Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure"

Transcription

1 Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Marie Verbanck Laboratoire de Mathématiques Appliquées, Agrocampus OUEST Soutenance de thèse - 4 septembre 2013

2 Données transcriptomiques Cellules d un organisme mêmes gènes Tous les gènes ne s expriment pas (production d ARNm) Données transcriptomiques (puce à ADN) mesure du Transcriptome : ensemble des ARNm (tissu, condition expérimentale (CE), temps donnés) Tableau sujets gènes transcriptome : ligne Comparaison des transcriptomes entre les CE hypothèses sur le rôle et les interactions entre les gènes Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 2 / 38

3 Données transcriptomiques Cellules d un organisme mêmes gènes Tous les gènes ne s expriment pas (production d ARNm) Données transcriptomiques (puce à ADN) mesure du Transcriptome : ensemble des ARNm (tissu, condition expérimentale (CE), temps donnés) Tableau sujets gènes transcriptome : ligne Comparaison des transcriptomes entre les CE hypothèses sur le rôle et les interactions entre les gènes Nécessité de développer des outils statistiques adaptés Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 2 / 38

4 Traitements statistiques classiques 1 Tests multiples gènes différentiellement exprimés (DE) en fonction des CE 2 Visualisation des gènes DE analyse factorielle 3 Clustering clusters de gènes coexprimés 4 Caractérisation biologique fonctions biologiques caractéristiques des gènes DE ou des clusters de gènes coexprimés (tests d enrichissement) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 3 / 38

5 Traitements statistiques classiques : limites Données bruitées variabilité technologique (prétraitement) variabilité biologique (sujets structurés selon un plan) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 4 / 38

6 Traitements statistiques classiques : limites Données bruitées variabilité technologique (prétraitement) variabilité biologique (sujets structurés selon un plan) Connaissance du seul transcriptome non suffisante relations complexes entre gènes large variété d interprétation Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 4 / 38

7 Traitements statistiques classiques : limites Données bruitées Débruitage des données Connaissance du seul transcriptome non suffisante Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 4 / 38

8 Traitements statistiques classiques : limites Données bruitées Débruitage des données Connaissance du seul transcriptome non suffisante Intégration d information extérieure Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 4 / 38

9 1 Visualisation et débruitage des données transcriptomiques par ACP régularisée Modèle de l ACP Régularisation Résultats 2 Clustering de gènes basé sur l intégration d information biologique de type Gene Ontology Principe Algorithme Résultats Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 5 / 38

10 1 Visualisation et débruitage des données transcriptomiques par ACP régularisée Modèle de l ACP Régularisation Résultats 2 Clustering de gènes basé sur l intégration d information biologique de type Gene Ontology Principe Algorithme Résultats Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 5 / 38

11 Contexte ACP couramment appliquée aux données transcriptomiques Visualisation Débruitage - réduction de la dimension Clustering Estimation matrice de variance-covariance (réseaux) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 6 / 38

12 Modèle de l ACP ACP X : matrice de données transcriptomiques sujets gènes Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 7 / 38

13 Modèle de l ACP ACP X : matrice de données transcriptomiques sujets gènes Point de vue exploratoire ˆX en rang inférieur (S) qui minimise X ˆX 2 Moindres carrés Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 7 / 38

14 Modèle de l ACP ACP X : matrice de données transcriptomiques sujets gènes Point de vue exploratoire ˆX en rang inférieur (S) qui minimise X ˆX 2 Moindres carrés Point de vue modèle Modèle à effets fixes (Caussinus, 1986) X = X + ε x ij = S ds q is r js + ε ij, ε ij N (0, σ 2 ) s=1 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 7 / 38

15 Modèle de l ACP ACP X : matrice de données transcriptomiques sujets gènes Point de vue exploratoire ˆX en rang inférieur (S) qui minimise X ˆX 2 Moindres carrés Point de vue modèle Modèle à effets fixes (Caussinus, 1986) X = X + ε x ij = S ds q is r js + ε ij, ε ij N (0, σ 2 ) s=1 Estimateurs du MV du modèle = Estimateurs des MC Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 7 / 38

16 Modèle de l ACP ACP Point de vue exploratoire min X ˆX 2 Point de vue modèle (X = X + ε) min X ˆX 2 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 8 / 38

17 Modèle de l ACP ACP Point de vue exploratoire min X ˆX 2 Point de vue modèle (X = X + ε) min X ˆX 2 Erreur quadratique moyenne (EQM) EQM = E i,j (ˆx ij x ij ) 2 Minimiser l EQM Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 8 / 38

18 Régularisation Termes de régularisation Estimateurs régularisés réduction de l EQM EQM = E i,j EQM = E i,j (ˆx ij x ij ) 2 min(n 1;p) s=1 ˆx (s) ij x (s) ij 2 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 9 / 38

19 Régularisation Termes de régularisation Estimateurs régularisés réduction de l EQM Termes de régularisation (φ s ) s=1,...,min(n 1;p) qui minimisent : EQM = E i,j min(n 1;p) s=1 φ s ˆx (s) ij x (s) ij 2 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 9 / 38

20 Régularisation Minimisation de l EQM EQM = E i,j avec ˆx (s) ij min(n 1;p) s=1 φ s ˆx (s) ij x (s) ij = λ s u is v js et x (s) ij 2 (1) = d s q is r js Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 10 / 38

21 Régularisation Minimisation de l EQM EQM = E i,j avec ˆx (s) ij min(n 1;p) s=1 φ s ˆx (s) ij x (s) ij = λ s u is v js et x (s) ij 2 (1) = d s q is r js Minimisation de l équation (1) comme une fonction de φ s : Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 10 / 38

22 Régularisation Minimisation de l EQM EQM = E i,j avec ˆx (s) ij min(n 1;p) s=1 φ s ˆx (s) ij x (s) ij = λ s u is v js et x (s) ij 2 (1) = d s q is r js Minimisation de l équation (1) comme une fonction de φ s : φ s = d s K min(i 1;K) I = σ2 + d s variance signal (dim s) variance totale (dim s) s = 1,..., S 0 sinon Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 10 / 38

23 Régularisation Minimisation de l EQM EQM = E i,j avec ˆx (s) ij min(n 1;p) s=1 φ s ˆx (s) ij x (s) ij = λ s u is v js et x (s) ij 2 (1) = d s q is r js Minimisation de l équation (1) comme une fonction de φ s : d s K φ s = min(i 1;K) I σ2 + d s 0 K λ s min(i 1;K) I ˆσ2 s = 1,..., S ˆφ s = λ s 0 sinon Rq : Paramètre de réglage S nb de dimensions sous-jacentes du signal Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 10 / 38

24 Régularisation ACP régularisée Définition de l ACP régularisée (ACPr) : ˆx ACPr ij = ˆx ACPr ij = ˆx ACPr ij = S ˆφ s λs u is v js s=1 S λ s s=1 ( S λs s=1 K min(i 1;K) I ˆσ2 λ s λs u is v js K min(i 1;K) I ˆσ2 λs ) u is v js Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 11 / 38

25 Résultats Plan de simulations Simulation jeux de données sous le modèle signal + bruit (X = X + ε, ε ij N (0, σ 2 )) Variation de paramètres I /K (100/20 = 5, 50/50 = 1 and 20/100 = 0.2) S (2, 4, 10) SNR (4, 1, 0.8) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 12 / 38

26 Résultats Méthodes prises en compte ACP régularisée (vrai S) ACP classique (vrai S) Méthode SURE (Candès et al., 2012) Stratégie de seuillage doux ˆx doux ij = min(i 1;K) ( s=1 λs λ ) + u isv js Choix du λ Minimisation de l estimateur sans biais de Stein (SURE) Paramètre de réglage : pas S, mais variance du bruit (vrai σ 2 ) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 13 / 38

27 Résultats I K S SNR EQM(ˆX ACP, X) EQM(ˆX ACPr, X) EQM(ˆX SURE, X) E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E-01 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 14 / 38

28 Résultats I K S SNR EQM(ˆX ACP, X) EQM(ˆX ACPr, X) EQM(ˆX SURE, X) E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E-01 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 14 / 38

29 Résultats I K S SNR EQM(ˆX ACP, X) EQM(ˆX ACPr, X) EQM(ˆX SURE, X) E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E-01 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 14 / 38

30 Résultats Application aux données à jeun/nourris Problématique agronomique (Désert et al., 2008) expressions de gènes (puce à ADN) chez 27 poulets CE : 4 états nutritionnels à jeun pendant 16 h (F16) à jeun pendant 16h puis renourris pendant 5h (F16R5) à jeun pendant 16 h puis renourris pendant 16h (F16R16) nourris en continu (N) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 15 / 38

31 Résultats Heatmaps Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 16 / 38

32 Résultats Heatmaps Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 16 / 38

33 Résultats Heatmaps Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 16 / 38

34 Résultats Conclusions et perspectives ACP régularisée permet de visualiser et débruiter les données transcriptomiques Bon résultats en termes d estimation du signal sous-jacent Intérêt de l ACP régularisée : terme de régularisation explicite Autre domaine d application débruitage d images (Candès et al. 2012) Interaction avec débruitage préalable Estimation du nombre de dimensions sous-jacentes Extension à l AFM Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 17 / 38

35 Intégration d information extérieure Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 18 / 38

36 Intégration d information extérieure Prise en compte du seul transcriptome insuffisante mécanismes de régulation de l expression (transcription) Protéines régulatrices, réseaux de régulation Localisation chromosomique Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 18 / 38

37 Intégration d information extérieure Prise en compte du seul transcriptome insuffisante mécanismes de régulation de l expression (transcription) Protéines régulatrices, réseaux de régulation Intégration d information sur le rôle fonctionnel des gènes d après la littérature : Gene Ontology Localisation chromosomique Étude des données transcriptomiques en lien avec la localisation chromosomique Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 18 / 38

38 1 Visualisation et débruitage des données transcriptomiques par ACP régularisée Modèle de l ACP Régularisation Résultats 2 Clustering de gènes basé sur l intégration d information biologique de type Gene Ontology Principe Algorithme Résultats Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 19 / 38

39 1 Visualisation et débruitage des données transcriptomiques par ACP régularisée Modèle de l ACP Régularisation Résultats 2 Clustering de gènes basé sur l intégration d information biologique de type Gene Ontology Principe Algorithme Résultats Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 19 / 38

40 Contexte Clustering de gènes à partir des données transcriptomiques seules (ex : heatmap, réseau) Interprétation sur la base des clusters à partir d une information extérieure (ex : Gene Ontology) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 20 / 38

41 Contexte Clustering de gènes à partir des données transcriptomiques seules (ex : heatmap, réseau) connexions biologiques systématiques entre gènes coexprimés Interprétation sur la base des clusters à partir d une information extérieure (ex : Gene Ontology) une partie de l information peut être reliée à l expérience Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 20 / 38

42 Principe Nouveau point de vue Coexpression 2 phénomènes véritables connexions biologiques (ex : dans un réseau de régulation génique) activation indépendante de différentes réponses biologiques Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 21 / 38

43 Principe Nouveau point de vue Coexpression 2 phénomènes véritables connexions biologiques (ex : dans un réseau de régulation génique) activation indépendante de différentes réponses biologiques Conserver véritable coexpression au moyen de l information biologique Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 21 / 38

44 Principe Données Données transcriptomiques un gène est défini par son profil d expression Information biologique : annotations Gene Ontology décrivant l implication d un gène dans des fonctions biologiques un gène est défini par son profil fonctionnel Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 22 / 38

45 Principe Codage de l information biologique Matrice T, T kj = 1 si le gène k est associé à la fonction biologique j, 0 sinon 1 j J Marges 1 T 1. k T kj T k. K T K. Marges T.1 T.j T.J T.. Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 23 / 38

46 Algorithme Principe général Similarité des profils fonctionnels de gènes coexprimés existence de véritables connexions biologiques Intégration d une information de coexpression dans l information biologique obtention de fonctions biologiques coexprimées Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 24 / 38

47 Algorithme Fonctions biologiques coexprimées 1 j J Marges 1 T 1. k T kj T k. K T K. Marges T.1 T.j T.J T.. Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 25 / 38

48 Algorithme Fonctions biologiques coexprimées Fct j gène 1 1 gène 2 0 gène 3 1 gène 4 1 gène 5 0 gène 6 1 gène 7 0 gène 8 0 gène Fct biologique Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 25 / 38

49 Algorithme Fonctions biologiques coexprimées Fct j gène 1 1 gène 2 0 gène 3 1 gène 4 1 gène 5 0 gène 6 1 gène 7 0 gène 8 0 gène Fct biologique S 1 S 2 S 3 S Expressions Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 25 / 38

50 Algorithme Fonctions biologiques coexprimées Fct j gène 1 1 gène 2 0 gène 3 1 gène 4 1 gène 5 0 gène 6 1 gène 7 0 gène 8 0 gène Fct biologique S 1 S 2 S 3 S Expressions Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 25 / 38

51 Algorithme Fonctions biologiques coexprimées Fct j gène 1 1 gène 2 0 gène 3 1 gène 4 1 gène 5 0 gène 6 1 gène 7 0 gène 8 0 gène Fct biologique S 1 S 2 S 3 S Expressions Fcts biologiques coexprimées Fct j 1 Fct j Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 25 / 38

52 Algorithme Matrice T coexp T coexp substitution des fonctions biologiques par des fonctions biologiques coexprimées Gènes de K j l associés avec la lème fonction coexprimée issue de j Fonction 1 Fonction j Fonction J 1 l L j Marges 1 T 1. k T kj 1 k K j l T k. K T K. Marges card(k 1 1 ) card(k j l ) card(k J L J ) T.. Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 26 / 38

53 Algorithme Analyse de la matrice T coexp AFC de la matrice T coexp étude du degré de similarité des profils fonctionnels sous condition de coexpression Deux gènes sont proches s ils ont des profils fonctionnels et d expression similaires Algorithme de clustering sur les coordonnées des gènes sur les axes de l AFC Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 27 / 38

54 Algorithme Évaluation des clusters de gènes Pour interpréter un cluster comme une entité biologique Coexpression Homogénéité biologique Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 28 / 38

55 Algorithme Évaluation des clusters de gènes Pour interpréter un cluster comme une entité biologique Coexpression indicateur de coexpression (CI) Homogénéité biologique indicateur d homogéneité biologique (BHI) Procédure d évaluation : 2 indicateurs multidimensionnels + 2 probabilités critiques (permutations) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 28 / 38

56 Résultats Plan de simulations Simulation de jeux de données E sim : données d expression simulées (K gènes et I sujets) sujet 1 sujet 2 sujet 3 sujet 4... gène 1 gène 2 gène 3 gène 4 gène 5... Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 29 / 38

57 Résultats Plan de simulations Simulation de jeux de données E sim : données d expression simulées (K gènes et I sujets) T sim : information biologique simulée structure hiérarchique de GO part de l information biologique reliée étude & part non reliée Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 29 / 38

58 Résultats Simulation de l information biologique Jeu de données d expression simulée E sim sujet 1 sujet 2 sujet 3 sujet 4... gène 1 gène 2 gène 3 gène 4 gène 5... Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 30 / 38

59 Résultats Simulation de l information biologique Jeu de données d expression simulée E sim CAH sur les gènes de E sim sujet 1 sujet 2 sujet 3 sujet 4... gène 1 gène 2 gène 3 gène 4 gène 5... Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 30 / 38

60 Résultats Simulation de l information biologique Construction de l information biologique simulée T e sim gène 1 gène 2 gène 3 gène 4 gène 5 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 30 / 38

61 Résultats Simulation de l information biologique Construction de l information biologique simulée Tsim e A B C D D gène 1 B gène 2 A gène gène C gène Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 30 / 38

62 Résultats Simulation de l information biologique Tsim e : information biologique simulée à partir des données d expression simulées (E sim ) Introduction d information biologique aléatoire par permutations intra-colonnes de T e sim T r sim Obtention de T sim = [T e sim, r T r sim ] r : intensité aléatoire Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 31 / 38

63 Résultats Plan de simulations Simulation de jeux de données E sim : données d expression simulées T sim : information biologique simulée Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 32 / 38

64 Résultats Plan de simulations Simulation de jeux de données E sim : données d expression simulées T sim : information biologique simulée Comparaison clustering Heatmap clustering sur la base d un réseau de régulation (WGCNA, Zhang et Horvath, 2005) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 32 / 38

65 Résultats Plan de simulations Simulation de jeux de données E sim : données d expression simulées T sim : information biologique simulée Comparaison clustering Heatmap clustering sur la base d un réseau de régulation (WGCNA, Zhang et Horvath, 2005) Evaluation : proportion de clusters significatifs (CI et BHI) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 32 / 38

66 Résultats Simulations CI BHI Deux I K r H W I H W I H W I Intégration plus grande proportion de bons candidats à l interprétation Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 33 / 38

67 Résultats Application aux données à jeun/nourris I Coexpression I Homogénéité biologique Deux Heatmap WGCNA Integration Intégration plus grande proportion de bon candidats à l interprétation Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 34 / 38

68 Résultats Application aux données à jeun/nourris I Coexpression I Homogénéité biologique Deux Heatmap WGCNA Integration Intégration plus grande proportion de bon candidats à l interprétation Interprétation des clusters de gènes : ex phospolipides et sphingolipides Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 34 / 38

69 Résultats Conclusion Proportion satisfaisante de bons candidats à l interprétation Amélioration des tests d enrichissement (+ cohérence) Validation biologique plus poussée à faire Prise en compte incertitude sur les GO Prise en compte d autres types de données (tableaux multiples) Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 35 / 38

70 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 36 / 38

71 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 36 / 38

72 Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 36 / 38

73 Références I Emmanuel J. Candès, Carlos A. Sing-Long, and Joshua D. Trzasko, Unbiased risk estimates for singular value thresholding and spectral estimators, (Submitted), H. Caussinus, Models and uses of principal component analysis (with discussion), p , DSWO Press, C. Désert, MJ. Duclos, P. Blavy, F. Lecerf, F. Moreews, C. Klopp, M. Aubry, F. Herault, P. Le Roy, C. Berri, M. Douaire, C. Diot, and Lagarrigue S., Transcriptome profiling of the feeding-to-fasting transition in chicken liver, BMC Genomics (2008). Michael B. Eisen, Paul T. Spellman, Patrick O. Brown, and David Botstein, Cluster analysis and display of genome-wide expression patterns, Proceedings of the National Academy of Sciences 95 (1998), no. 25, Marie Verbanck, Julie Josse, and François Husson, Regularised PCA to denoise and visualise data, Statistics and Computing (submitted) (2013). Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 37 / 38

74 Références II Marie Verbanck, Sébastien Lê, and Jérôme Pagès, A new unsupervised gene clustering algorithm based on the integration of biological knowledge into expression data, BMC Bioinformatics 14 (2013), no. 1, 42 (en), Highly Accessed. Bin Zhang and Steve Horvath, A general framework for weighted gene co-expression network analysis, Statistical applications in genetics and molecular biology 4 (2005). Marie Verbanck Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure 38 / 38

Soutenance de stage Laboratoire des Signaux et Systèmes

Soutenance de stage Laboratoire des Signaux et Systèmes Soutenance de stage Laboratoire des Signaux et Systèmes Bornes inférieures bayésiennes de l'erreur quadratique moyenne. Application à la localisation de points de rupture. M2R ATSI Université Paris-Sud

Plus en détail

ProxiLens : Exploration interactive de données multidimensionnelles à partir de leur projection

ProxiLens : Exploration interactive de données multidimensionnelles à partir de leur projection ProxiLens : Exploration interactive de données multidimensionnelles à partir de leur projection Nicolas HEULOT (CEA LIST) Michaël AUPETIT (CEA LIST) Jean-Daniel FEKETE (INRIA Saclay) Journées Big Data

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

THÈSE / AGROCAMPUS OUEST

THÈSE / AGROCAMPUS OUEST N o ordre : 2013-16 N o série : G-11 THÈSE / AGROCAMPUS OUEST Sous le label de l Université Européenne de Bretagne pour obtenir le diplôme de : DOCTEUR DE L INSTITUT SUPÉRIEUR DES SCIENCES AGRONOMIQUES,

Plus en détail

Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6

Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6 Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6 Ludovic Denoyer 21 septembre 2015 Ludovic Denoyer () FDMS 21 septembre 2015 1 / 1 Contexte Observation La plupart des bonnes

Plus en détail

Classification Exemple : Enquête d opinion sur les OGM. Pauline Le Badezet Alexandra Lepage

Classification Exemple : Enquête d opinion sur les OGM. Pauline Le Badezet Alexandra Lepage Classification Exemple : Enquête d opinion sur les OGM Pauline Le Badezet Alexandra Lepage SOMMAIRE Introduction Méthodologie Méthode de partitionnement Classification Ascendante Hiérarchique Interprétation

Plus en détail

Analyse simultanée de variables quantitatives et qualitatives. à l aide de l analyse factorielle multiple

Analyse simultanée de variables quantitatives et qualitatives. à l aide de l analyse factorielle multiple Analyse simultanée de variables quantitatives et qualitatives à l aide de l analyse factorielle multiple Jérôme Pagès Laboratoire de mathématiques appliquées Agrocampus France Analyse Factorielle Multiple

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Analyse de la variance Comparaison de plusieurs moyennes

Analyse de la variance Comparaison de plusieurs moyennes Analyse de la variance Comparaison de plusieurs moyennes Biostatistique Pr. Nicolas MEYER Laboratoire de Biostatistique et Informatique Médicale Fac. de Médecine de Strasbourg Mars 2011 Plan 1 Introduction

Plus en détail

TABLE DES MATIÈRES. PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats. Pierre Dagnelie

TABLE DES MATIÈRES. PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats. Pierre Dagnelie PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats Pierre Dagnelie TABLE DES MATIÈRES 2012 Presses agronomiques de Gembloux pressesagro.gembloux@ulg.ac.be www.pressesagro.be

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Analyse de données longitudinales continues avec applications

Analyse de données longitudinales continues avec applications Université de Liège Département de Mathématique 29 Octobre 2002 Analyse de données longitudinales continues avec applications David MAGIS 1 Programme 1. Introduction 2. Exemples 3. Méthodes simples 4.

Plus en détail

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013 L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS Lorène Allano 16 Avril 2013 Question? Expert Aide à la décision Expériences Digitalisation Analyse automatique Visualisation Outils adapté Données numériques

Plus en détail

Gestion des données manquantes en Analyse en Composantes Principales

Gestion des données manquantes en Analyse en Composantes Principales Gestion des données manquantes en Analyse en Composantes Principales François Husson & Julie Josse Laboratoire de mathématiques appliquées, Agrocampus Rennes Bordeaux, 11 mars 2010 1 / 37 L'équipe d'agrocampus

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Intérêt du découpage en sous-bandes pour l analyse spectrale

Intérêt du découpage en sous-bandes pour l analyse spectrale Intérêt du découpage en sous-bandes pour l analyse spectrale David BONACCI Institut National Polytechnique de Toulouse (INP) École Nationale Supérieure d Électrotechnique, d Électronique, d Informatique,

Plus en détail

Analyse de données avec Complémentarité des méthodes d analyse factorielle et de classification

Analyse de données avec Complémentarité des méthodes d analyse factorielle et de classification Analyse de données avec Complémentarité des méthodes d analyse factorielle et de classification François Husson & Julie Josse Laboratoire de mathématiques appliquées Agrocampus Rennes husson@agrocampus-ouest.fr

Plus en détail

Filtrage stochastique non linéaire par la théorie de représentation des martingales

Filtrage stochastique non linéaire par la théorie de représentation des martingales Filtrage stochastique non linéaire par la théorie de représentation des martingales Adriana Climescu-Haulica Laboratoire de Modélisation et Calcul Institut d Informatique et Mathématiques Appliquées de

Plus en détail

Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques

Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques Département de Biostatistique Unité INSERM U900 Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques Eléonore GRAVIER 27 Mai 2010 15ème Journées des Statisticiens

Plus en détail

Introduction au cours STA 102 Analyse des données : Méthodes explicatives

Introduction au cours STA 102 Analyse des données : Méthodes explicatives Analyse des données - Méthodes explicatives (STA102) Introduction au cours STA 102 Analyse des données : Méthodes explicatives Giorgio Russolillo giorgio.russolillo@cnam.fr Infos et support du cours Slide

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Analyse de données avec R Complémentarité des méthodes d'analyse factorielle et de classification. 2 L'analyse de données avec R

Analyse de données avec R Complémentarité des méthodes d'analyse factorielle et de classification. 2 L'analyse de données avec R Analyse de données avec R Complémentarité des méthodes d'analyse factorielle et de classification François Husson, Julie Josse & Jérôme Pagès Laboratoire de mathématiques appliquées - 65 rue de St-Brieuc

Plus en détail

Biologie Intégrative Projet Fédérateur Biogenouest

Biologie Intégrative Projet Fédérateur Biogenouest Biologie Intégrative Projet Fédérateur Biogenouest Coordinateurs: C. Pineau (INSERM U625 & PF protéomique BGO) D. Eveillard (LINA Université de Nantes UMR CNRS 6241) Animateur: Y. Le Bras (Biogenouest)

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Le support de la formation est en ligne. http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php

Le support de la formation est en ligne. http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php Le support de la formation est en ligne http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php Recherche de gènes significatifs Sortir une liste de cibles sur 1 manip 1. Ouvrir le fichier de résultats

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Analyse des données individuelles groupées

Analyse des données individuelles groupées Analyse des données individuelles groupées Analyse des Temps de Réponse Le modèle mixte linéaire (L2M) Y ij, j-ième observation continue de l individu i (i = 1,, N ; j =1,, n) et le vecteur des réponses

Plus en détail

Clermont Ferrand - Janvier 2003

Clermont Ferrand - Janvier 2003 DISDAMIN: Algorithmes de Data Mining Distribués Valerie FIOLET (1,2) - Bernard TOURSEL (1) 1 Equipe PALOMA - LIFL - USTL - LILLE (FRANCE) 2 Service Informatique - UMH - MONS (BELGIUM) Clermont Ferrand

Plus en détail

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7 Table des matières Préface Public 1 Structure de l ouvrage 1 Caractéristiques de l ouvrage 3 Contenu 3 Pédagogie 4 Remarques sur l adaptation française 4 Ressources numériques 5 Biographie 6 PREMIÈRE PARTIE

Plus en détail

Prise en compte des données manquantes en ACP - imputation simple et multiple

Prise en compte des données manquantes en ACP - imputation simple et multiple Prise en compte des données manquantes en ACP - imputation simple et multiple Julie Josse Laboratoire de mathématiques appliquées, Agrocampus Ouest Jouy-en-Josas, 7 mars 2011 1 / 38 Laboratoire de mathématiques

Plus en détail

L analyse de variance à un critère de classification (ANOVA)

L analyse de variance à un critère de classification (ANOVA) Bio 041 L analyse de variance à un critère de classification (ANOVA) Pierre Legendre & Daniel Borcard, Université de Montréal Référence: Scherrer (007), section 14.1.1.1 et 14.1. 1 - Introduction Objectif:

Plus en détail

Module Mixmod pour OpenTURNS

Module Mixmod pour OpenTURNS Module Mixmod pour OpenTURNS Régis LEBRUN EADS Innovation Works 23 septembre 2013 EADS IW 2013 (EADS Innovation Work) 23 septembre 2013 1 / 21 Outline Plan 1 OpenTURNS et propagation d incertitudes 2 Mixmod

Plus en détail

Résume du cours de Mécanique Analytique

Résume du cours de Mécanique Analytique Résume du cours de Mécanique Analytique jean-eloi.lombard@epfl.ch 22 janvier 2009 Table des matières 1 Équations de Lagrange 1 1.1 Calcul des variations....................... 3 1.2 Principe de moindre

Plus en détail

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH

Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Approche par groupe de gènes pour les données longitudinales d expression génique avec une application dans un essai vaccinal contre le VIH Boris Hejblum 1,2,3 & Rodolphe Thiébaut 1,2,3 1 Inserm, U897

Plus en détail

Introduction à l analyse des données. Olivier Godechot

Introduction à l analyse des données. Olivier Godechot Introduction à l analyse des données Olivier Godechot Introduction. Les données statistiques : de très nombreuses variables. Aucune n est parfaite La perception d un phénomène appréhendée comme la combinaison

Plus en détail

Introduction à l approche bootstrap

Introduction à l approche bootstrap Introduction à l approche bootstrap Irène Buvat U494 INSERM buvat@imedjussieufr 25 septembre 2000 Introduction à l approche bootstrap - Irène Buvat - 21/9/00-1 Plan du cours Qu est-ce que le bootstrap?

Plus en détail

QUANTIFICATION DES EXAMENS ONCOLOGIQUES AU FLUORO-DÉOXYGLUCOSE EN TOMOGRAPHIE PAR ÉMISSION DE POSITONS

QUANTIFICATION DES EXAMENS ONCOLOGIQUES AU FLUORO-DÉOXYGLUCOSE EN TOMOGRAPHIE PAR ÉMISSION DE POSITONS Journées Jeunes Chercheurs d Aussois d - Décembre D 2003 U494 QUANTIFICATION DES EXAMENS ONCOLOGIQUES AU FLUORO-DÉOXYGLUCOSE OXYGLUCOSE EN TOMOGRAPHIE PAR ÉMISSION DE POSITONS Juliette FEUARDENT Thèse

Plus en détail

Agrégation des portefeuilles de contrats d assurance vie

Agrégation des portefeuilles de contrats d assurance vie Agrégation des portefeuilles de contrats d assurance vie Est-il optimal de regrouper les contrats en fonction de l âge, du genre, et de l ancienneté des assurés? Pierre-O. Goffard Université d été de l

Plus en détail

Extraction d informations stratégiques par Analyse en Composantes Principales

Extraction d informations stratégiques par Analyse en Composantes Principales Extraction d informations stratégiques par Analyse en Composantes Principales Bernard DOUSSET IRIT/ SIG, Université Paul Sabatier, 118 route de Narbonne, 31062 Toulouse cedex 04 dousset@irit.fr 1 Introduction

Plus en détail

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu BMM 1 Presentation Statistiques Multivariées pour la Bioinformatique Susan Holmes, Stanford, susan@stat.stanford.edu Specificités de cette classe Les données genetiques sont discretes: comptage. En general

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique DOMAINE P3.C3.D1. Pratiquer une démarche scientifique et technologique, résoudre des

Plus en détail

Outils Statistiques du Data Mining

Outils Statistiques du Data Mining Outils Statistiques du Data Mining Pr Roch Giorgi roch.giorgi@univ-amu.fr SESSTIM, Faculté de Médecine, Aix-Marseille Université, Marseille, France http://sesstim-orspaca.org http://optim-sesstim.univ-amu.fr

Plus en détail

Modélisation et Vérification des Réseaux de Régulations entre Gènes

Modélisation et Vérification des Réseaux de Régulations entre Gènes Modélisation et Vérification des Réseaux de Régulations entre Gènes Loïc Paulevé JDOC 2010-29 avril 2010 Directeur : Co-encadrant : Olivier Roux Morgan Magnin Laboratoire : IRCCyN, UMR CNRS 6597 Équipe

Plus en détail

Méthodes de Monte-Carlo Simulation de grandeurs aléatoires

Méthodes de Monte-Carlo Simulation de grandeurs aléatoires Méthodes de Monte-Carlo Simulation de grandeurs aléatoires Master Modélisation et Simulation / ENSTA TD 1 2012-2013 Les méthodes dites de Monte-Carlo consistent en des simulations expérimentales de problèmes

Plus en détail

Méthodes d apprentissage :

Méthodes d apprentissage : Méthodes d apprentissage : application au tri de complexes protéines-protéines Jérôme Azé Apprentissage: tâches Apprentissage non supervisé (Eisen, ) Apprentissage supervisé (arbres de décision, k-ppv,

Plus en détail

Anomalies chromosomiques et tumeurs d Ewing

Anomalies chromosomiques et tumeurs d Ewing Anomalies chromosomiques et tumeurs d Ewing Sylvain Blachon IRISA/INRIA Rennes - projet SITCON 21 Octobre 2008 Sylvain Blachon (IRISA/INRIA Rennes - projet SITCON) Anomalies chromosomiques et tumeurs d

Plus en détail

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Table des matières 1 Graph Kernels for Molecular Structure-Activity Relationship Analysis

Plus en détail

La classification automatique de données quantitatives

La classification automatique de données quantitatives La classification automatique de données quantitatives 1 Introduction Parmi les méthodes de statistique exploratoire multidimensionnelle, dont l objectif est d extraire d une masse de données des informations

Plus en détail

Cours de Statistiques

Cours de Statistiques Cours de Statistiques Romain Raveaux 1 1 Laboratoire L3I Université de La Rochelle romain.raveaux01 at univ-lr.fr Octobre 24-11, 2008 1 / 35 Sommaire 1 Quelques Rappels 2 numériques Relations entre deux

Plus en détail

Initiation à la fouille de données et à l apprentissage automatiq

Initiation à la fouille de données et à l apprentissage automatiq Initiation à la fouille de données et à l apprentissage automatique 1 Laboratoire d Informatique Fondamentale de Marseille Université de Provence christophe.magnan@lif.univ-mrs.fr www.lif.univ-mrs.fr/

Plus en détail

fonction processus biologiques criblage

fonction processus biologiques criblage Transcriptome 1 Transcriptome : ensemble des ARNm ou transcrits présents dans une population de cellules dans des conditions données. Plan Introduction Acquisition des données Description des données Transformation,

Plus en détail

Programmation linéaire

Programmation linéaire Programmation linéaire DIDIER MAQUIN Ecole Nationale Supérieure d Electricité et de Mécanique Institut National Polytechnique de Lorraine Mathématiques discrètes cours de 2ème année Programmation linéaire

Plus en détail

Atelier GEDSIP 2007. Gautier Bastide bastide@ensm-douai.fr. Abdelhak Seriai seriai@ensm. Mourad Oussalah oussalah@lina.univ

Atelier GEDSIP 2007. Gautier Bastide bastide@ensm-douai.fr. Abdelhak Seriai seriai@ensm. Mourad Oussalah oussalah@lina.univ 1 Atelier GEDSIP 2007 Gautier Bastide bastide@ensm-douai.fr douai.fr Ecole des Mines de Douai Abdelhak Seriai seriai@ensm ensm-douai.fr Ecole des Mines de Douai Mourad Oussalah oussalah@lina.univ lina.univ-nantes.frnantes.fr

Plus en détail

STATISTIQUES. UE Modélisation pour la biologie

STATISTIQUES. UE Modélisation pour la biologie STATISTIQUES UE Modélisation pour la biologie 2011 Cadre Général n individus: 1, 2,..., n Y variable à expliquer : Y = (y 1, y 2,..., y n ), y i R Modèle: Y = Xθ + ε X matrice du plan d expériences θ paramètres

Plus en détail

«Audio et vidéo surveillance intelligente»

«Audio et vidéo surveillance intelligente» «Audio et vidéo surveillance intelligente» Jérôme Besnard Miriad Charles Lehalle - Miriad Sébastien Ambellouis INRETS Le plan La problématique La plateforme expérimentale mise en place Un exemple de détecteur

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

Master 1 de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( 2014/2015) -

Master 1 de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( 2014/2015) - Dominique Ferrieux - Université Paul Valéry - Montpellier III Master de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( /) - Deuxième partie : Plans :

Plus en détail

Analyse factorielle des correspondances de Benzécri

Analyse factorielle des correspondances de Benzécri Analyse factorielle des correspondances de Benzécri One Pager Décembre 2013 Vol. 8 Num. 011 Copyright Laréq 2013 http://www.lareq.com Analyse Factorielle des Correspondances de Benzécri Une illustration

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Évaluation économique en santé publique

Évaluation économique en santé publique Lecture et appréciation d évaluations économiques réelles en santé publique ATELIER MÉTHODOLOGIQUE Préparé pour les Journées annuelles de santé publique 2005 Carole St-Hilaire, Ph.D. chercheure, AÉTMIS

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Probabilités. I- Expérience aléatoire, espace probabilisé : ShotGun. 1- Définitions :

Probabilités. I- Expérience aléatoire, espace probabilisé : ShotGun. 1- Définitions : Probabilités I- Expérience aléatoire, espace probabilisé : 1- Définitions : Ω : Ensemble dont les points w sont les résultats possibles de l expérience Des évènements A parties de Ω appartiennent à A une

Plus en détail

FONDEMENTS MATHÉMATIQUES 12 E ANNÉE. Mathématiques financières

FONDEMENTS MATHÉMATIQUES 12 E ANNÉE. Mathématiques financières FONDEMENTS MATHÉMATIQUES 12 E ANNÉE Mathématiques financières A1. Résoudre des problèmes comportant des intérêts composés dans la prise de décisions financières. [C, L, RP, T, V] Résultat d apprentissage

Plus en détail

TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers

TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers Principe Construction Techniques réalisables sur TMA Analyse des résultats: lecture Interprétation - Intégration des résultats Intérêts

Plus en détail

Recherche et qualité de l information scientifique Dr Caroline Fonzo-Christe Pharmacie des HUG

Recherche et qualité de l information scientifique Dr Caroline Fonzo-Christe Pharmacie des HUG Recherche et qualité de l information scientifique Dr Caroline Fonzo-Christe Pharmacie des HUG 21.02.2002 CONTEXTE Evolution des connaissances Evaluation de nouvelles approches thérapeutiques, de nouvelles

Plus en détail

Vision par ordinateur : Un tour d horizon. Adrien Bartoli LASMEA CNRS/UBP Clermont-Ferrand

Vision par ordinateur : Un tour d horizon. Adrien Bartoli LASMEA CNRS/UBP Clermont-Ferrand Vision par ordinateur : Un tour d horizon Adrien Bartoli LASMEA CNRS/UBP Clermont-Ferrand Séance II : Panoramas en environnement déformable Panoramas en environnement rigide Représentation minimale d un

Plus en détail

Générateur de Nombres Aléatoires

Générateur de Nombres Aléatoires Générateur de Nombres Aléatoires Les générateurs de nombres aléatoires sont des dispositifs capables de produire une séquence de nombres dont on ne peut pas tirer facilement des propriétés déterministes.

Plus en détail

Imputation multiple pour variables qualitatives par analyse des correspondances multiples

Imputation multiple pour variables qualitatives par analyse des correspondances multiples Imputation multiple pour variables qualitatives par analyse des correspondances multiples Vincent Audigier & François Husson & Julie Josse Laboratoire de mathématiques appliquées, Agrocampus Ouest 65 rue

Plus en détail

Méthodes statistiques pour l analyse de puce à ADN. Tristan Mary-Huard Institut National Agronomique Paris-Grignon

Méthodes statistiques pour l analyse de puce à ADN. Tristan Mary-Huard Institut National Agronomique Paris-Grignon Méthodes statistiques pour l analyse de puce à ADN Tristan Mary-Huard Institut National Agronomique Paris-Grignon 4 questions Comment récupérer un signal utilisable pour chaque gène? Normalisation Comment

Plus en détail

ANALYSE FACTORIELLE DE DONNÉES MIXTES : PRINCIPE ET

ANALYSE FACTORIELLE DE DONNÉES MIXTES : PRINCIPE ET ANALYSE FACTORIELLE DE DONNÉES MIXTES : PRINCIPE ET EXEMPLE D APPLICATION Jérôme Pagès Laboratoire de mathématiques appliquées Agrocampus, 35042 Rennes cedex email : pages@agrorennes.educagri.fr Résumé

Plus en détail

Enjeux mathématiques et Statistiques du Big Data

Enjeux mathématiques et Statistiques du Big Data Enjeux mathématiques et Statistiques du Big Data Mathilde Mougeot LPMA/Université Paris Diderot, mathilde.mougeot@univ-paris-diderot.fr Mathématique en Mouvements, Paris, IHP, 6 Juin 2015 M. Mougeot (Paris

Plus en détail

Axe MSA Bilan scientifique et perspectives. ENSM.SE L. Carraro - 17 décembre 07

Axe MSA Bilan scientifique et perspectives. ENSM.SE L. Carraro - 17 décembre 07 Axe MSA Bilan scientifique et perspectives ENSM.SE L. Carraro - 17 décembre 07 17 décembre 07 2 Plan Compétences acquises domaines scientifiques compétences transverses Domaines ou activités accessibles

Plus en détail

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population.

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population. Première STMG1 2014-2015 progression. - 1 Table des matières Fil rouge. 3 Axes du programme. 3 Séquence : Proportion d une sous population dans une population. 3 Information chiffrée : connaître et exploiter

Plus en détail

COURS DE STATISTIQUES (24h)

COURS DE STATISTIQUES (24h) COURS DE STATISTIQUES (24h) Introduction Statistiques descriptives (4 h) Rappels de Probabilités (4 h) Echantillonnage(4 h) Estimation ponctuelle (6 h) Introduction aux tests (6 h) Qu est-ce que la statistique?

Plus en détail

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription.

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Résumé de thèse de David Kieffer Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Dans le cadre de la lutte contre le cancer, l'entreprise Genclis (Genomic

Plus en détail

Analyse exploratoire de données

Analyse exploratoire de données Analyse exploratoire de données Françoise Fessant TECH/SUSI 28/09/2006 Sommaire Analyse exploratoire de données Cartes de kohonen Analyse des usages ADSL p2 Analyse exploratoire de données Construction

Plus en détail

Master IAD Module PS. Reconnaissance de la parole (suite) Modèles de Markov et bases de données. Gaël RICHARD Février 2008

Master IAD Module PS. Reconnaissance de la parole (suite) Modèles de Markov et bases de données. Gaël RICHARD Février 2008 Master IAD Module PS Reconnaissance de la parole (suite) Modèles de Markov et bases de données Gaël RICHARD Février 2008 1 Reconnaissance de la parole Introduction Approches pour la reconnaissance vocale

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Analyse de sensibilité pour données climatiques

Analyse de sensibilité pour données climatiques Analyse de sensibilité pour données climatiques Ronan Trépos (master 2 de Franck Boizard) 1 er octobre 2015 Collaborations : F. Boizard, R. Faivre, R. Trépos et pôle transverse du CATI IUMA (S. Roux, S.

Plus en détail

ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE

ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE Elisabeth Morand & Jérôme Pagès Agrocampus Rennes Laboratoire de mathématiques appliquées CS 425 3542 Rennes cedex Résumé Pour comparer deux nuages de points

Plus en détail

Utilisation d informations visuelles dynamiques en asservissement visuel Armel Crétual IRISA, projet TEMIS puis VISTA L asservissement visuel géométrique Principe : Réalisation d une tâche robotique par

Plus en détail

Le programme de mathématiques Classes de première STI2D STL

Le programme de mathématiques Classes de première STI2D STL Journée de l inspection 15 avril 2011 - Lycée F. BUISSON 18 avril 2011 - Lycée J. ALGOUD 21 avril 2011 - Lycée L. ARMAND Le programme de mathématiques Classes de première STI2D STL Déroulement de la journée

Plus en détail

Activité 1 : échantillonnage

Activité 1 : échantillonnage Activité échantillonnage, intervalle de fluctuation, prise de décision (à partir d un même thème) Les trois activités qui suivent s inspirent du document «ressources pour la classe de première générale

Plus en détail

Modélisation et analyse des structures des réseaux hydrographiques

Modélisation et analyse des structures des réseaux hydrographiques Modélisation et analyse des structures des réseaux hydrographiques Université des Sciences et Techniques du Languedoc Stage de Master Parcours : Fonctionnement des Ecosystèmes Naturels Et Cultivés Réalisé

Plus en détail

Simulation Examen de Statistique Approfondie II **Corrigé **

Simulation Examen de Statistique Approfondie II **Corrigé ** Simulation Examen de Statistique Approfondie II **Corrigé ** Ces quatre exercices sont issus du livre d exercices de François Husson et de Jérôme Pagès intitulé Statistiques générales pour utilisateurs,

Plus en détail

Indexation conceptuelle application au domaine biomédical. Mesures de similarité dans les ontologies. [Séminaire MIAD Montpellier SupAgro]

Indexation conceptuelle application au domaine biomédical. Mesures de similarité dans les ontologies. [Séminaire MIAD Montpellier SupAgro] [] Indexation conceptuelle application au domaine biomédical Mesures de similarité dans les ontologies Sylvie Ranwez Sébastien Harispe LGI2P de l école des mines d Alès équipe KID (Knowledge and Image

Plus en détail

Hélène Desmier ab, Pascale Kuntz a & Ivan Kojadinovic a. Pauc, 44306 Nantes. {prenom.nom}@polytech.univ-nantes.fr

Hélène Desmier ab, Pascale Kuntz a & Ivan Kojadinovic a. Pauc, 44306 Nantes. {prenom.nom}@polytech.univ-nantes.fr Une classification hiérarchique de variables discrètes basée sur l information mutuelle en pré-traitement d un algorithme de sélection de variables pertinentes. Hélène Desmier ab, Pascale Kuntz a & Ivan

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Analyse en composantes principales

Analyse en composantes principales Analyse en composantes principales Gilles Gasso, Stéphane Canu INSA Rouen - Département ASI Laboratoire LITIS 1 17 septembre 01 1. Ce cours est librement inspiré du cours DM de Alain Rakotomamonjy Gilles

Plus en détail

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p.

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p. STATISTIQUE THÉORIQUE ET APPLIQUÉE Tome 2 Inférence statistique à une et à deux dimensions Pierre Dagnelie TABLE DES MATIÈRES Bruxelles, De Boeck, 2011, 736 p. ISBN 978-2-8041-6336-5 De Boeck Services,

Plus en détail

STATISTIQUES. Cours I : Test d hypothèses. Télécom Physique Strasbourg Module 2101. Fabrice Heitz. Octobre 2014

STATISTIQUES. Cours I : Test d hypothèses. Télécom Physique Strasbourg Module 2101. Fabrice Heitz. Octobre 2014 Télécom Physique Strasbourg Module 2101 STATISTIQUES Cours I : Test d hypothèses Fabrice Heitz Octobre 2014 Fabrice Heitz (Télécom PS) Statistiques 2014 1 / 75 Cours I TESTS D HYPOTHÈSES Fabrice Heitz

Plus en détail

La rugosité arithmétique (Ra), la rugosité quadratique moyenne (Rq) et les normes Lα

La rugosité arithmétique (Ra), la rugosité quadratique moyenne (Rq) et les normes Lα WORKSHOP RUGOSITE Université de Poitiers 11 Octobre 27 La rugosité arithmétique (Ra), la rugosité quadratique moyenne (Rq) et les normes Lα François HENNEBELLE 1,3, Maxence BIGERELLE 2 et Thierry COOREVITS

Plus en détail

Graphes, réseaux et internet

Graphes, réseaux et internet Graphes, réseaux et internet Clémence Magnien clemence.magnien@lip6.fr LIP6 CNRS et Université Pierre et Marie Curie (UPMC Paris 6) avec Matthieu Latapy, Frédéric Ouédraogo, Guillaume Valadon, Assia Hamzaoui,...

Plus en détail

- Mobiliser les résultats sur le second degré dans le cadre de la résolution d un problème.

- Mobiliser les résultats sur le second degré dans le cadre de la résolution d un problème. Mathématiques - classe de 1ère des séries STI2D et STL. 1. Analyse On dote les élèves d outils mathématiques permettant de traiter des problèmes relevant de la modélisation de phénomènes continus ou discrets.

Plus en détail

LES MODÈLES DE PRÉVISIONS ÉCONOMIQUES. René GARCIA John GALBRAITH 17 juin 1999

LES MODÈLES DE PRÉVISIONS ÉCONOMIQUES. René GARCIA John GALBRAITH 17 juin 1999 LES MODÈLES DE PRÉVISIONS ÉCONOMIQUES René GARCIA John GALBRAITH 17 juin 1999 1 GESTION INTÉGRÉE DES RISQUES HYDRO-QUÉBEC 17 juin 1999 Prévisions économiques utilisées pour le modèle financier de Hydro-Québec

Plus en détail

Analyse des réseaux sociaux et apprentissage

Analyse des réseaux sociaux et apprentissage Analyse des réseaux sociaux et apprentissage Emmanuel Viennet Laboratoire de Traitement et Transport de l Information Université Paris 13 - Sorbonne Paris Cité Réseaux sociaux? Réseaux sociaux? Analyse

Plus en détail

ALGORITHMES POUR LA VISUALISATION SCIENTIFIQUE

ALGORITHMES POUR LA VISUALISATION SCIENTIFIQUE BAZEILLE Stéphane MOUGEL Baptiste IUP3 ALGORITHMES POUR LA VISUALISATION SCIENTIFIQUE EN Année 2003/2004 1 TABLE DES MATIERES Home... 3 Introduction.... 3 Marching Square... 4 Algorithme....4 Programmation...4

Plus en détail