Maladies communes (multifactorielles)

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Maladies communes (multifactorielles)"

Transcription

1 Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement (alimentaire, cigarette, infection, stress ) Ex : Maladies métaboliques diabète de type 1 T1DM diabète de type 2 T2DM Maladies neurologiques sclérose en plaque MS maladie de Parkinson PD maladie d Alzheimer AD Maladies psychiatriques schizophrénie Maladies vasculaires hypertension artérielle Maladies articulaires polyarthrite rhumatoïde RA Maladies infectieuses! prédisposition à la lèpre

2 Facteurs génétiques et environnementaux Génétique Environnement Principes de génétique humaine Josué Feingold, Marc Fellous, Michel Solignac Hermann éditeurs

3 Feingold et al Variations du risque en fonction du génotype

4 Récurrence familiale dans quelques maladies communes Risque Relatif (RR) = Odds Ratio (OD) = λs Feingold et al

5 Comment identifier les gènes et les allèles responsables de cette augmentation du risque relatif? 1. Etudes familiales (analyse de liaison) Grandes familles «monogéniques» : méthode paramétrique Petites familles : méthode non paramétrique : Etude des cousins germains (sib-pairs) 2. Etudes d association Etudes cas-témoins comparaison de fréquence allélique ou fréquence génotypes (aa/aa/aa) (pour test effet récessif, dominant ou additif) Dans population générale ou population ± «isolée» (islande, finlande, juifs ashkenaze, villages de montagne ) avec éventuels effets fondateurs

6 1. Méthode des germains atteints (sib-pairs) ? Probabilité à priori (si parents informatifs = IBD) 2 allèles communs (1 2) allèle commun (1 4 ou 2 3) allèle commun (3 4) 0.25 IBD: Identity by descent; IBS: Identity by state (si parents non typés ou non informatifs)

7 Méthode des germains atteints χ 2 = Σ (O - A) 2 A Déterminer la valeur du p d après la distribution du χ 2 Feingold et al

8 Locus de susceptibilité à la lèpre Etude «Genome Wide» Mira et al. Nature Genetics, 2003 Les patients étudiés : 86 familles 205 patients (90 paucibacillaires, 115 multibacillaires)

9 Locus de susceptibilité à la lèpre 20 microsatellites de la région 6q25-27 Mira et al. Nature Genetics, 2003

10 2. Etudes d association Etudes cas-témoins Comparaison de fréquence allélique ou fréquence génotypes (aa/aa/aa) (pour test effet récessif, dominant ou additif) Hypothèse d un effet fondateur risque relatif et risque attribuable : Risque = p(m) Risque relatif RR = p(m)f+/p(m)f- (f+; f-: facteur de risque présent ou absent) Risque attribuable défini au niveau de population: proportion de cas imputables au facteur de risque RA= f(rr-1)/1+ f(rr-1) f=fréquence allèle

11 Etudes d association Gène(s) ou allèles candidats Région candidate Whole genome association study (GWAS) : possible que depuis 2005

12 Etude d association; interprétation de résultat positif (= statistiquement significatif) Allèle est directement impliqué dans risque pathologique: nécessite test fonctionnel Exemple: Maladie d Alzheimer

13 Formes monogéniques de la maladie d Alzheimer Très rares (moins de 1 pour mille), plaques amyloïdes Autosomique dominant, début précoce 4 gènes (multigénique) : APP, préséniline 1, préséniline 2, (TREM2) Forme multifactorielle de la maladie d Alzheimer Début tardif, plaques amyloïdes Touche environ 10% de la population à 85 ans

14 Forme multifactorielle de la maladie d Alzheimer Gène de prédisposition : ApoE Allèles : Apo ε4 arg arg Apo ε3 cys arg Apo ε2 cys cys 17 % 73 % 10 % Fréquence des génotypes ε4 homozygote : 0,17 x 0,17 0,03 (3 %) ε4 hétérozygote : 2 x 0,17 x 0,83 0,28 (28 %) ε2 ou ε3 (pas ε4) : 0,83 x 0,83 0,69 (69 %)

15 Risque relatif de l allèle ε4 pour la maladie d Alzheimer : génotype patients % contrôles % risque relatif RR ε4 ε4 ou ε3 ε x 3,1 26 ε4 ε x 7,7 ε3 ε x 2,6 ε2 ou ε3 (pas ε4) risque attribuable RA (%) Incidence de la maladie vers 85 ans 10% 0,1 x 0,14 0,1 x 0,44 RR homoz =. 0,03. = 7,7 RR hétéroz =. 0,28. = 2,6 0,1 x 0,42 0,69 0,1 x 0,42 0,69

16 Risque relatif de l allèle ε4 pour la maladie d Alzheimer : génotypes (fréq.) RR risque à 85 ans ε4 ε4 (3 %) 7,7 x 44 % ε3 ε4 (28 %) 2,6 x 16 % ε2 ou ε3 (69 %) 1 x 6 %

17 Estimation de la prévalence de démence DSM-III-R (Alzheimer) selon l âge et le génotype ApoE e4

18 Etude d association; interprétation de résultat positif (= statistiquement significatif) Allèle est directement impliqué dans risque pathologique: nécessite test fonctionnel Allèle est en déséquilibre de liaison avec allèle proche impliqué fonctionnellement dans risque : nécessite étude par séquençage de l haplotype à risque, éventuellement dans différentes populations

19 Déséquilibre de liaison et haplotype Emergence de variation au cours de l évolution Variations dans les chromosomes dans une population. Adam et mutation Eve Temps présent

20 Evolution de longueur de région commune chez des patients, autour d une mutation ou variant à risque 1 ère G 2 ème G 10 ème G 50 ème G 100 ème G M ou VR 40Mb 25Mb 2-3Mb 0.5Mb 0.2Mb M: mutation VR: variant à risque

21 Association entre la lèpre et 81 SNPs de la région candidate (2 Mb) Mira et al, Nature, 2004

22 Mira et al, Nature, 2004

23 Y a t il d autres gènes et allèles responsables de l augmentation du risque relatif dans la maladie d Alzheimer? Whole genome association study (GWAS) Polymorphismes en déséquilibre de liaison avec allèle proche impliqué fonctionnellement dans risque

24 GWAS 2009 Maladie d Alzheimer, Harold et al Nat. Genet. 2009

25 GWAS 2009 Maladie d Alzheimer, Harold et al Nat. Genet SNPs showing genome-wide significant association with AD in stage 1 of the GWAS.

26 Etude d association; interprétation de résultat positif (= statistiquement significatif) Allèle est directement impliqué dans risque pathologique: nécessite test fonctionnel Allèle est en déséquilibre de liaison avec allèle proche impliqué fonctionnellement dans risque Mauvais choix des témoins, artefact lié à une stratification de la population étudiée Faux positif (type 1 error) (signification de p 0,01 ), problème capital des tests multiples (emploi correction de Bonferroni ou autres tests) et biais de publication de résultats positifs: nécessite études de réplication

27 Nature Genetics, 2003

28 Variants rares, polymorphismes communs Les stratégies «whole genome association» sont basées sur l hypothèse: maladie commune, facteur génétique de risque fréquent dans la population (common disease/ common variant); dans ces cas le risque relatif est rarement supérieur à 2. Mais étude de maladies monogéniques suggère que variants individuellement rares peuvent avoir effets important sur le risque Variant fr 1/10, RR2: risque attribuable = 9% Variant fr 1/1000, RR10: RA = 1% 2ème cas: variant plus important pour l individu, mais peu contributif pour la population

29 Variants génétiques et maladies rares ou communes

30 Maladie de Parkinson corps de Levy dans la substantia nigra Touche environ 3% de la population à 80 ans Formes monogéniques, début précoce Au moins 5 gènes connus, expliquent 3% des cas Formes Dominantes présence de corps de Lévy - PARK1, PARK4 α-synucléine - PARK8 LRRK2 Formes Récessives absence de corps de Lévy - PARK2 parkine - PARK6 PINK1 - PARK7 DJ-1 Forme multifactorielle, début vers ans, corps de Levy Antécédents familiaux chez 15 % des patients > RR 5

31 Variants rares, maladies communes Un concept émergent Maladie de Parkinson glucocérébrosidase (GBA) (mutations homozygotes > maladie de Gaucher) Gan-Or et al. Neurology 2008 : Mutations modérées (N370S, R496H) et sévères (84insGG, IVS2 + 1, V394L, D409H, L444P, RecTL) mutations perte de fonction. Risque relatif des mutations GBA hétérozygotes génotype mutations hétérozygotes pas de mutation patients % contrôles % risque relatif RR 17,9 6,3 x 3,2 16% 82,1 93,7 risque attribuable RA (%) 0,03 x 0,179 RR hétéroz =. 0,063. 0,03 x 0,821 0,937 = 3,2 Neumann et al. Brain 2009

32 CONCLUSIONS: Identifier les variants rares des maladies communes > séquençage à haut débit séquencer un génome humain pour $ Progrès dans l interprétation, et surtout dans les applications éventuelles seront beaucoup plus lents et progressifs, et limités par la complexité des facteurs de risque

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Du malade au gène: aléas de la recherche appliquée

Du malade au gène: aléas de la recherche appliquée UNITE DE GENETIQUE MEDICALE UNIVERSITE SAINT-JOSEPH Du malade au gène: aléas de la recherche appliquée Eliane CHOUERY KHOURY Journées de la recherche à l USJ La publication académique: moyens et enjeux

Plus en détail

Chapitre III Les anomalies de la régulation de la glycémie

Chapitre III Les anomalies de la régulation de la glycémie Chapitre III Les anomalies de la régulation de la glycémie -I -Unité et diversité des diabètes Mesures de la glycémie en continu chez un patient diabétique 1 Les critères de diagnostic du diabète 2 3 Conclusion

Plus en détail

LA MALADIE D ALZHEIMER 1980-2010: APPORT DE L ÉPIDÉMIOLOGIE

LA MALADIE D ALZHEIMER 1980-2010: APPORT DE L ÉPIDÉMIOLOGIE LA MALADIE D ALZHEIMER 1980-2010: APPORT DE L ÉPIDÉMIOLOGIE Annick Alpérovitch DR Emérite Inserm Université Pierre et Marie Curie - Inserm U708 «Neuroépidémiologie» LES GRANDES LIGNES DE CE TOUR D HORIZON

Plus en détail

MSBM de Génétique. Recherche des facteurs génétiques impliqués dans les maladies fréquentes. 17 avril 2014. Dr Gaëtan Lesca / Pr Pascal Roy

MSBM de Génétique. Recherche des facteurs génétiques impliqués dans les maladies fréquentes. 17 avril 2014. Dr Gaëtan Lesca / Pr Pascal Roy MSBM de Génétique Recherche des facteurs génétiques impliqués dans les maladies fréquentes 17 avril 2014 Dr Gaëtan Lesca / Pr Pascal Roy PLAN DU COURS 1. Définitions, rappel sur les maladies monogéniques

Plus en détail

4 ème réunion du réseau «Epidémiologie génétique» du GIRCI Grand Ouest

4 ème réunion du réseau «Epidémiologie génétique» du GIRCI Grand Ouest 4 ème réunion du réseau «Epidémiologie génétique» du GIRCI Grand Ouest Vendredi 9 janvier 2015 TOURS Epidémiologie génétique Epidémiologie Distribution des maladies dans les populations Génétique des populations

Plus en détail

Vulnérabilité, résilience à la dépression : gènes et/ou environnement?

Vulnérabilité, résilience à la dépression : gènes et/ou environnement? Vulnérabilité, résilience à la dépression : gènes et/ou environnement? Professeur Alain Malafosse CHU et Université de Genève alain.malafosse@hcuge.ch Hyman, Nature, 2008 Caspi et al., Nature Reviews Neuroscience,

Plus en détail

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement.

Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Chapitre 3. La complexité des relations entre gènes, phénotypes et environnement. Les gènes gouvernent la synthèse des protéines qui participent à la réalisation du phénotype mais d'autres éléments, comme

Plus en détail

COURS 10 : Génétique des Maladies Multifactorielles

COURS 10 : Génétique des Maladies Multifactorielles UE5: Génétique Médicale 10/12/13 8h30 à 10h30 Stéphanie Debette RT: Aude Renaud RF: Zahra Rahnema COURS 10 : Génétique des Maladies Multifactorielles Ronéo 11 1 I. Utilisation des connaissances des Maladies

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

Utilisation des outils de mesure de la performance des analyses de laboratoire

Utilisation des outils de mesure de la performance des analyses de laboratoire Utilisation des outils de mesure de la performance des analyses de laboratoire Christiane Claessens Laboratoire de santé publique du Québec 24 octobre 2006 Surprise! Un test de laboratoire 100% précis

Plus en détail

Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer

Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer Recherche d associations haplotypiques dans le cadre de la maladie d Alzheimer Benjamin Grenier-Boley UMR744 - Santé publique et épidémiologie 17/05/2011 Benjamin Grenier-Boley, IPL Recherche d associations

Plus en détail

aux maladies autoimmunes

aux maladies autoimmunes Facteurs de susceptibilité génétique aux maladies autoimmunes Maladies autoimmunes (épidémiologie) Incidence Pé Prévalence tteinte t féminine i (100.000 pers/an) (100.000) (%) ddison 06 0.6 14 93 Diabète

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Prédispositions génétiques aux cancers du sein en 2013 quels gènes impliqués? Dominique Stoppa-Lyonnet Institut Curie, Université Paris Descartes

Prédispositions génétiques aux cancers du sein en 2013 quels gènes impliqués? Dominique Stoppa-Lyonnet Institut Curie, Université Paris Descartes Prédispositions génétiques aux cancers du sein en 2013 quels gènes impliqués? Dominique Stoppa-Lyonnet Institut Curie, Université Paris Descartes 1 - Estimation du risque individuel de cancer du sein :

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Docteur José LABARERE

Docteur José LABARERE UE7 - Santé Société Humanité Risques sanitaires Chapitre 3 : Epidémiologie étiologique Docteur José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Métabolisme du fer : hepcidine Fer absorbé par les entérocytes des villosités duodénales : transporteur

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

La maladie d Alzheimer: un carrefour de déterminations génétiques et de risques environnementaux

La maladie d Alzheimer: un carrefour de déterminations génétiques et de risques environnementaux La maladie d Alzheimer: un carrefour de déterminations génétiques et de risques environnementaux Philippe van den Bosch de Aguilar Institut des Sciences de la Vie Université Catholique de Louvain Le vieillissement

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Points méthodologiques Adapter les méthodes statistiques aux Big Data

Points méthodologiques Adapter les méthodes statistiques aux Big Data Points méthodologiques Adapter les méthodes statistiques aux Big Data I. Répétition de tests et inflation du risque alpha II. Significativité ou taille de l effet? 2012-12-03 Biomédecine quantitative 36

Plus en détail

RAPPELS DES CRITERES MOTIVANT UNE CONSULTATION D ONCOGENETIQUE. Pr Y.-J. BIGNON Département d'oncogénétique Centre Jean Perrin 63000 CLERMONT-FERRAND

RAPPELS DES CRITERES MOTIVANT UNE CONSULTATION D ONCOGENETIQUE. Pr Y.-J. BIGNON Département d'oncogénétique Centre Jean Perrin 63000 CLERMONT-FERRAND RAPPELS DES CRITERES MOTIVANT UNE CONSULTATION D ONCOGENETIQUE Pr Y.-J. BIGNON Département d'oncogénétique Centre Jean Perrin 63000 CLERMONT-FERRAND Le cancer du sein 1 000 000 nouveaux cas par an dans

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

LE DIABETE DANS LES DEPARTEMENTS D OUTRE MER CARACTERISTIQUES

LE DIABETE DANS LES DEPARTEMENTS D OUTRE MER CARACTERISTIQUES LE DIABETE DANS LES DEPARTEMENTS D OUTRE MER CARACTERISTIQUES PREVENTION SOMMAIRE EPIDEMIOLOGIE La prévalence du diabète traité est estimée en 2009 à 4,4 % de la population résidant en France soit 3 millions

Plus en détail

Conclusions diabète, déclin cognitif, démences, maladie d'alzheimer et bénéfice expérimental des anticalciques et clinique des glitazones: 11-12

Conclusions diabète, déclin cognitif, démences, maladie d'alzheimer et bénéfice expérimental des anticalciques et clinique des glitazones: 11-12 Diabète et démences Plan: diabète et démences - données anatomo-pathologiques: 3 - diabète et troubles cognitifs: 4 - risque de démences et maladie d'alzheimer: 5-7 - prédiabète, HTA du diabétique et démences:

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Cholestérol. Précautions de prélèvement. Valeurs usuelles. Clinique. Cholestérol total. HDL-cholestérol. LDL-cholestérol. Hypocholestérolémies

Cholestérol. Précautions de prélèvement. Valeurs usuelles. Clinique. Cholestérol total. HDL-cholestérol. LDL-cholestérol. Hypocholestérolémies Cholestérol 89 Cholestérol L hypercholestérolémie est un facteur de risque d athérosclérose comme l ont établi de grandes enquêtes épidémiologiques. Dans le sang, le cholestérol est transporté par des

Plus en détail

Article. «Maladies multifactorielles : un cauchemar pour le généticien» Josué Feingold. M/S : médecine sciences, vol. 21, n 11, 2005, p. 927-933.

Article. «Maladies multifactorielles : un cauchemar pour le généticien» Josué Feingold. M/S : médecine sciences, vol. 21, n 11, 2005, p. 927-933. Article «Maladies multifactorielles : un cauchemar pour le généticien» Josué Feingold M/S : médecine sciences, vol. 21, n 11, 2005, p. 927-933. Pour citer cet article, utiliser l'information suivante :

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Maladie de Gaucher. Génétique et Marqueurs. Dr Catherine CAILLAUD. Laboratoire de Biochimie Génétique, Hôpital Cochin, Paris

Maladie de Gaucher. Génétique et Marqueurs. Dr Catherine CAILLAUD. Laboratoire de Biochimie Génétique, Hôpital Cochin, Paris Maladie de Gaucher Génétique et Marqueurs Dr Catherine CAILLAUD Laboratoire de Biochimie Génétique, Hôpital Cochin, Paris Maladie de Gaucher Mode de transmission : récessif autosomique - risque de récidive

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Octobre 2014 Médecine «génomique» personnalisée La médecine «génomique» personnalisée repose sur l identification de sous-groupes de

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Facteurs de risque vasculaire et maladie d Alzheimer: Focus sur l HTA

Facteurs de risque vasculaire et maladie d Alzheimer: Focus sur l HTA Facteurs de risque vasculaire et maladie d Alzheimer: Focus sur l HTA Thomas Vogel Praticien Hospitalier Pôle de Gériatrie Hôpitaux Universitaires de Strasbourg Contexte 855 000 personnes concernées par

Plus en détail

Quelle est votre attitude? Quel objectif glycémique souhaitez vous? Quelle surveillance proposez vous?

Quelle est votre attitude? Quel objectif glycémique souhaitez vous? Quelle surveillance proposez vous? Mme SE...V. Agée de 42 ans. Antécédents familiaux : père - mère obèse, tante parternelle diabétique. Rh - 1 ère grossesse 33 ans (1990) Accouchement par voie basse, compliqué, ventouse, dystocie d épaule,

Plus en détail

MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE

MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE Forum HH 05.02.2013 Ghislaine Gagnon Unité HPCI Qualitatif ou quantitatif? Les 2 méthodes peuvent être utilisées séparément ou en conjonction - le qualitatif

Plus en détail

ADN ADN. "Tests génétiques, mythes et réalités" ADN dans la cellule. Tests génétiques : mythes et réalités. Application médicom

ADN ADN. Tests génétiques, mythes et réalités ADN dans la cellule. Tests génétiques : mythes et réalités. Application médicom "Tests génétiques, mythes et réalités" Docteur Romano La Harpe Institut de médecine légale Unité de médecine forensique Tests génétiques : ADN mythes et réalités Application médicalem Application médicom

Plus en détail

Optimisation de données de génotypage SNP pour les études d association

Optimisation de données de génotypage SNP pour les études d association Optimisation de données de génotypage SNP pour les études d association Gènes candidats et caractères quantitatifs Bertrand Servin INRA - UMR de Génétique Cellulaire Université de Washington - Département

Plus en détail

Les dix points clés de la lecture critique. Michel Cucherat UMR 5558 - Lyon

Les dix points clés de la lecture critique. Michel Cucherat UMR 5558 - Lyon Les dix points clés de la lecture critique Michel Cucherat UMR 5558 - Lyon Point 1 Interpréter les résultats pour décider But de la lecture critique : Juger de la validité scientifique (fiabilité du résultat)

Plus en détail

Anomalies observées avant la naissance associées aux mutations HNF1B

Anomalies observées avant la naissance associées aux mutations HNF1B Anomalies observées avant la naissance associées aux mutations HNF1B Laurence Heidet Centre de Référence des Maladies Rénales Héréditaires de l Enfant et de l Adulte. Service de Néphrologie Pédiatrique

Plus en détail

Profil d expression des micro ARNs hépatiques associés à la réponse virologique prolongée chez des patients atteints d hépatite chronique C

Profil d expression des micro ARNs hépatiques associés à la réponse virologique prolongée chez des patients atteints d hépatite chronique C Profil d expression des micro ARNs hépatiques associés à la réponse virologique prolongée chez des patients atteints d hépatite chronique C E. Estrabaud 1, I. Bièche 2, M. Lapalus 1, S. de Muynck 1, M.

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

GENETIQUE DES POPULATIONS

GENETIQUE DES POPULATIONS GENETIQUE DES POPULATIONS Etudie La distribution des gènes à l intérieur des populations Les facteurs qui maintiennent ou modifient la fréquence des gènes ou des génotypes d une génération à une autre

Plus en détail

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007.

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007. Recherche des causes génétiques de génodermatoses chez le chien Catherine André CNRS André Eric Guaguere Lille Emmanuel Bensignor Rennes Mathieu Heuzé Thè Heuzé Thèse vé vétérinaire Guillaume Queney, Queney,

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

THESE. Docteur de l Université Toulouse III

THESE. Docteur de l Université Toulouse III UNIVERSITE PAUL SABATIER - TOULOUSE III U.F.R. Sciences de la Vie et de la Terre Ecole Doctorale Biologie Santé Biotechnologies THESE Pour obtenir le grade de Docteur de l Université Toulouse III Discipline

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

3 e journée recherche de la SFTG 8 février 2014. G. Blanc-Garin, E. Dania-Jambu, M. Plantureux, A-L Parant, A. Simavonian, R. Sourzac, H.

3 e journée recherche de la SFTG 8 février 2014. G. Blanc-Garin, E. Dania-Jambu, M. Plantureux, A-L Parant, A. Simavonian, R. Sourzac, H. Apport d un système d exceptions dans la mesure des indicateurs de la ROSP : Exemple des indicateurs concernant le diabète, l hypertension artérielle, les benzodiazépines et les statines 3 e journée recherche

Plus en détail

SBI3U Épreuve Génétique Nom:

SBI3U Épreuve Génétique Nom: SBI3U Épreuve Génétique Nom: PARTIE A (15) (Connaissances et compréhension) Inscrire la bonne réponse sur la carte SCANTRON 1. Une femme porteuse du gène d hémophilie et un homme hémophile sont croisés.

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Son importance 3% des grossesses : problème génétique g Individus de moins de 25 ans: 1/20 des pathologies est d origine d génétique g Différents types de maladies

Plus en détail

Quelle valeur accorder aux prédictions de risques pour les maladies multifactorielles?

Quelle valeur accorder aux prédictions de risques pour les maladies multifactorielles? Quelle valeur accorder aux prédictions de risques pour les maladies multifactorielles? Texte émanant de la Société Française de Génétique Humaine*. *Ce texte est le résultat du travail de réflexion et

Plus en détail

Les accidents vasculaires cérébraux (AVC) et la sclérose en plaques (SEP) : deux affections pourvoyeuses de handicap en Neurologie

Les accidents vasculaires cérébraux (AVC) et la sclérose en plaques (SEP) : deux affections pourvoyeuses de handicap en Neurologie Les accidents vasculaires cérébraux (AVC) et la sclérose en plaques (SEP) : deux affections pourvoyeuses de handicap en Neurologie M. Benabdeljlil, S. Aïdi, M. El Alaoui Faris Service de Neurologie A et

Plus en détail

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900.

2 ) LE SYSTEME ABO : Le système de groupes érythrocytaires (= premier groupe tissulaire) a été découvert grâce aux travaux de Landsteiner en 1900. 04.01.00. GROUPES SANGUINS Dr Deschamps 1 ) DEFINITION : a) Groupe : Ensemble d individus qui ont un caractère en commun et se distinguent ainsi des autres. b) Sanguin : Concerne une cellule ou une molécule

Plus en détail

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

Diagnostic des patientes à risque de cancer du sein 1

Diagnostic des patientes à risque de cancer du sein 1 Diagnostic des patientes à risque de cancer du sein 1 D. Stoppa-Lyonnet, M. Gauthier-Villars, I. Coupier, P. This et N. Andrieu Introduction L estimation du risque de cancer du sein a reposé jusqu au début

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

STRATÉGIES À L ESSAI POUR PRÉVENIR LA MALADIE D ALZHEIMER

STRATÉGIES À L ESSAI POUR PRÉVENIR LA MALADIE D ALZHEIMER STRATÉGIES À L ESSAI POUR PRÉVENIR LA MALADIE D ALZHEIMER Serge Gauthier, MD, FRCPC Centre McGill d études sur le vieillissement Institut universitaire en santé mentale Douglas CONTENU Stades de la maladie

Plus en détail

Emergence de la Sclérose en plaques aux Antilles Françaises. Service de neurologie Fort de France

Emergence de la Sclérose en plaques aux Antilles Françaises. Service de neurologie Fort de France Emergence de la Sclérose en plaques aux Antilles Françaises Service de neurologie Fort de France Epidémiologie INCIDENCE SEP ET NMO AUX ANTILLES FRANCAISES Periode Population SEP Cas Taux IC 95% NMO Cas

Plus en détail

Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique

Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique Le déficit en Proteine Kinase C-δ une nouvelle cause de Lupus Erythémateux Systémique Alexandre Belot, MD, PhD Service de Néphrologie, Rhumatologie, Dermatologie Pédiatriques Hôpital Femme Mère Enfant

Plus en détail

PREMIÈRE PARTIE Vieillissement progressif et vieillesse harmonieuse Introduction... 25

PREMIÈRE PARTIE Vieillissement progressif et vieillesse harmonieuse Introduction... 25 SOMMAIRE Avant-propos... 15 Introduction générale. Présentation de la méthode de «causalité»... 19 PREMIÈRE PARTIE Vieillissement progressif et vieillesse harmonieuse Introduction... 25 CHAPITRE I Nous

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Projet de mesure d indicateurs de qualité à. du groupe de médecine de famille (GMF) Montmagny. Jean-François Rancourt md 27 novembre 2012 2011 JASP

Projet de mesure d indicateurs de qualité à. du groupe de médecine de famille (GMF) Montmagny. Jean-François Rancourt md 27 novembre 2012 2011 JASP Projet de mesure d indicateurs de qualité à partir d un dossier médical électronique (DME) du groupe de médecine de famille (GMF) Montmagny Jean-François Rancourt md 27 novembre 2012 2011 JASP Début connaissance

Plus en détail

AOMI, IPS et rigidité de l aorte A.SALAHMANSOUR, L.IDIR, K.ABERKANE, M.BENSEDIK, A.HOUCHI, S.OUERDANE

AOMI, IPS et rigidité de l aorte A.SALAHMANSOUR, L.IDIR, K.ABERKANE, M.BENSEDIK, A.HOUCHI, S.OUERDANE AOMI, IPS et rigidité de l aorte A.SALAHMANSOUR, L.IDIR, K.ABERKANE, M.BENSEDIK, A.HOUCHI, S.OUERDANE Congrès SAMEV 2010 L artériopathie oblitérante des membres inférieurs Complication fréquente et redoutable

Plus en détail

23. Interprétation clinique des mesures de l effet traitement

23. Interprétation clinique des mesures de l effet traitement 23. Interprétation clinique des mesures de l effet traitement 23.1. Critères de jugement binaires Plusieurs mesures (indices) sont utilisables pour quantifier l effet traitement lors de l utilisation d

Plus en détail

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine Recherche et médecine personnalisée : le point de vue de l oncogénéticien Dr Dugast catherine cc Dépistage de masse K sein chez mère 60 ans, nulliparité? Antécédent de hodgkin à 15 ans???? Quel est mon

Plus en détail

Clonage Positionnel. Positionnement des gènes de prédisposition dans le génome humain (ou le génome de la souris, modèle d une maladie humaine)

Clonage Positionnel. Positionnement des gènes de prédisposition dans le génome humain (ou le génome de la souris, modèle d une maladie humaine) Clonage Positionnel Positionnement des gènes de prédisposition dans le génome humain (ou le génome de la souris, modèle d une maladie humaine) Génétique classique vs Clonage positionnel Positional Cloning

Plus en détail

La prise en charge des personnes atteintes d une

La prise en charge des personnes atteintes d une Les affections de longue durée Les aspects économiques des affections de longue durée Les dépenses de soins des 12 % d assurés bénéficiant de la prise en charge en ALD représentent 60 % des remboursements

Plus en détail

25ème colloque CORATA-IBS La Rochelle 21 au 23 mai 2008

25ème colloque CORATA-IBS La Rochelle 21 au 23 mai 2008 25ème colloque CORATA-IBS La Rochelle 21 au 23 mai 2008 Session : Nouveaux marqueurs Marqueurs biologiques de la maladie d Alzheimer Partie 1 : Partie 2 : Partie 3 : Partie 4 : Généralités sur la maladie

Plus en détail

Un test d association génétique pour la détection de regroupements de variants rares liés à une pathologie

Un test d association génétique pour la détection de regroupements de variants rares liés à une pathologie Un test d association génétique pour la détection de regroupements de variants rares liés à une pathologie 14 décembre 2015 Elodie PERSYN*, Lise BELLANGER**, Christian DINA*, Richard REDON* *Institut du

Plus en détail

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Chapitre 5 UE4 : Biostatistiques Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière.

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière. Génome humain Polymorphismes Marqueurs génétiques Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière Génome humain Génome Humain () Homme Cellules Noyaux 46 Chromosomes Protéines Gènes ADN

Plus en détail

Syndrome de Lynch : les risques tumoraux

Syndrome de Lynch : les risques tumoraux Lille - 22/03/2013 Syndrome de Lynch : les risques tumoraux Valérie Bonadona, MD, PhD Centre Léon Bérard & CNRS UMR 5558 Lyon Le Syndrome de Lynch = Syndrome HNPCC (Hereditary Nonpolyposis Colorectal Cancer)

Plus en détail

Apathie, profil actimétrique nocturne et gènes de l horloge biologique. Plan:

Apathie, profil actimétrique nocturne et gènes de l horloge biologique. Plan: Apathie, profil actimétrique nocturne et gènes de l horloge biologique CMRR Nice Emmanuel Mulin mulin.e@chu-nice.fr Plan: Préambule Apathie et maladie d Alzheimer Sommeil et maladie d Alzheimer Données

Plus en détail

En vue de l'obtention du

En vue de l'obtention du En vue de l'obtention du DO OC CT TO ORA AT DE L UN NI IV VE ER RSI IT TÉ É DE TO OU ULO OU US SE Délivré par l'université Toulouse III - Paul Sabatier Discipline ou spécialité : Statistique Génétique

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

Ch5 : Variation génétique et médecine

Ch5 : Variation génétique et médecine T3 : Corps humain et santé T3/U1 : Variation génétique et santé Ch5 : Variation génétique et médecine I. Les maladies génétiques germinales A. Rappel et définitions Une maladie est dite génétique germinale

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

Maladie d Alzheimer. Gina Devau. U1198 Mécanismes moléculaires dans les démences neurodégénératives www.mmdn.univ-montp2.fr

Maladie d Alzheimer. Gina Devau. U1198 Mécanismes moléculaires dans les démences neurodégénératives www.mmdn.univ-montp2.fr Maladie d Alzheimer Gina Devau U1198 Mécanismes moléculaires dans les démences neurodégénératives www.mmdn.univ-montp2.fr Espérance de vie 2006 Femmes Hommes France 83 ans 76 ans Education Alimentation

Plus en détail