (séquençage des PCR wave, ADN 1/50 ni)

23 T No CAS 3 (muté exon 9, série 108) T muté Cas 3 wave B9 54.0c = profil variant (PCR du 18/08/09, ADN 1/10) séquence = normal (PCR du 24/08/09, ADN 1/10)

24 CAS 3 (c.1504_1509dup) PCR du 31/08/09 : dilutions successives ADN 1/5 ADN 1/5, 1/10, 1/100 : dup homozygote ADN 1/10 ADN 1/50 ADN 1/100 ADN 1/50 : dup hétérozygote (allèle muté majoritaire) PCR du 18/10/09 : test autre couple d amorces B9+/B9- -ADN ½ : dup homozygote - ADN 1/5 : dup homozygote - ADN 1/10 : dup hétérozygote (allèle V majoritaire) - ADN 1/50 : normal - ADN 1/100 : dup homozygote - ADN 1/200 : ni C9+/9R -ADN ½ : dup homozygote - ADN 1/5 : dup homozygote - ADN 1/10 : dup hétérozygote (allèle V majoritaire) - ADN 1/50 : dup hétérozygote (allèle V majoritaire) - ADN 1/100 : dup homozygote - ADN 1/200 : dup hétérozygote (50/50)

25 CAS 3 (c.1504_1509dup) PCR du 31/08/09 : dilutions successives ADN 1/5 ADN 1/5, 1/10, 1/100 : dup homozygote ADN 1/10 ADN 1/50 ADN 1/100 ADN 1/50 : dup hétérozygote (allèle muté majoritaire) PCR du 18/10/09 : test autre couple d amorces B9+/B9- -ADN ½ : dup homozygote - ADN 1/5 : dup homozygote - ADN 1/10 : dup hétérozygote (allèle V majoritaire) - ADN 1/50 : normal - ADN 1/100 : dup homozygote - ADN 1/200 : ni C9+/9R -ADN ½ : dup homozygote - ADN 1/5 : dup homozygote - ADN 1/10 : dup hétérozygote (allèle V majoritaire) - ADN 1/50 : dup hétérozygote (allèle V majoritaire) - ADN 1/100 : dup homozygote - ADN 1/200 : dup hétérozygote (50/50)

26 Vérification de toutes les délétions homozygotes et de tous les GIST WT pour l exon 11 - Pour chaque ADN : dilutions successives = 1/5, 1/10, 1/50, 1/100, 1/200, 1/500 - Toutes les dilutions sont passées sur wave (hétéroduplex non mélangés avec du normal) - Pour les cas bizarres : séquençage des PCR passées sur wave aucun GIST WT retrouvé muté 22 patients del homozygote testés (28ADN) Exemple de cas «normal» Exemple de cas «bizarre»

27 CAS 4 (c.1673_1675del) 1/5 1/10 1/50 1/100 1/200 1/500 Del homozygote Del hétérozygote Del3 ADN 1/5 à ADN 1/100 ADN 1/200 à ADN 1/500

28 CAS 5 (c.1670_1675del) ADN 1/10 et ADN 1/50 : del homozygote Del6 1/10 1/50 1/100 ADN 1/100 : del hétérozygote

29 CAS 6 (c.1671_1676del) 1/200 1/500 Del6 ADN 1/5 à 1/200 = del homozygote ADN 1/500 = del hétérozygote

30 CAS 7 (c.1669_1683del) Del hétérozygote A revoir

31 CAS ASSURANCE QUALITE CONTICANET ADN 38 1/5 = séquence normale ADN 38 1/2 = del24 homozygote Del24 Autre cas : ADN5 - ADN5 1/10 = del21 homozygote - ADN5 1/100 = séquence normale ADN testé à Lyon : PCR faite plusieurs fois et del non retrouvée à chaque fois ADN envoyé à Leuven (centre de référence des mutations GIST) : séquence normale

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin L anatomopathologiste : un lien entre les différents intervenants Françoise Collin Les grands classiques Microbiopsie Biopsie chirurgicale Pièce opératoire Diagnostic AP classification OMS 2002 > 50 types

Plus en détail

Pourquoi la relecture peut-elle changer une prise en charge? Dr Nathalie Stock, PH Service d Anatomie et Cytologie pathologique CHU de Rennes

Pourquoi la relecture peut-elle changer une prise en charge? Dr Nathalie Stock, PH Service d Anatomie et Cytologie pathologique CHU de Rennes Pourquoi la relecture peut-elle changer une prise en charge? Dr Nathalie Stock, PH Service d Anatomie et Cytologie pathologique CHU de Rennes Sarcomes Ubiquitaires: touche les tissus mous, les viscères,

Plus en détail



Plus en détail

Plateformes hospitalières de génétique moléculaire des cancers

Plateformes hospitalières de génétique moléculaire des cancers Plateformes hospitalières de génétique moléculaire des cancers Biomarqueurs et cancers o Identification d altérations génétiques au sein des cellules cancéreuses => nouveaux biomarqueurs moléculaires diagnostic

Plus en détail

Pathologie moléculaire (2)

Pathologie moléculaire (2) Pathologie moléculaire (2) DES d anatomie pathologique Jean-François Emile, Service de pathologie & EA4340 Hôp. Ambroise Paré, APHP & Université de Versailles SQY Analyse de l ADN tumoral Circuit d un

Plus en détail

Autres tumeurs de la paroi digestive. Polype fibroïde inflammatoire Leiomyome Leiomyosarcome Schwannome Tumeur maligne des gaines nerveuses

Autres tumeurs de la paroi digestive. Polype fibroïde inflammatoire Leiomyome Leiomyosarcome Schwannome Tumeur maligne des gaines nerveuses Autres tumeurs de la paroi digestive Polype fibroïde inflammatoire Leiomyome Leiomyosarcome Schwannome Tumeur maligne des gaines nerveuses Leiomyome du tube digestif Beaucoup plus rare que les GIST Localisations

Plus en détail

Testing moléculaire RER/MSI

Testing moléculaire RER/MSI Atelier Instabilité Microsatellitaire 26 avril 2014, Bordeaux Testing moléculaire RER/MSI Isabelle Soubeyran Unité de Pathologie Moléculaire Institut Bergonié Bordeaux PGMC d Aquitaine Système RER = système

Plus en détail



Plus en détail

L échinococcose alvéolaire en France de 1982 à 2005

L échinococcose alvéolaire en France de 1982 à 2005 L échinococcose alvéolaire en France de 1982 à 2005 M Piarroux (1), R Piarroux (1), J Knapp (1), I Capek (2), S Bresson-Hadni (1) et le réseau FrancEchino. (1) FrancEchino, CHU de Besançon (2) InVS Echinococcose

Plus en détail

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise!

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise! Diagnostic moléculaire des tumeurs solides, l'expérience Rennaise Bioinformaticien, Biologiste moléculaire, Biostatisticien, Biologiste B. Ndiaye, M. de Tayrac, J. & A. Mosser Le#séquençage#à#haut#débit#NGS#dans#le#cadre#du#diagnos9c##

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Importance du développement des biomarqueurs par un industriel

Importance du développement des biomarqueurs par un industriel Importance du développement des biomarqueurs par un industriel Dr Frédéric Eberlé, responsable médical Roche Diagnostics France Marseille, 27 mars 2015 Terminologie Biomarqueurs, Tests de diagnostic, Tests-compagnons

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Les biobanques pour les débutants

Les biobanques pour les débutants Les biobanques pour les débutants C Dubourg B Turlin 14 octobre 2010 CHU de Rennes Définition Collection d échantillons biologiques humains Réunion, à des fins scientifiques, de prélèvements biologiques

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

L inhibition de l EGFR dans les CBNPC. Une thérapeutique personnalisée en pleine mutation

L inhibition de l EGFR dans les CBNPC. Une thérapeutique personnalisée en pleine mutation L inhibition de l EGFR dans les CBNPC Une thérapeutique personnalisée en pleine mutation La cellule cancéreuse Hanahan D Cell 2000 Hanahan D, Cell 2000 ADN ARN Protéine III PDGF-R I EGF-R IV FGF- R II

Plus en détail

Génotypage et profil de résistance aux IP des virus de l hépatite C par séquençage dans la région NS3 à partir d une seule RT-PCR

Génotypage et profil de résistance aux IP des virus de l hépatite C par séquençage dans la région NS3 à partir d une seule RT-PCR Génotypage et profil de résistance aux IP des virus de l hépatite C par séquençage dans la région NS3 à partir d une seule RT-PCR B Besse 1, M Coste-Burel 1, S Vallet 3, C Feray 2, E André-Garnier 1 Laboratoire

Plus en détail

Mutation KRAS et BRAF dans le cancer métastatique du colon Aspects pratiques et STIC MOKAECM

Mutation KRAS et BRAF dans le cancer métastatique du colon Aspects pratiques et STIC MOKAECM DIU de Pathologie Moléculaire Module 3, Pathologie moléculaire appliquée Bordeaux, 3 février 2011 Mutation KRAS et BRAF dans le cancer métastatique du colon Aspects pratiques et STIC MOKAECM Plateforme

Plus en détail

Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux. Activité FISH/CGH et présentation de cas

Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux. Activité FISH/CGH et présentation de cas Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux Activité FISH/CGH et présentation de cas Gaëlle Pérot Institut Bergonié Département de Biopathologie Bordeaux Département

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail


LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

Centre Jean Perrin. Centre de Lutte contre le Cancer d'auvergne. Clermont-Ferrand - France - Projet PROGACIR

Centre Jean Perrin. Centre de Lutte contre le Cancer d'auvergne. Clermont-Ferrand - France - Projet PROGACIR Centre Jean Perrin Centre de Lutte contre le Cancer d'auvergne Clermont-Ferrand - France - Projet PROGACIR Positionnement Intérêt du séquençage de l ADN tumoral circulant du gène TP53 muté pour la prédiction

Plus en détail

TD 5 : Génétique humaine

TD 5 : Génétique humaine TD 5 : Génétique humaine Exercice 1 (pour se mettre en forme...). Une femme de vision normale dont le père est daltonien (maladie héréditaire récessive, caractérisée par un défaut de vision des couleurs,

Plus en détail

Modèles animaux de cancérogenèse

Modèles animaux de cancérogenèse INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE isabelle.dhennin@u-picardie.fr Modèles animaux de cancérogenèse I- Généralités sur le cancer 1- Données épidémiologiques Hommes Femmes

Plus en détail

Rédacteurs : R. Guimbaud et J. Selves


Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Les modèles précliniques in vivo sont ils à la. hauteur de ce qu en attendent les cliniciens? ONCOTRANS Nancy. Mars 2009. P.

Les modèles précliniques in vivo sont ils à la. hauteur de ce qu en attendent les cliniciens? ONCOTRANS Nancy. Mars 2009. P. Les modèles précliniques in vivo sont ils à la hauteur de ce qu en attendent les cliniciens? ONCOTRANS Nancy Mars 2009 P. Chastagner - Oncologie pédiatrique, CHU Nancy - EA 4001, faculté de Médecine, Nancy

Plus en détail

Cytogénétique et biologie moléculaire

Cytogénétique et biologie moléculaire Cytogénétique et biologie moléculaire apport au diagnostic, à l évaluation pronostique et au suivi des hémopaties malignes C Bastard, DESC, 21 septembre 2009 Pourquoi est-ce possible? Parce que les anomalies

Plus en détail

L'apport de l'étude des génomes : les innovations génétiques.

L'apport de l'étude des génomes : les innovations génétiques. Introduction : L'apport de l'étude des génomes : les innovations génétiques. Au sein du vivant, les espèces se différencient les unes des autres par l existence de gènes différents. Au sein d une espèce,

Plus en détail

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx 1 / 35 2 / 35 Contexte 3 / 35 Risque cumulé de cancer à 70 ans Cancer du sein

Plus en détail

Session orale Nouvelles cibles kinases : résultats préliminaires de l essai «AcSé Crizotinib»

Session orale Nouvelles cibles kinases : résultats préliminaires de l essai «AcSé Crizotinib» Session orale Nouvelles cibles kinases : résultats préliminaires de l essai «AcSé Crizotinib» D après la communication orale de Denis Moro-Sibilot, abstract 1200, WCLC 2015 Clément Korenbaum, interne,centre

Plus en détail

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 «Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 COUTTON Charles Etude du Génome Cytogénétique Cytogénétique moléculaire Biologie moléculaire

Plus en détail

Surveillance. Éléments de la surveillance. Principe : alternance. Examen d imagerie. Examen clinique. Le suivi post thérapeutique en ville

Surveillance. Éléments de la surveillance. Principe : alternance. Examen d imagerie. Examen clinique. Le suivi post thérapeutique en ville Le suivi post thérapeutique en ville Surveillance Docteur Elisabeth LUPORSI Centre Alexis Vautrin-CHU 25 mai 2012 Strasbourg CNGOF Quelle indications? Quel rythme? Que surveiller? Quand changer l hormonothérapie?

Plus en détail

Docteur T. RAHME, Gastro-Entérologue, Proctologue. VILLE LE RAINCY, SALON DE LA SANTE du 03 10 2015. Prévention des cancers digestifs

Docteur T. RAHME, Gastro-Entérologue, Proctologue. VILLE LE RAINCY, SALON DE LA SANTE du 03 10 2015. Prévention des cancers digestifs Docteur T. RAHME, Gastro-Entérologue, Proctologue 1, avenue de la résistance 93340 LE RAINCY Tél. 01 43 81 75 31 VILLE LE RAINCY, SALON DE LA SANTE du 03 10 2015 Prévention des cancers digestifs Le cancer

Plus en détail

Interprétation des résultats

Interprétation des résultats Plateforme de séquençage Cochin Interprétation des résultats Grace à la base de données vous avez un accès direct à vos séquences. Pour valider la qualité de ces séquences vous devez visualiser leur chromatogramme.

Plus en détail

Nouvelles mutations RAS

Nouvelles mutations RAS Nouvelles mutations RAS dans les cancers colo-rectaux Rappel RAS : interrupteur de plusieurs voies de signalisation ras MUTATION RAS /ras activé en permanence : signalisation continue de la prolifération

Plus en détail

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Thèse de médecine SEVY Amandine, JNIN décembre 2014 I. Myopathies distales Définition

Plus en détail

Intérêt du test RER Applications cliniques et thérapeutiques

Intérêt du test RER Applications cliniques et thérapeutiques Intérêt du test RER Applications cliniques et thérapeutiques Atelier MMR / RER 26/04/2014 Dr Virginie Bubien Dr Emmanuelle Barouk-Simonet Unité d oncogénétique - Département de Biopathologie - Institut

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire

AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire I- Récapitulatif des tests moléculaires à effectuer Type de cancer Transloc. ALK Amp. ALK Amp. MET Transloc. ROS Mut. ALK Mut. MET Mut.

Plus en détail

Étude des mutations PIK3CA

Étude des mutations PIK3CA Étude des mutations PIK3CA Application dans les cancers du sein et les cancers colorectaux métastatiques Alexandre Harlé a.harle@nancy.unicancer.fr Centre Alexis Vautrin Unité de Biologie des tumeurs Département

Plus en détail



Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

La Génétique pour les Nuls

La Génétique pour les Nuls La Génétique pour les Nuls Marie Pierre AUDREZET Laboratoire de Génétique Moléculaire INSERM U1078 - CHRU BREST La Génétique pour les nuls Mutations Référence : Base de données HGMD Différents types de

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail


LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail


DEPARTEMENT DE BIOLOGIE CLINIQUE, D ANATOMIE PATHOLOGIQUE ET DE GENETIQUE MEDICALE Tableau des consignes de prélèvement I. LABORATOIRE DE BIOLOGIE MOLECULAIRE 1.1. Secteur Hématologie Code analyses Descriptif Indications principales IG.ADN TG.ADN TD.ADN TB.ADN Recherche réarrangement des gènes des immunoglobulines Recherche

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

AcSé crizotinib: Modalités pratiques pour le criblage moléculaire

AcSé crizotinib: Modalités pratiques pour le criblage moléculaire AcSé crizotinib: Modalités pratiques pour le criblage moléculaire I- Récapitulatif des tests moléculaires à effectuer Type de cancer Transloc. ALK Amp. ALK Amp. MET Transloc. ROS Mut. ALK Mut. MET Cancer

Plus en détail

La recherche BRAF : intérêts et limites en 2013

La recherche BRAF : intérêts et limites en 2013 La recherche BRAF : intérêts et limites en 2013 Réunion GFPC Paris, décembre 2013 Pr D Damotte Pathologie Hôpitaux universitaires paris centre BRAF: voie MEK / ERK AMM mélanome en 2011 La recherche BRAF

Plus en détail

LES DIFFÉRENTS ASPECTS DE LA CANCÉROLOGIE. Formation destinée aux Aides Soignantes 19 mars 2015 Nicole MOREL Réseau ONCOLIE

LES DIFFÉRENTS ASPECTS DE LA CANCÉROLOGIE. Formation destinée aux Aides Soignantes 19 mars 2015 Nicole MOREL Réseau ONCOLIE LES DIFFÉRENTS ASPECTS DE LA CANCÉROLOGIE Formation destinée aux Aides Soignantes 19 mars 2015 Nicole MOREL Réseau ONCOLIE PLAN 1. Cancérogénèse/Définition 2. Les causes connues 3. Epidémiologie 4. Prévention

Plus en détail

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI Mlle ImaneSmaili SVI4 Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI PLAN 1. Introduction 2.Définition 3. Principe 4.Les applications de la PCR Introduction La PCR «Polymerase

Plus en détail

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Haouari M., Ferchichi A. in Ferchichi A. (comp.), Ferchichi A. (collab.). Réhabilitation des pâturages et des

Plus en détail

Dépistage du Cancer Colorectal. Dr M Si Hocine-Département de Médecine Interne Hôpital St Camille-Bry Sur Marne)

Dépistage du Cancer Colorectal. Dr M Si Hocine-Département de Médecine Interne Hôpital St Camille-Bry Sur Marne) Dépistage du Cancer Colorectal Dr M Si Hocine-Département de Médecine Interne Hôpital St Camille-Bry Sur Marne) Epidémio des Kc Colorectaux 35000 nouveaux cas par an, mais mortalité stable. 10 à30 % de

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail


Dr Véronique Haddad SERVICE DE BIOLOGIE DES TUMEURS CHU de BORDEAUX Dr Véronique Haddad SERVICE DE BIOLOGIE DES TUMEURS CHU de BORDEAUX Cancer = tumeur maligne formée à partir d'une cellule initialement normale qui se transforme grâce à une accumulation d événements moléculaires

Plus en détail


TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité Développement de Techniques et Analyse Moléculaire de la Biodiversité HyDRIMZ DENITEXPRESS a Influence de faibles concentrations en nanoparticules de CuO sur l expression des gènes de la dénitrification

Plus en détail

Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011

Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011 Mesure 21 SOINS ET VIE DES MALADES Les tests de génétique moléculaire pour l accès aux thérapies ciblées en France en 2011 COLLECTION Rapports & synthèses POUR UN ACCÈS AUX THÉRAPIES CIBLÉES : - LES PLATEFORMES

Plus en détail

ATELIER 3 : GENECAN Prise en charge des tests moléculaires sur la plateforme GENECAN

ATELIER 3 : GENECAN Prise en charge des tests moléculaires sur la plateforme GENECAN ATELIER 3 : GENECAN Prise en charge des tests moléculaires sur la plateforme GENECAN J. Bonneau (plateforme d extraction) N. Richard (Service de génétique CHU) D. Vaur (Laboratoire de biologie et de génétique

Plus en détail


PRESENTATION DU PROGRAMME «ACSE MOLECULAIRE» Avril 2013 PRESENTATION DU PROGRAMME «ACSE MOLECULAIRE» Face au développement des nouveau médicaments et du diagnostic moléculaire, l INCa lance un programme pour faciliter l accès à l innovation dans

Plus en détail

Brochure d information

Brochure d information Brochure d information La Néoplasie Endocrinienne Multiple de type 1 1 Question 1 : qu est-ce que la néoplasie endocrinienne multiple de type 1? Pour répondre à cette question, il faut d abord connaître

Plus en détail

Brettanomyces : biodiversité et conséquences.

Brettanomyces : biodiversité et conséquences. Brettanomyces : biodiversité et conséquences. Béatrice VINCENT (1), Morvan COARER (2), Aurélie PAIN (2) (1) Institut Français de la Vigne et du Vin 21200 Beaune (2) Institut Français de la Vigne et du

Plus en détail

Validation de méthodes pour la recherche de mutations en génétique somatique

Validation de méthodes pour la recherche de mutations en génétique somatique SEPTEMBRE 2014 Validation de méthodes pour la recherche de mutations en génétique somatique DOCUMENT DESTINÉ AUX LABORATOIRES DE BIOLOGIE MOLÉCULAIRE POUR ACCOMPAGNER LA DÉMARCHE DE VALIDATION DES TECHNIQUES

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail


LE DÉPISTAGE DU CANCER COLORECTAL. Dre S. Lefebvre CHVO- Gatineau LE DÉPISTAGE DU CANCER COLORECTAL Dre S. Lefebvre CHVO- Gatineau Dépistage du cancer colorectal (CCR) Reconnaître l importance du dépistage du CCR. Comprendre la progression des lésions pré-néoplasiques

Plus en détail

Pratique de l immunohistochimie Applications diagnostiques Tumeurs des tissus mous. JM Coindre - Bordeaux

Pratique de l immunohistochimie Applications diagnostiques Tumeurs des tissus mous. JM Coindre - Bordeaux Pratique de l immunohistochimie Applications diagnostiques Tumeurs des tissus mous JM Coindre - Bordeaux 1 Tumeurs des tissus mous Rappels Tumeurs rares (2% des prélèvements) Tumeurs variées (150 types

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

Paradigme Th1/Treg dans l athérosclérose des patients transplantés rénaux

Paradigme Th1/Treg dans l athérosclérose des patients transplantés rénaux Paradigme Th1/Treg dans l athérosclérose des patients transplantés rénaux Bamoulid J, Courivaud C, Deschamps M, Ferrand Ch, Chalopin JM, Tiberghien P, Saas Ph, Ducloux D Néphrologie CHU Besançon INSERM

Plus en détail

«Besoins de l anatomopathologiste en cas de biopsie d une tumeur osseuse ou des parties molles cytogénétique»

«Besoins de l anatomopathologiste en cas de biopsie d une tumeur osseuse ou des parties molles cytogénétique» «Besoins de l anatomopathologiste en cas de biopsie d une tumeur osseuse ou des parties molles cytogénétique» A- Biopsie chirurgicale pour le diagnostic des tumeurs osseuses (1) Le volume, généralement

Plus en détail

6 0 390 3 3 9< 3 =3 290 < 3 6>45 467 7(83 7,3 9 %&?!%?7,39 3 @33 793>939.39 93939 A3.33 3 0 9 3> 3

6 0 390 3 3 9< 3 =3 290 < 3 6>45 467 7(83 7,3 9 %&?!%?7,39 3 @33 793>939.39 93939 A3.33 3 0 9 3> 3 !"#$ $%&'( )* +,-+./0)* +,-1$02!/3 ($ $%&'( 45 467 7(8 5 329. )* +,- 0)* 9 0 +9)* +,-: ( ; 6 0 390 3 3 9< 3 =3 290 < 3 6>45 467 7(83 7,3 9 %&?!%?7,39 3 @33 793>939.39 6)* 999.63 93939 A3.33 3 0 9 3> 3

Plus en détail

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Si les conditions physiques telles que l âge, les antécédents, mais aussi des facteurs sociaux, psychiques et culturels influencent

Plus en détail

3.3. La dégénérescence cortico basale (DCB).19

3.3. La dégénérescence cortico basale (DCB).19 Table des matières I. Introduction 8 1.Aspects cliniques de la maladie d Alzheimer 9 1.1. Diagnostic clinique..9 1.2. Aspects épidémiologiques 9 1.3. Aspects génétiques..9 2. Lésions neuropathologiques

Plus en détail

Centre National de Référence de la Syphilis www.cnr-syphilis.fr

Centre National de Référence de la Syphilis www.cnr-syphilis.fr Centre National de Référence de la Syphilis www.cnr-syphilis.fr CNR Syphilis Service de Dermatologie Vénéréologie Hôpital Cochin Pavillon Gustave Roussy, Laboratoire de Dermatologie Etage 4, porte 405-8,

Plus en détail

Les Tumeurs Stromales Gastro-Intestinales du chien

Les Tumeurs Stromales Gastro-Intestinales du chien Les Tumeurs Stromales Gastro-Intestinales du chien ANNE GIRARD-LUC (1), EDOUARD REYES-GOMES (1), JEAN-JACQUES FONTAINE (1), MARIE LAGADIC (2) ET FLORENCE BERNEX (1,3) (1) SERVICE D EMBRYOLOGIE D HISTOLOGIE

Plus en détail

Plateforme hospitalière de génétique moléculaire des. Pr Eric Delabesse Laboratoire d Hématologie CHU Purpan delabesse.e@chu-toulouse.

Plateforme hospitalière de génétique moléculaire des. Pr Eric Delabesse Laboratoire d Hématologie CHU Purpan delabesse.e@chu-toulouse. Plateforme hospitalière de génétique moléculaire des cancers de Midi-Pyrénées Pr Eric Delabesse Laboratoire d Hématologie CHU Purpan delabesse.e@chu-toulouse.fr Plateformes de diagnostic moléculaire des

Plus en détail

Faculté des sciences de Tunis Laboratoire de génétique, immunologie et pathologie humaine Institut Salah Azaiez Le Cancer Du Sein Héréditaire En Tunisie Génétique & Éthique TROUDI Wafa C est Quoi Le Cancer?

Plus en détail

Comment gérer au mieux ma charge de travail en biologie moléculaire?

Comment gérer au mieux ma charge de travail en biologie moléculaire? Comment gérer au mieux ma charge de travail en biologie moléculaire? Une souplesse d emploi inégalée dans les tests de biologie moléculaire, répondant aux exigences de votre laboratoire Le système VERSANT

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail



Plus en détail

! " # $ % & ' $ () * +,-./ -! 01 '* +,-./ 2 ' 3 $ 1 4 ) $ ()

!  # $ % & ' $ () * +,-./ -! 01 '* +,-./ 2 ' 3 $ 1 4 ) $ () ! " #$%& ' $() *+,-./-!01'*+,-./2'3$14 ) $() 5 61()78 8)9 5 43:0 *+,-./ " '*+,!: " ' " -:*+,-./; " ) < 7! '! 4:' 4 4! := 4!! >4! 3:'! =! 4!! 7?5 61()78 8)94!! 8.4 : @A$A8.4:! 4 B44 8:4?:4:04: 7* +,!:::074

Plus en détail

IRM Mammaire Quelles indications en 2014? Dr Marie Hélène CARACO

IRM Mammaire Quelles indications en 2014? Dr Marie Hélène CARACO IRM Mammaire Quelles indications en 2014? Dr Marie Hélène CARACO 1 Introduction a IRM : imagerie de l angiogénèse tumorale améliore la sensibilité de détection (> 90 %) par contre faible spécificité (70

Plus en détail

Qu est-ce qu une tumeur stromale gastro-intestinale?

Qu est-ce qu une tumeur stromale gastro-intestinale? Qu est-ce qu une tumeur stromale gastro-intestinale? La tumeur stromale gastro-intestinale est une forme rare de cancer qui se développe dans le tube digestif (ou tractus gastro-intestinal). On l appelle

Plus en détail

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain 1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain Le séquençage du génome humain et après? Comment a-t-il été séquencé? Que nous apprend la séquence? Et après?

Plus en détail

Le gène ABCB4 / MDR3 : de l ADN au phénotype

Le gène ABCB4 / MDR3 : de l ADN au phénotype Le gène ABCB4 / MDR3 : de l ADN au phénotype Dr Véronique Barbu Dr Michèle Maurice Pr Chantal Housset LCBGM & CRMIVB, AP-HP, HUEP UPMC & INSERM, CdR Saint-Antoine, Paris Réseau national «Hereditary Cholestasis

Plus en détail

Domaine général de formation : Environnement et consommation Axe de développement : Utilisation responsable de biens et de services

Domaine général de formation : Environnement et consommation Axe de développement : Utilisation responsable de biens et de services LIENS AVEC LE PROGRAMME DE FORMATION DE L ÉCOLE QUÉBÉCOISE AGROALIMENTAIRE LA TRANSFORMATION DU LAIT EN FROMAGE Domaine général de : Environnement et consommation Axe de développement : Utilisation responsable

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes.

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Epigénétique Introduction «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Deux périodes successives récentes dans l étude des génomes

Plus en détail

6 ème Rencontre Régionale d actualités SÉNOLOGIQUE

6 ème Rencontre Régionale d actualités SÉNOLOGIQUE 6 ème Rencontre Régionale d actualités SÉNOLOGIQUE Niort, le 20 mars 2014 8 ème Rencontre Régionale d actualités SÉNOLOGIQUE Actualités en ANATOMOPATHOLOGIE Audelaure JUNCA (Poitiers) Actualités en ANATOMOPATHOLOGIE

Plus en détail

La génétique en cancérologie: une démarche progressive

La génétique en cancérologie: une démarche progressive La génétique en cancérologie: une démarche progressive UCP: A partir d observations cliniques et/ou biologiques (âge, ATCDs) émettre une hypothèse diagnostique poser l indication d une consultation d oncogénétique

Plus en détail

Utilisation des cultures cellulaires pour évaluer la cytotoxicité et l activité antitumorale de molécules ou d extraits

Utilisation des cultures cellulaires pour évaluer la cytotoxicité et l activité antitumorale de molécules ou d extraits Utilisation des cultures cellulaires pour évaluer la cytotoxicité et l activité antitumorale de molécules ou d extraits 08 Juillet 2011 Ingrid Fruitier-Arnaudin ifruitie@univ-lr.fr Par des tests de biologie

Plus en détail

L hyperméthylation des gènes suppresseurs de tumeur comme marqueur en cancérologie

L hyperméthylation des gènes suppresseurs de tumeur comme marqueur en cancérologie L hyperméthylation des gènes suppresseurs de tumeur comme marqueur en cancérologie Florence de Fraipont UF Cancérologie Biologique et Biothérapie, pôle de Biologie, CHU Grenoble Définitions Méthodes d

Plus en détail

GenoLyse VER 1.0. Notice d'utilisation IFU-51610-09. pour usage diagnostique in vitro uniquement

GenoLyse VER 1.0. Notice d'utilisation IFU-51610-09. pour usage diagnostique in vitro uniquement GenoLyse VER 1.0 Notice d'utilisation IFU-51610-09 pour usage diagnostique in vitro uniquement 10/2012 GenoLyse Kit d Extraction d ADN Bactérien Veuillez lire attentivement la notice d utilisation dans

Plus en détail