This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and"

Transcription

1 This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier s archiving and manuscript policies are encouraged to visit:

2 Pathologie Biologie 58 (2010) Évaluation de la plate-forme de PCR en temps réel LightCycler pour la mesure des charges virales CMV, EBV, HHV-6 et BKV dans le sang total Evaluation of the LightCycler real-time PCR system for the measurement of CMV, EBV, HHV-6 and BKV viral loads in whole blood D. Boutolleau a,b, *, C. Deback a,b,j.géli a,b,z.aït-arkoub b, F. Angleraud b, A. Gautheret-Dejean a,b,c, H. Agut a,b a UPMC, université Paris VI, ER1 DETIV, Paris, France b Service de virologie, groupe hospitalier Pitié-Salpêtrière, AP HP, bâtiment CERVI, 83, boulevard de l Hôpital, Paris, France c UPRES EA 4065, laboratoire de microbiologie, faculté des sciences pharmaceutiques et biologiques, université Paris Descartes, Paris, France INFO ARTICLE RÉSUMÉ Historique de l article : Reçu le 9 juin 2009 Accepté le 26 juin 2009 Disponible sur Internet le 4 novembre 2009 Mots clés : LightCycler Diagnostic virologique moléculaire Charge virale Sang total Infections virales opportunistes Keywords: LightCycler system Viral molecular diagnosis Viral load Whole blood specimen Opportunistic viral infections Objectif. La plate-forme de PCR en temps réel LightCycler (LC480) a été évaluée pour le diagnostic moléculaire quantitatif des infections virales opportunistes dues au cytomégalovirus humain (CMV), au virus Epstein-Barr (EBV), au sixième herpèsvirus humain (HHV-6) et au virus BK (BKV), en comparaison avec des techniques de PCR en temps réel de référence (techniques «maison»). Patients et méthodes. Un total de 253 prélèvements de sang total provenant de patients greffés a été testé. Résultats. Les méthodes de référence et LC480 étaient très bien corrélées (coefficient de corrélation de Spearman Rho 0,85 ; p < 0,0001) avec une excellente concordance d un point de vue qualitatif (90,5 %) et sans différence significative d un point de vue quantitatif pour l ensemble des quatre virus testés. L exactitude des protocoles sur le LC480 a été confirmée par les résultats obtenus avec les 44 échantillons du contrôle de qualité pour le diagnostic moléculaire 2008 (Quality Control for Molecular Diagnosis [QCMD]). Conclusion. Le système LC480 est un automate de PCR en temps réel parfaitement adapté à l activité hospitalière d un laboratoire de virologie pour le diagnostic et le suivi des infections virales opportunistes chez les patients greffés par la mesure des charges virales CMV, EBV, HHV-6 et BKV dans les prélèvements de sang total. ß 2009 Elsevier Masson SAS. Tous droits réservés. ABSTRACT Objective. The Roche LightCycler (LC480) system was evaluated for quantitative molecular diagnosis of opportunistic viral infections caused by human cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), and BK virus (BKV), in comparison with in-house real-time PCR assays. Patients and methods. A total of 253 whole blood specimens obtained from transplant recipients were tested. Results. Both the in-house and the LC480 methods were highly correlated (Spearman correlation coefficient Rho 0.85; p < ) with an excellent overall qualitative agreement (90.5 %) and no significant quantitative difference between both techniques for the four viruses tested. The accuracy of the LC480 protocols were confirmed further by the results obtained with the 44 samples from the Quality Control for Molecular Diagnosis (QCMD) 2008 proficiency panel. Conclusion. The LC480 system constitutes a suitable and versatile real-time PCR platform in a routine laboratory setting for the diagnosis and monitoring of opportunistic viral infections in transplant recipients, by measuring HCMV, EBV, HHV-6, and BKV loads in whole blood samples. ß 2009 Elsevier Masson SAS. All rights reserved. * Auteur correspondant. Adresse (D. Boutolleau) /$ see front matter ß 2009 Elsevier Masson SAS. Tous droits réservés. doi: /j.patbio

3 D. Boutolleau et al. / Pathologie Biologie 58 (2010) Tableau 1 Amorces et sondes d hydrolyse utilisées pour les techniques de PCR en temps réel sur l automate LC480. Virus Gène cible Nature Séquence (5 3 ) Référence CMV US8 Amorce sens ACCAACATAAGGACTTTTCACACTTTT Deback et al. [4] Amorce antisens GAATACAGACACTTAGAGCTCGGGGT FAM-CTGGCCAGCACGTATCCCAACAGCA-TAMRA EBV BXLF1 Amorce sens GGGGCAAAATACTGTGTTAG Brengel-Pesce et al. [7] Amorce antisens CGGGGGACACCATAGT FAM-CGGCGCATGTTCTCCTCCAC-TAMRA HHV-6 U65-U66 Amorce sens GACAATCACATGCCTGGATAATG Gautheret-Dejean et al. [5] Amorce antisens TGTAAGCGTGTGGTAATGGACTAA FAM-AGCAGCTGGCGAAAAGTGCTGTGC-TAMRA BKV LT-ag Amorce sens AAGTCTTTAGGGTCTTCTAC Si-Mohamed et al. [6] Amorce antisens GAGTCCTGGTGGAGTTCC FAM-AGAATCTGCTGTTGCTTCTTCATCACTGGC-TAMRA 1. Introduction Le cytomégalovirus humain (CMV), le virus Epstein-Barr (EBV), le sixième herpèsvirus humain (HHV-6) et le virus BK (BKV) sont des virus largement répandus dans la population générale et constituent une cause majeure de morbidité et de mortalité chez les patients recevant une greffe d organe solide ou de cellules souches hématopoïétiques [1 3]. Dans les laboratoires de virologie, des méthodes de diagnostic à la fois rapides, sensibles et spécifiques sont nécessaires pour la mesure des charges virales sanguines chez les patients afin de détecter précocement les infections virales opportunistes et de prévenir efficacement les maladies associées à ces virus. Le but de cette étude était de développer de nouveaux protocoles de PCR en temps réel pour le CMV, l EBV, le HHV-6 et le BKV sur le LightCycler (LC480), la nouvelle plate-forme de PCR en temps réel récemment commercialisée par Roche Diagnostics (Meylan, France) et d évaluer les performances de ce nouveau système par comparaison à des techniques de PCR en temps réel de référence (techniques «maison»), en utilisant des prélèvements de sang total et des panels de contrôle de qualité. d une minute à 40 8C. Les techniques de PCR en temps réel ont été effectuées en parallèle sur le LC480, après des adaptations mineures des protocoles initiaux. L amplification a été réalisée dans un volume final de 25 ml comprenant le tampon LC480 Probes Master (1X), les amorces sens et antisens (200 nm chacune), la sonde d hydrolyse (100 nm), l uracil-n-glycosylase (0,38 unité ; Invitrogen, Cergy- Pontoise, France) et 10 ml d extrait d ADN. À noter que pour la technique BKV sur LC480, les concentrations d amorces et de sonde étaient 500 nm. Pour la technique EBV sur LC480, la sonde d hybridation marquée au LC-Red 640 (appelée sonde EBV-LC2 dans la méthode initiale décrite par Brengel-Pesce et al. [7]) a été utilisée en tant que sonde d hydrolyse doublement marquée FAM - TAMRA. Les séquences des amorces et des sondes utilisées dans les protocoles pour le LC480 sont indiquées dans le Tableau 1. Pour l ensemble des virus testés, le programme d amplification sur LC480 était le suivant : deux minutes à 50 8C etdix minutes à 95 8C, puis 45 cycles comprenant chacun 15 secondes à 95 8C et 40 secondes à 60 8C et une étape finale de refroidissement de 30 secondes à 40 8C. Pour le CMV, l EBV et le HHV-6, la quantification du génome viral était effectuée grâce à une courbe de calibration générée à partir de dilutions successives de raison 10 d ADN viral obtenu par extraction de cellules infectées et quantifié par rapport à un plasmide (gracieusement fourni par les Pr Bruno Lina, Pr Jean-Marie Seigneurin et Dr Agnès Gautheret-Dejean, respectivement). Pour le BKV, un standard quantifié du commerce a été utilisé (BK Human Polyomavirus quantitated viral DNA, Tebu-Bio, Perray-en-Yvelines, France). Afin de détecter la présence potentielle d inhibiteurs de PCR dans les extraits d ADN, tous les extraits ont été testés purs et à la dilution 1:10. Les résultats des charges virales ont été exprimésen log (nombre de copies/ml). Le seuil de sensibilité de toutes les techniques de PCR était 1,4 log (25 copies/ml). 2. Patients et méthodes Au total, 253 prélèvements de sang total (prélevés sur anticoagulant EDTA) provenant de patients greffés d organe solide ou de cellules souches hématopoïétiques ont été analysés pour le CMV (n = 62), l EBV (n = 104), le HHV-6 (n = 53) et le BKV (n = 34). Ces prélèvements biologiques ont été sélectionnésrétrospectivement afin d obtenir un large éventail de valeurs de charges virales pour chacun des virus étudiés. De plus, 44 échantillons du contrôle de qualité pour le diagnostic moléculaire 2008 (Quality Control for Molecular Diagnosis [QCMD]) ont été testés : dix pour le CMV, dix pour l EBV, 12 pour le HHV-6 et 12 pour le BKV. Les prélèvements sanguins ont été conservés à 80 8C avant d être testés et les échantillons du QCMD ont été reconstitués avec de l eau stérile pour biologie moléculaire au moment des tests, selon les recommandations du fournisseur. L ADN aété extrait à partir de 400 ml d échantillon (sang total ou contrôle de qualité) à l aide de la trousse MagNA Pure Compact Nucleic Acid Isolation kit I sur l automate MagNA Pure Compact (Roche Diagnostics). Le volume d élution était de 100 ml. Les ADN viraux ont ensuite été amplifiés àl aide des techniques de PCR en temps réel de référence (techniques «maison») mises en œuvre dans le laboratoire pour notre activité de diagnostic virologique. Pour le CMV, le HHV-6 et le BKV, les techniques de PCR en temps réel utilisant la technologie de sonde d hydrolyse (TaqMan 1 ) ont été utilisées comme décrit précédemment [4 6]. Pour l EBV, la technique de PCR en temps réel utilisant la technologie des sondes d hybridation a été effectuée comme décrit précédemment [7]. Les PCR CMV et HHV-6 ont été réalisées sur l automate ABI PRISM (Applied Biosystems, Courtaboeuf, France) en utilisant le programme d amplification suivant : deux minutes à 50 8C et dix minutes à 95 8C, puis 45 cycles comprenant chacun 15 secondes à 95 8C et une minute à 60 8C (mode émulation 9600). Les PCR EBV et BKV ont été effectuées sur le LightCycler (LC1.5 ; Roche Diagnostics). Pour la technique BKV, le programme d amplification était le suivant : une minute à 50 8C et huit minutes à 95 8C, puis 45 cycles comprenant chacun cinq secondes à 95 8C et 20 secondes à 60 8C, et une étape finale de refroidissement d une minute à 40 8C. Les paramètres du programme d amplification pour la technique EBV étaient les suivants : une minute à 50 8C et huit minutes à 95 8C, puis 45 cycles comprenant chacun dix secondes à 95 8C, 15 secondes à 58 8C et 15 secondes à 72 8C, et une étape finale de refroidissement 3. Résultats Parmi les 253 prélèvements de sang total testés à l aide des techniques de PCR en temps réel de référence et des techniques LC480, 174 étaient positifs dans les deux techniques et 55 étaient négatifs, ce qui correspond à une concordance globale de 90,5 % entre les deux techniques. Les concordances respectives pour les techniques CMV, EBV, HHV-6 et BKV étaient 93,5, 87,5, 87 et 100 % (Tableau 2). Les 24 (9,5 %) résultats discordants correspondaient à des prélèvements comportant de faibles charges virales, Tableau 2 Comparaison des méthodes de PCR en temps réel de référence et LC480 pour la détection des génomes du CMV, de l EBV, du HHV-6 et du BKV dans les prélèvements de sang total. Virus Méthode de référence Méthode LC480 Total Positif Négatif CMV Positif (85 %) Négatif (15 %) Total 53 (85 %) 9 (15 %) 62 (100 %) EBV Positif (67 %) Négatif (33 %) Total 63 (61 %) 41 (39 %) 104 (100 %) HHV-6 Positif (83 %) Négatif (17 %) Total 37 (70 %) 16 (30 %) 53 (100 %) BKV Positif (76 %) Négatif (24 %) Total 26 (76 %) 8 (24 %) 34 (100 %)

4 168 D. Boutolleau et al. / Pathologie Biologie 58 (2010) Fig. 1. Comparaison des charges virales dans le sang total obtenues avec les techniques de référence et LC480. Les données correspondent aux prélèvements pour lesquels les résultats étaient positifs avec les deux techniques. A. Corrélation entre les charges virales CMV, EBV, HHV-6 et BKV obtenues par quantification des génomes viraux avec les techniques de référence et les techniques LC480. B. Représentations de Bland-Altman pour les techniques de PCR en temps réel CMV, EBV, HHV-6 et BKV. Pour chaque graphique, l axe des abscisses (x) représente la moyenne des valeurs (log copies/ml de sang total) obtenues avec la technique de référence et la technique LC480 pour chaque prélèvement et l axe des ordonnées (y) représente la différence entre les valeurs (log copies/ml de sang total) obtenues avec les deux techniques. Les lignes horizontales représentent la différence moyenne (ligne pleine) plus ou moins 1,96 déviation standard (pointillés).

5 D. Boutolleau et al. / Pathologie Biologie 58 (2010) inférieures à 2,7 log (500 copies/ml), quel que soit le virus étudié. Pour chaque virus, les résultats quantitatifs obtenus par les deux techniques (référence et LC480) ont été comparés à l aide du test de corrélation de Spearman. Une corrélation statistiquement significative a été mise en évidence, avec des coefficients de corrélation (Rho) de 0,98, 0,85, 0,92 et 0,87 pour le CMV, l EBV, le HHV-6 et le BKV, respectivement (p < 0,0001) (Fig. 1A). Les représentations de Bland-Altman n ont pas mis en évidence de différence significative entre les deux techniques pour chaque virus étudié. En effet, les moyennes des différences des charges virales (Dlog [technique LC480/technique de référence]) étaient globalement comprises entre 0,07 et 0,19 : 0,07 (1,96 déviation standard [DS] : 0,45 à 0,31) pour le CMV ; 0,15 (1,96 DS : 0,90 à 1,19) pour l EBV ; 0,06 (1,96 DS : 0,86 à 0,98) pour le HHV-6 ; 0,19 (1,96 DS : 0,74 à 1,11) pour le BKV (Fig. 1B). L exactitude de ces nouveaux protocoles de PCR en temps réel sur LC480 a été confirmée grâce à l analyse des échantillons du QCMD Pour chaque panel de virus, la concordance entre les résultats qualitatifs obtenus avec les techniques de référence et les techniques LC480 était de 100 %. En ce qui concerne les résultats quantitatifs, les moyennes des différences des charges virales (Dlog [technique LC480/technique de référence]) étaient 0,11, 0,04, 0,04 et 0,33 pour le CMV, l EBV, le HHV-6 et le BKV, respectivement. De plus, les moyennes des différences des charges virales (Dlog) entre les résultats obtenus avec la technique LC480 et les résultats attendus par l organisme fournissant le QCMD (c est-à-dire la moyenne des résultats de l ensemble des participants) étaient comprises entre 0,41 (HHV-6) et 0,61 (EBV). La composition détaillée de chacun des panels du QCMD inclus dans cette étude est disponible sur le site officiel du QCMD : 4. Discussion À ce jour, seulement quelques applications du LC480 dans le domaine du diagnostic virologique moléculaire, concernant notamment les papillomavirus ou les virus respiratoires, ont été décrites [8 10].Notre étude avait pour but d évaluer les performances de la plate-forme de PCR en temps réel LC480 dans le contexte de l activité de routine d un laboratoire de virologie pour le diagnostic et le suivi des infections virales opportunistes fréquemment rencontrés chez les patients au cours de la période post-greffe d organe solide ou de cellules souches hématopoïétiques et ce en utilisant à la fois des prélèvements de sang total et des contrôles de qualité (QCMD). Dans un premier temps, de nouveaux protocoles de PCR en temps réel pour le CMV, l EBV, HHV-6 et le BKV ont été adaptés sur le LC480 à partir de techniques précédemment décrites dans la littérature [4 7]. La composition du mélange réactionnel ainsi que le programme d amplification sur le LC480 étaient identiques pour chacun des protocoles, ce qui permet la détection et la quantification moléculaire des quatre virus au cours de la même technique, ce qui constitue un très grand avantage pour l activité diagnostique de routine d un laboratoire de virologie. De plus, tous les protocoles utilisaient la technologie de sonde d hydrolyse (TaqMan 1 ) qui constitue une méthode particulièrement bien adaptée à la quantification des génomes viraux. Le LC480 offre de nombreux avantages par rapport aux automates d amplification utilisés pour les techniques de référence : l utilisation de microplaques réactionnelles de 96 puits à la place des carrousels comprenant 32 capillaires sur les LC1.5 (Roche Diagnostics) permet d analyser simultanément un plus grand nombre d échantillons, et le temps total d amplification de 80 minutes au lieu de 120 minutes avec l ABI PRISM (Applied Biosystems) permet de réduire le délai d obtention des résultats. En comparaison avec les techniques de référence du laboratoire, la concordance des résultats obtenus sur les prélèvements de sang total avec les protocoles mis en place sur le LC480 était très bonne (90,5 %). En termes de charges virales, quel que soit le virus étudié, une forte corrélation a été observée entre les deux techniques, le coefficient de corrélation de Spearman étant compris entre 0,85 et 0,98, sans décalage significatif au regard des représentations de Bland-Altman. Les quelques résultats discordants correspondaient à de faibles charges virales, inférieures à 2,7 log (soit 500 copies/ml), sans conséquence significative en termes de diagnostic virologique ou de prise en charge thérapeutique des patients [4,11 13]. Les données obtenues pour les 44 échantillons du QCMD 2008 ont confirmé ces résultats avec une concordance de 100 % pour la détection des génomes viraux et des moyennes des différences des charges virales obtenues avec les techniques de référence et LC480 comprises entre 0,11 et 0,33. De plus, les résultats obtenus avec les protocoles LC480 étaient similaires à ceux attendus par l organisme du QCMD. En conclusion, la plate-forme de PCR en temps réel LC480, couplée à l automate MagNA Pure Compact pour l extraction de l ADN, constitue un système parfaitement adapté à l activité hospitalière d un laboratoire de virologie pour le diagnostic et le suivi des infections virales opportunistes chez les patients greffés par la mesure des charges virales CMV, EBV, HHV-6 et BKV dans les prélèvements de sang total. 5. Conflits d intérêts Les auteurs de ce manuscrit n ont aucun conflits d intérêts. Remerciements Nous remercions Nicolas Brunet et Florence Corne de la société Roche Diagnostics pour leur aide et leur assistance. Références [1] Razonable RR, Paya CV. Herpesvirus infections in transplant recipients: current challenges in the clinical management of cytomegalovirus and Epstein-Barr virus infections. Herpes 2003;10:60 5. [2] De Bolle L, Naesens L, De Clercq E. Update on human herpesvirus 6 biology, clinical features, and therapy. Clin Microbiol Rev 2005;18: [3] Randhawa P, Brennan DC. BK virus infection in transplant recipients: An overview and update. Am J Transplant 2006;6: [4] Deback C, Fillet AM, Dhedin N, Barrou B, Varnous S, Najioullah F, et al. Monitoring of human cytomegalovirus infection in immunosuppressed patients using real-time PCR on whole blood. J Clin Virol 2007;40: [5] Gautheret-Dejean A, Manichanh C, Thien-Ah-Koon F, Fillet AM, Mangeney N, Vidaud M, et al. Development of a real-time PCR assay for the diagnosis of human herpesvirus-6 infection and application to bone marrow transplant recipients. J Virol Methods 2002;100: [6] Si-Mohamed A, Le Goff J, Désiré N, Maylin S, Glotz D, Bélec L. Detection and quantitation of BK virus DNA by real-time polymerase chain reaction in the LTag gene in adult renal transplant recipients. J Virol Methods 2006;131:21 7. [7] Brengel-Pesce K, Morand P, Schmuck A, Bourgeat MJ, Buisson M, Barguès G, et al. Routine use of real-time quantitative PCR for laboratory diagnosis of Epstein-Barr virus infections. J Med Virol 2002;66: [8] Dumonceaux TJ, Mesa C, Severini A. Internally controlled triplex quantitative PCR assay for human polyomaviruses JC and BK. J Clin Microbiol 2008;46: [9] Molenkamp R, van der Ham A, Schinkel J, Beld M. Simultaneous detection of five DNA targets by real-time TaqMan PCR using the Roche LightCycler 1 480: Application in viral molecular diagnostics. J Virol Methods 2007;141: [10] Stevens MP, Garland SM, Tabrizi SN. Development and validation of a realtime PCR assay specifically detecting human papillomavirus 52 using the Roche LightCycler system. J Virol Methods 2008;147: [11] Boutolleau D, Fernandez C, André E, Imbert-Marcille BM, Milpied N, Agut H, et al. Human herpesvirus (HHV)-6 and HHV-7: two closely related viruses with different infection profiles in stem cell transplant recipients. J Infect Dis 2003;187: [12] Fafi-Kremer S, Brengel-Pesce K, Barguès G, Bourgeat MJ, Genoulaz O, Seigneurin JM, et al. Assessment of automated DNA extraction coupled with real-time PCR for measuring Epstein-Barr virus load in whole blood, peripheral mononuclear cells and plasma. J Clin Virol 2004;30: [13] Yeo FE, Yuan CM, Swanson SJ, Reinmuth B, Kiandoli LC, Kaplan KJ, et al. The prevalence of BK polyomavirus infection in outpatient kidney transplant recipients followed in a single center. Clin Transplant 2008;22:

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Carge virale du VHB : ADN-VHB ADN-VHB 11CHB1 Mars 2011 Edition : Septembre 2011 Afssaps -143/147, Bd Anatole France F-93285 Saint

Plus en détail

Apport de la PCR en temps réel en maladies infectieuses

Apport de la PCR en temps réel en maladies infectieuses Apport de la PCR en temps réel en maladies infectieuses Biologie moléculaire Amplification PCR I. Dénaturation ADN 95 C II. Hybridation t = Tm III. Extension t dépend de la polymérase employée PCR «classique»

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Charge virale de l Hépatite C : ARN-VHC ARN-VHC 05VHC1 mars 2005 Edition : novembre 2006 Annales ARN-VHC 05VHC1 1 / 14 ARN-VHC

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar EBV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

2007 : Evaluation des extracteurs QiaSymphony (Qiagen) et EasyMag

2007 : Evaluation des extracteurs QiaSymphony (Qiagen) et EasyMag Objectifs : 2007 : Evaluation des extracteurs QiaSymphony (Qiagen) et EasyMag (BioMérieux) pour l extraction de l ADN du cytomégalovirus humain à partir du sang total de la salive et du LCR. (CNR Limoges)

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

PRINCIPES THEORIQUES DE LA PCRq

PRINCIPES THEORIQUES DE LA PCRq PRINCIPES THEORIQUES DE LA PCRq Ce chapitre aborde les notions présentées rapidement dans l introduction (Ct, droite standard, principes de la quantification). Il détaille les différents formats de fluorescence

Plus en détail

DBS (Dried Blood Spot) dans le suivi virologique des patients VIH+ sous traitement antirétroviral

DBS (Dried Blood Spot) dans le suivi virologique des patients VIH+ sous traitement antirétroviral DBS (Dried Blood Spot) dans le suivi virologique des patients VIH+ sous traitement antirétroviral ANRS 12 235 Abou Abdallah Malick DIOUARA UCAD(ED-SEV) Sénégal & UM1 (CSB2) Montpellier - France Contact:

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

altona altona RealStar HSV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar HSV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar HSV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

DÉTECTION DU GÉNOME DU VIH

DÉTECTION DU GÉNOME DU VIH DÉTECTION DU GÉNOME DU VIH AU SEIN DES FRACTIONS DU SPERME Classement NABM : 16-02 - code : non codé JUILLET 2006 Service évaluation des actes professionnels 2 avenue du Stade de France 93218 Saint-Denis

Plus en détail

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction) L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Corinne.sailleau@anses.fr Agence Nationale de Sécurité

Plus en détail

Kit d extraction PicoPure RNA

Kit d extraction PicoPure RNA Isoler des ARN même à partir d une cellule Le kit d extraction PicoPure RNA a été développé pour obtenir une haute qualité des ARNs totaux à partir d un minimum de dix cellules. Le haut rendement obtenu

Plus en détail

INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD

INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD 5 e réunion viro-clinique inter-corevih «VIH, cultures et thérapeutiques» Marie Leoz, 23 mars 2013 PRÉLÈVEMENT SUR BUVARD : C EST QUOI? POURQUOI? Mode alternatif de

Plus en détail

Ministère des Solidarités, de la Santé et de la Famille

Ministère des Solidarités, de la Santé et de la Famille Ministère des Solidarités, de la Santé et de la Famille Direction générale de la Santé Sous-Direction de la gestion des risques des milieux Bureau des eaux DGS/SD7A N Personnes chargées du dossier : Philippe

Plus en détail

Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand?

Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand? Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand? Dr. Ilka Engelmann Laboratoire de Virologie, Pôle Biologie Pathologie Génétique, CHRU de Lille EA3610, Université Lille 2

Plus en détail

Infections aiguës respiratoires

Infections aiguës respiratoires Infections aiguës respiratoires Apport de la biologie moléculaire Marie-Claude Bernard D I symposium infections aiguës respiratoires 29/03/05 - p.1 Le diagnostic Culture EIA ICT (immunochromato) Immuno

Plus en détail

DEPARTEMENT DE BIOLOGIE CLINIQUE, D ANATOMIE PATHOLOGIQUE ET DE GENETIQUE MEDICALE Tableau des consignes de prélèvement

DEPARTEMENT DE BIOLOGIE CLINIQUE, D ANATOMIE PATHOLOGIQUE ET DE GENETIQUE MEDICALE Tableau des consignes de prélèvement I. LABORATOIRE DE BIOLOGIE MOLECULAIRE 1.1. Secteur Hématologie Code analyses Descriptif Indications principales IG.ADN TG.ADN TD.ADN TB.ADN Recherche réarrangement des gènes des immunoglobulines Recherche

Plus en détail

Guide d utilisation des kits Perfect Master Mix SYBR Green

Guide d utilisation des kits Perfect Master Mix SYBR Green Guide d utilisation des kits Perfect Master Mix SYBR Green Pour les produits AnyGenes : Cat # PMSX-F2S Cat # PMSX-F4S Cat # PMSX-F8S Cat # PMSX-F12S Cat # PMSX-F24S (* Cat # pour toutes les références

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

Tests Interferon = quoi de neuf? en médecine du travail

Tests Interferon = quoi de neuf? en médecine du travail Tests Interferon = quoi de neuf? en médecine du travail Elisabeth BOUVET, Dominique Abiteboul GERES Tuberculose infection et tuberculose maladie Contact BK= TM Infection latente 95% Infection = 30% des

Plus en détail

Virologie en Pédiatrie

Virologie en Pédiatrie Virologie en Pédiatrie Pr Coumba Touré Kane ANRS-SENEGAL Introduc3on 3,4 millions d enfants en 2010 (OMS 2011) 90% de ces enfants en Afrique sub- saharienne 260 000 enfants infectés en 2012 Baisse de 52

Plus en détail

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Haouari M., Ferchichi A. in Ferchichi A. (comp.), Ferchichi A. (collab.). Réhabilitation des pâturages et des

Plus en détail

DETECTION DES PARVOVIRUS DES PALMIPEDES PAR PCR EN TEMPS REEL

DETECTION DES PARVOVIRUS DES PALMIPEDES PAR PCR EN TEMPS REEL DETECTION DES PARVOVIRUS DES PALMIPEDES PAR PCR EN TEMPS REEL Jean-Luc Pingret 1, Catherine Zadjian 2, Stéphane Lemière 3, Corine Boucraut-Baralon 1 1 SCANELIS, 23 chemin des Capelles 31076 Toulouse cedex3

Plus en détail

GenoLyse VER 1.0. Notice d'utilisation IFU-51610-09. pour usage diagnostique in vitro uniquement

GenoLyse VER 1.0. Notice d'utilisation IFU-51610-09. pour usage diagnostique in vitro uniquement GenoLyse VER 1.0 Notice d'utilisation IFU-51610-09 pour usage diagnostique in vitro uniquement 10/2012 GenoLyse Kit d Extraction d ADN Bactérien Veuillez lire attentivement la notice d utilisation dans

Plus en détail

Anticorps anti-hla en transplantation rénale

Anticorps anti-hla en transplantation rénale Anticorps anti-hla en transplantation rénale Caroline Suberbielle Laboratoire d'immuno-histocompatibilité Hôpital St Louis Paris Définitions Patient «naïf» Patient sans événement immunisant Homme ou enfant

Plus en détail

Importance du développement des biomarqueurs par un industriel

Importance du développement des biomarqueurs par un industriel Importance du développement des biomarqueurs par un industriel Dr Frédéric Eberlé, responsable médical Roche Diagnostics France Marseille, 27 mars 2015 Terminologie Biomarqueurs, Tests de diagnostic, Tests-compagnons

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques?

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? Dr C. ZANDOTTI Laboratoire de Virologie du Pr D. Raoult CHU Timone, Marseille. Virus herpes simplex (HSV) Virus strictement humain,

Plus en détail

JNI. Pr B Lina. Les tests rapides grippe : leur utilisation en pratique de ville

JNI. Pr B Lina. Les tests rapides grippe : leur utilisation en pratique de ville Les tests rapides grippe : leur utilisation en pratique de ville Pr B Lina Hospices Civils de Lyon, CNR des virus influenza (Sud), F69677, Bron Université de Lyon, Université Lyon 1, F69372, Lyon JNI 15

Plus en détail

Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun

Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun Richard Njouom Chef du Service de Virologie Centre Pasteur Cameroun Worshop on HPV/Cervical

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

CONTRÔLE DE LA QUALITE ANALYTIQUE AU LABO. Août 2009 Hilde De Boeck

CONTRÔLE DE LA QUALITE ANALYTIQUE AU LABO. Août 2009 Hilde De Boeck CONTRÔLE DE LA QUALITE ANALYTIQUE AU LABO Août 2009 Hilde De Boeck SOMMAIRE 1. Introduction 2. Mise en œuvre d un CQI 3. Préparation d un échantillon CQI 4. Calcule des valeurs cibles 5. Réalisation du

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

Charges virales basses sous traitement: définition impact virologique. Laurence Bocket Virologie CHRU de Lille

Charges virales basses sous traitement: définition impact virologique. Laurence Bocket Virologie CHRU de Lille XVIIe Journée Régionale de Pathologie Infectieuse 12 octobre 2010 Charges virales basses sous traitement: définition impact virologique Laurence Bocket Virologie CHRU de Lille conflits d intérêts subventions,

Plus en détail

Medication management capacity in highly functioning community living older adults: detection of early deficits.

Medication management capacity in highly functioning community living older adults: detection of early deficits. Drug Regimen Unassisted Grading Scale (DRUGS) Edelberg HK, Shallenberger E, Wei JY (1999) Medication management capacity in highly functioning community living older adults: detection of early deficits.

Plus en détail

Evaluation des risques fournisseurs en corrélation avec la Norme ISO 9001 :2015

Evaluation des risques fournisseurs en corrélation avec la Norme ISO 9001 :2015 1 Résumé L ISO 9001 Version 2008 est actuellement en cours de révision pour une publication en Septembre 2015, avec obligation pour les services biomédicaux de se conformer à tous les nouveaux critères

Plus en détail

Compte rendu 151 Co-Oxymétrie

Compte rendu 151 Co-Oxymétrie P: Compte rendu 151 Co-Oxymétrie Centre Toulousain pour le Contrôle de qualité en Biologie clinique Association déclarée à la Préfecture de la Haute-Garonne le 30 Octobre 1973 et enregistrée sous le n

Plus en détail

Medication management ability assessment: results from a performance based measure in older outpatients with schizophrenia.

Medication management ability assessment: results from a performance based measure in older outpatients with schizophrenia. Medication Management Ability Assessment (MMAA) Patterson TL, Lacro J, McKibbin CL, Moscona S, Hughs T, Jeste DV. (2002) Medication management ability assessment: results from a performance based measure

Plus en détail

Q PCR sur LC480 Roche

Q PCR sur LC480 Roche Q PCR sur LC480 Roche!! NE JAMAIS LAISSER DE PLAQUE DANS L APPAREIL!! Généralités : lampe xénon à arc : s éteint 30 min après chaque run durée d un run : plq 96p = 1h10 environ plq 384p = 40 50 min environ

Plus en détail

Comment gérer au mieux ma charge de travail en biologie moléculaire?

Comment gérer au mieux ma charge de travail en biologie moléculaire? Comment gérer au mieux ma charge de travail en biologie moléculaire? Une souplesse d emploi inégalée dans les tests de biologie moléculaire, répondant aux exigences de votre laboratoire Le système VERSANT

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

23. Interprétation clinique des mesures de l effet traitement

23. Interprétation clinique des mesures de l effet traitement 23. Interprétation clinique des mesures de l effet traitement 23.1. Critères de jugement binaires Plusieurs mesures (indices) sont utilisables pour quantifier l effet traitement lors de l utilisation d

Plus en détail

Dosage de l HbA1C décentralisée: une réelle plus-value?

Dosage de l HbA1C décentralisée: une réelle plus-value? Dosage de l HbA1C décentralisée: une réelle plus-value? Les jeudis de Fleurus 22 Octobre 2015 Answers for life. HbA1C: Rappels fondamentaux RBC Une fraction du glucose présent dans le sang se lie à l hémoglobine

Plus en détail

Manuel du kit ipsogen JAK2 MutaQuant

Manuel du kit ipsogen JAK2 MutaQuant Mars 2015 Manuel du kit ipsogen JAK2 MutaQuant 12 (référence 673522) 24 (référence 673523) Version 1 Diagnostics in vitro quantitatifs À utiliser sur des appareils Rotor-Gene Q, ABI PRISM 7900HT SDS, Applied

Plus en détail

RÉSUMÉ DE RECHERCHE. Fondé sur un rapport de recherche préparé pour l IB par : Ling Tan et Yan Bibby, Australian Council for Educational Research

RÉSUMÉ DE RECHERCHE. Fondé sur un rapport de recherche préparé pour l IB par : Ling Tan et Yan Bibby, Australian Council for Educational Research RÉSUMÉ DE RECHERCHE Comparaison des résultats d élèves issus ou non d établissements dispensant les programmes de l IB au programme ISA d évaluation des écoles internationales, et au questionnaire sur

Plus en détail

PLEX-ID, une nouvelle approche pour une identification microbienne rapide

PLEX-ID, une nouvelle approche pour une identification microbienne rapide PLEX-ID, une nouvelle approche pour une identification microbienne rapide Pr Jacques Izopet Laboratoire de Virologie CHU de Toulouse & INSERM U1043 41 ème Colloque National des 41 ème Colloque National

Plus en détail

VZV EBV. AdV CMV HHV7 HHV8. Virus BK HSV1 HSV2. R-gene trousses de PCR en Temps-Réel HHV6

VZV EBV. AdV CMV HHV7 HHV8. Virus BK HSV1 HSV2. R-gene trousses de PCR en Temps-Réel HHV6 INFECTIONS VIRALES POST-TRANSPLANTATION HSV1 EBV CMV HHV7 HHV8 VZV HSV2 HHV6 Virus BK AdV R-gene trousses de PCR en Temps-Réel Détectent et Quantifient les principaux virus impliqués dans les infections

Plus en détail

Le programme OPP-ERA (Open Polyvalent Platforms-Era) UNITAID. Pr Christine ROUZIOUX CHU Necker, Université Paris Descartes

Le programme OPP-ERA (Open Polyvalent Platforms-Era) UNITAID. Pr Christine ROUZIOUX CHU Necker, Université Paris Descartes Le programme OPP-ERA (Open Polyvalent Platforms-Era) UNITAID Pr Christine ROUZIOUX CHU Necker, Université Paris Descartes Programme en réponse à l appel d offres UNITAID: Diagnostic TB, Paludisme et VIH

Plus en détail

Autres termes clés (Other key terms)

Autres termes clés (Other key terms) Carve-out method Autres termes clés (Other key terms) Norme Rapports d assurance sur les contrôles d une société de services extérieurs (, Assurance Reports on Controls at a Third Party Service Organization)

Plus en détail

Evaluation de l exposition tabagique chez un groupe de «fumeurs actifs» et un groupe de «fumeurs passifs».

Evaluation de l exposition tabagique chez un groupe de «fumeurs actifs» et un groupe de «fumeurs passifs». Evaluation de l exposition tabagique chez un groupe de «fumeurs actifs» et un groupe de «fumeurs passifs». Dosage de la nicotine et de la cotinine urinaires par chromatographie liquide haute performance

Plus en détail

Testosterone EXPLORER DE NOUVEAUX DOMAINES. ARCHITECT 2nd Generation DOSAGE SENSIBLE ET EXACT. Put science on your side.**

Testosterone EXPLORER DE NOUVEAUX DOMAINES. ARCHITECT 2nd Generation DOSAGE SENSIBLE ET EXACT. Put science on your side.** EXPLORER DE NOUVEAUX DOMAINES ARCHITECT nd Generation Testosterone DOSAGE SENSIBLE ET EXACT * Une Promesse pour la Vie ** Mettre la science à vos côtés Put science on your side.** * Pourquoi doser la testostérone?

Plus en détail

Centre National de Référence de la Syphilis www.cnr-syphilis.fr

Centre National de Référence de la Syphilis www.cnr-syphilis.fr Centre National de Référence de la Syphilis www.cnr-syphilis.fr CNR Syphilis Service de Dermatologie Vénéréologie Hôpital Cochin Pavillon Gustave Roussy, Laboratoire de Dermatologie Etage 4, porte 405-8,

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Exemple de programme de travail (Base pour un cours d une semaine) M. Querci WORLD HEALTH ORGANIZATION REGIONAL

Plus en détail

Evaluation des coûts de dépistage d Entérocoques Résistants aux Glycopeptides : Résultats préliminaires

Evaluation des coûts de dépistage d Entérocoques Résistants aux Glycopeptides : Résultats préliminaires Evaluation des coûts de dépistage d Entérocoques Résistants aux Glycopeptides : culture versus PCR Résultats préliminaires J. Assoukpa, L. Dupraz, D. Lecointe UFHHLIN, Centre Hospitalier Sud Francilien,

Plus en détail

Les dispositifs médicaux de diagnostic in vitro SPLIT 06/11/06

Les dispositifs médicaux de diagnostic in vitro SPLIT 06/11/06 Les dispositifs médicaux de diagnostic in vitro Directive européenne 98/79/CE du 27/10/98 relative aux DMDIV OBJECTIFS Directive dite «Nouvelle approche» - Harmonisation des réglementations nationales

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Nouvelles Recommandations en 2009 et rappels sur les indications de la prophylaxie post-exposition. Dr H.Melliez CH de Tourcoing 19 mars 2009

Nouvelles Recommandations en 2009 et rappels sur les indications de la prophylaxie post-exposition. Dr H.Melliez CH de Tourcoing 19 mars 2009 Nouvelles Recommandations en 2009 et rappels sur les indications de la prophylaxie post-exposition Dr H.Melliez CH de Tourcoing 19 mars 2009 «Nouvelles recommandations» Sources : DGS : CIRCULAIRE INTERMINISTERIELLE

Plus en détail

Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée

Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée C. Rondé-Oustau, JY. Jenny,J.Sibilia, J. Gaudias, C. Boéri, M. Antoni Hôpitaux

Plus en détail

Urgent NOTIFICATION DE SECURITE

Urgent NOTIFICATION DE SECURITE Urgent NOTIFICATION DE SECURITE Dispositif: CDI 100 et 101 Système de Monitorage hématocrite/saturation en Référence: FSN106 2010-12 [FR] Action: Information Produit A l attention de: L Ingénieur Biomédical

Plus en détail

Role du microbiota pulmonaire dans la mucoviscidose

Role du microbiota pulmonaire dans la mucoviscidose 29. März 2014 Role du microbiota pulmonaire dans la mucoviscidose Gaudenz Hafen, MD & MER1 Médecin assoicé Résponsable de l unité pneumologie et mucoviscidose pédiatrique Table des matières 1. Introduction

Plus en détail

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00)

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00) Pour jeudi 12/02/2014 DEVOIR A LA MAISON BMGG (temps recommandé : 2H00) Calculatrice non autorisée Dictionnaire anglais/français autorisé. Clonage et PCR En 1983, Kary Mullis conçut l'idée de la réaction

Plus en détail

Étude de validation du Bluestar Forensic

Étude de validation du Bluestar Forensic Étude de validation du Bluestar Forensic I. Matériels et matières utilisés II. des tests 2.1. Détermination du seuil de sensibilité du kit Bluestar 2.2. Détermination de taches en fonction de leur volume

Plus en détail

Centre Jean Perrin. Centre de Lutte contre le Cancer d'auvergne. Clermont-Ferrand - France - Projet PROGACIR

Centre Jean Perrin. Centre de Lutte contre le Cancer d'auvergne. Clermont-Ferrand - France - Projet PROGACIR Centre Jean Perrin Centre de Lutte contre le Cancer d'auvergne Clermont-Ferrand - France - Projet PROGACIR Positionnement Intérêt du séquençage de l ADN tumoral circulant du gène TP53 muté pour la prédiction

Plus en détail

DYNAMIQUE DE LA QUASIESPECE DE VARIANTS ADN VIH-1 RESISTANTS CHEZ DES PATIENTS SOUS TRAITEMENT EFFICACE ETUDE EN SEQUENCAGE A HAUT DEBIT

DYNAMIQUE DE LA QUASIESPECE DE VARIANTS ADN VIH-1 RESISTANTS CHEZ DES PATIENTS SOUS TRAITEMENT EFFICACE ETUDE EN SEQUENCAGE A HAUT DEBIT Séminaires Jeudi 24 septembre 2015 DYNAMIQUE DE LA QUASIESPECE DE VARIANTS ADN VIH-1 RESISTANTS CHEZ DES PATIENTS SOUS TRAITEMENT EFFICACE ETUDE EN SEQUENCAGE A HAUT DEBIT Dr Pierre Gantner EA 7327: Infec-on

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Les méthodes de diagnostic en virologie

Les méthodes de diagnostic en virologie Les méthodes de diagnostic en virologie Pourquoi faire du diagnostic en virologie? Dons de sang, d organes et de tissus (dépistage obligatoire) Suivi biologique des infections (VIH, VHB, VHC) Mesures prophylactiques

Plus en détail

d identification et de typage des orbivirus (action A1)

d identification et de typage des orbivirus (action A1) Développement d outils d d identification d et de typage des orbivirus (action A1) Stéphan ZIENTARA, Corinne SAILLEAU, Emmanuel BREARD, Cyril VIAROUGE, Kamilla GORNA, Anthony RELMY, Alexandra DESPRAT UMR

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Virus BK et transplantation rénale

Virus BK et transplantation rénale Virus BK et transplantation rénale B Hurault de Ligny CHU Caen Infections à vbk en transplantation rénale Infection virale fréquente 30-40% Gravité: néphropathie à vbk prévalence: 5% (1 à 10%) perte du

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

RAPPORT D ESSAI INTER-LABORATOIRE 02-2015-A. Rapport final

RAPPORT D ESSAI INTER-LABORATOIRE 02-2015-A. Rapport final Agence Fédérale pour la sécurité de la Chaîne alimentaire BU PT Schemes Laboratoire fédéral pour la Sécurité alimentaire Chaussée de Namur, 22 B-5030 Gembloux Tel. +32 (0)81 62 03 00 Fax +32 (0)81 62 03

Plus en détail

Lecture automatisée. Séminaire de formation continue IAL. Dr V. Aubert

Lecture automatisée. Séminaire de formation continue IAL. Dr V. Aubert Anticorps anti-nucléaire: anti nucléaire: Lecture automatisée avec le NOVA View Séminaire de formation continue IAL Lausanne 14 Lausanne, 14.11.2013 11 2013 Dr V. Aubert Service d immunologie Service d

Plus en détail

MANUEL DE PRELEVEMENT DU CNR SYPHILIS

MANUEL DE PRELEVEMENT DU CNR SYPHILIS Procédure qualité au 1/21 DU CNR SYPHILIS Procédure qualité au 2/21 OBJET Le Manuel de Prélèvement a pour but d améliorer les échanges entre les centres préleveurs réalisant et assurant l acheminement

Plus en détail

PLATE-FORME ANALYSE STRUCTURALE Prestations générales

PLATE-FORME ANALYSE STRUCTURALE Prestations générales PLATE-FORME ANALYSE STRUCTURALE Prestations générales Structuralis est agréé Crédit Impôt Recherche pour l ensemble des prestations décrites. 1-Prestations RMN Les prestations ci-après sont considérées

Plus en détail

Utilisation des outils de mesure de la performance des analyses de laboratoire

Utilisation des outils de mesure de la performance des analyses de laboratoire Utilisation des outils de mesure de la performance des analyses de laboratoire Christiane Claessens Laboratoire de santé publique du Québec 24 octobre 2006 Surprise! Un test de laboratoire 100% précis

Plus en détail

I REPARTITION DES VALEURS OBTENUES AVEC LES 7 COFFRETS ELISA ET LE TEST DE FARR :

I REPARTITION DES VALEURS OBTENUES AVEC LES 7 COFFRETS ELISA ET LE TEST DE FARR : I REPARTITION DES VALEURS OBTENUES AVEC LES 7 COFFRETS ELISA ET LE TEST DE FARR : Nous avo cotaté l'extrême difficulté de comparaison des résultats obtenus par les 7 trousses en raison de "valeurs-seuil"

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE JANUARY 30, 2012 SERVICES DE SEQUENÇAGE Centre d Innovation Génome Québec et Université McGill Services de détection de SNP et séquençage de novo par extension d amorce Technologie de type Sanger Guide

Plus en détail

Identification et détection des virus. A) Détection symptomatologique

Identification et détection des virus. A) Détection symptomatologique Identification et détection des virus La détection et l'identification des virus font appel à différentes méthodes. Ces méthodes se caractérisent par leur spécificité et leur sensibilité. On peut citer

Plus en détail

Méthode en trois étapes destinée à une évaluation globale des résultats obtenus pour différents échantillons.

Méthode en trois étapes destinée à une évaluation globale des résultats obtenus pour différents échantillons. ISP Rue J. Wytsman, 14 B-1050 BRUXELLES SERVICE PUBLIC FEDERAL (SPF) SANTE PUBLIQUE, PROTECTION DE LA CHAINE ALIMENTAIRE ET ENVIRONNEMENT COMMISSION DE BIOLOGIE CLINIQUE SERVICE DES LABORATOIRES DE BIOLOGIE

Plus en détail

2

2 1 2 Au total, 3 types de test moléculaires sont disponibles en virologie médicale. Ces tests incluent les tests de détection et de quantification de l ARN du VHC à l aide de méthode en temps réel (PCR

Plus en détail

Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation

Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation J Arnaud DBI, CHU de Grenoble CQE et assurance qualité Méthodes analytiques

Plus en détail

Notice d utilisation M5-01-002. Epigenomics AG, 10178 Berlin, Allemangne

Notice d utilisation M5-01-002. Epigenomics AG, 10178 Berlin, Allemangne Notice d utilisation Avant d utiliser ce kit, veuillez lire attentivement la notice et suivre scrupuleusement les instructions afin de garantir la fiabilité et la pertinence des résultats des tests. IFU

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

Aspects microbiologiques de la borréliose de Lyme B. Jaulhac

Aspects microbiologiques de la borréliose de Lyme B. Jaulhac Aspects microbiologiques de la borréliose de Lyme B. Jaulhac Laboratoire associé au Centre National de Référence des Borrelia Laboratoire de Bactériologie Hôpitaux Universitaires de Strasbourg Diagnostic

Plus en détail

Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8. A Le cisplatine... 8

Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8. A Le cisplatine... 8 Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8 A Le cisplatine.... 8 A.I Découverte de l activité anti-tumorale du cisplatine... 8 A.II Activité

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

Réglementation européenne. enne des dispositifs médicaux m diagnostic in vitro. E. LAFORGERIE 19 juillet 2006

Réglementation européenne. enne des dispositifs médicaux m diagnostic in vitro. E. LAFORGERIE 19 juillet 2006 Réglementation européenne enne des dispositifs médicaux m de diagnostic in vitro E. LAFORGERIE 19 juillet 2006 Historique des réglementationsr Décret du 19 avril 1996 relatif à l enregistrement des réactifsr

Plus en détail

Infection à CMV et allogreffe de cellules souches hématopoïétiques : Expérience du Centre National de Greffe de Moelle Osseuse, Tunis.

Infection à CMV et allogreffe de cellules souches hématopoïétiques : Expérience du Centre National de Greffe de Moelle Osseuse, Tunis. Infection à CMV et allogreffe de cellules souches hématopoïétiques : Expérience du Centre National de Greffe de Moelle Osseuse, Tunis. Tarek Ben Othman Congrès de la STPI, 24 avril 2009 Plan Introduction

Plus en détail

UNE FORMATION POUR APPRENDRE À PRÉSENTER DES DONNÉES CHIFFRÉES : POUR QUI ET POURQUOI? Bénédicte Garnier & Elisabeth Morand

UNE FORMATION POUR APPRENDRE À PRÉSENTER DES DONNÉES CHIFFRÉES : POUR QUI ET POURQUOI? Bénédicte Garnier & Elisabeth Morand UNE FORMATION POUR APPRENDRE À PRÉSENTER DES DONNÉES CHIFFRÉES : POUR QUI ET POURQUOI? Bénédicte Garnier & Elisabeth Morand Service méthodes statistiques Institut National d Etudes Démographiques (Ined)

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Infections endovasculaires

Infections endovasculaires Infections endovasculaires O. Leroy Service de Réanimation et Maladies Infectieuses CH Tourcoing 59 Conflits d intérêt Laboratoires Novartis: Orateur Laboratoires Sanofi-Aventis: Orateur, investigateur

Plus en détail