voies de signalisation

Dimension: px
Commencer à balayer dès la page:

Download "voies de signalisation"

Transcription

1 Olivier Lascols Faculté de Médecine ierre et Marie Curie Généralités s sur les voies de signalisation 1 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? 2. Quels relais intracellulaires? 3. Spécificité de ces relais intracellulaires? II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs 2. léïotropie d un signal 3. Intégration de signaux par la cellule 2

2 La transduction des signaux: généralitg ralités Début des années 1980 ligand Système d amplification arrivée du signal membrane R transduction par récepteur? émission intracellulaire du signal quels seconds messagers? quels relais? Cibles cellulaires effets biologiques 3 La transduction des signaux aujourd hui ligand 1 ligand 2 ligand 3 Stratégie de signalisation : Directe : ligand 1 Indirecte: ligand 2 ou 3 R Transports R R Etablissement de réseaux complexes par les progrès en biologie cellulaire et moléculaire : Clonage de gènes NOAU Métabolisme Modèles cellulaires : Modification d expression de protéines Mutagénèse dirigée Modèles animaux : Souris Knock-out Souris Knock-in 4

3 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF (Epidermal( Growth Factor) 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 5 Méthodologie d éd étude des récepteursr ETAE MATERIEL METHODES RESULTATS Localisation. tissus. Test de liaison. cellules -autoradiographie - microscopie prolifération électronique différenciation. Effets biologiques apoptose Localisation.membranes. fractionnement Cellulaire. cytosol subcellulaire capacité. test de liaison spécificité Caractérisation protéines. solubilisation. Structure. Activité solubilisées. test de liaison nature, taille enzyme. électrophorèse. immunoprécipitation. test d activité Sélection. récepteurs. chromatographie purifiés d affinité (Ab, ligand). test de liaison Clonage. ADNc. Criblage de banque. Séquence protéique. Domaines spécialisés. Expression du récepteur Structure /. récepteurs. Mutagénèse dirigée. Mode de transduction Fonction mutés. transfection. cellules cystéine transmb TK tyrosines 6

4 Interaction Ligand Récepteur L + R Spécificité *L : ligand radioactif LR LR totale *L + R + X *LR + *LX fixation totale *L + R *LR fixation spécifique L : excès de ligand «froid» *L + L + X *LX + LX fixation non spécifique Réversible spécifique non spécifique Saturable : nombre de site récepteur défini = Ro 7 Etude de la structure du récepteurr Structure fixant l EGF liaison de 125 I-EGF 125 I-EGF + R 125 I-EGF/R pontage covalent 125 I-EGF + R 125 I-EGF/R électrophorèse en SDS autoradiographie Identification par Western blot DSS 8

5 Clonage d une d protéine cellule rotéine purifiée ARNm séquence partielle en acides aminés Lys-prol-trp-tyr-asp-ser-cys-ala séquence nucléotidique AAGTCCTGCGGTGACAACGGTCG = SONDE ADNc vecteur recombinant Banque d ADNc Criblage de la banque Séquence I en aa de la protéine ADNc du gène Séquence nucléotidique complète Expression de la protéine Mutagénèse dirigée roduction d anticorps 9 Etude structure fonction Construction de mutants du récepteur à l EGF Répétitions riche en leucine Domaine riches en cystéine Autophosphorylation des mutants EGFR Domaine Tyrosine Kinase Domaine C-terminal 10

6 Activation d un d récepteur r tyrosine kinase (TK) Mb 2. hosphorylation sur des résidus tyrosines de substrats endogènes TK AT TK AD 1. Autophosphorylation sur des résidus tyrosines du récepteur substrat substrat AT AD 11 Activation par dimérisation et transphosphorylation Apport de la cristallographie et de la bioinformatique : Structure 3D a. Forme repliée d EGFR: -faible affinité de liaison de l EGF - pas d activité kinase b. Fixation de l EGF: - changement conformationnel du monomère (allostérie) - démasquage de la boucle de dimérisation. b. Dimérisation: - dos à dos - activation de la tyrosine kinase 12

7 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 13 Etude des interactions : entre molécules connues Activation par le ligand Immunoprécipitation des complexes formés avec anticorps spécifique Séparation des constituants du complexe par électrophorèse Visualisation des protéines par immunoblot avec des anticorps spécifiques 14

8 Application Implication de Grb2 dans la voie de signalisation induite par EGF I : immunoprécipitation IB : immunoblot Lors de l activation par EGF: 1. Le récepteur à l EGF change de taille apparente 2. Le récepteur à l EGF est phosphorylé sur une tyrosine 3. Induction d une interaction entre EGFR et Grb2 15 Clonage d un d nouveau partenaire Fragment EGFR marqué Banque d expression d ADNc I Criblage de la banque Clones positifs radioactifs Séquençage des ADN Expression de la protéine roduction d anticorps Immunoprécipitation Immunoblot 16

9 Système double hybride (1) BD : Binding Domain AD : Activating Domain UAS : Upstream Activating Sequence 17 Système double hybride (2) Criblage d une d librairie d expressiond 18

10 Etude de la localisation d un d relais ADNc de protéine relais ADNc de protéine TAG ADNc de protéine chimère Expression de la protéine chimère stimulation par le ligand Localisation de la protéine chimère si TAG fluorescent Ex: GF Green Fluorescent rotein si TAG non fluorescent Ab fluorescent anti-tag Microscopie confocale en lumière fluorescente 19 b. La voie d activation d des MAK par l EGF l : recrutement d un d premier relais par EGFR activé Domaine SH2 Domaine SH3 Mb TK TK TK TK Grb2 : Growth Receptor Bound rotein sos : son of sevenless Grb2 sos 1. Complexe Grb2/sos 2. Interaction entre Tyr- et SH2 Grb2 sos Grb2 sos 3. Localisation à la membrane de sos 20

11 Activation d un d 2ème 2 relais membranaire Mb TK TK Grb2 sos ras GD ras GT ras : petite protéine G myristoylée localisation membranaire 1. Interaction sos ras 2. Echange GD-GT 21 Cycle d activationd activation-inactivation inactivation de la protéine ras ras GD i GT GTase GA SIGNAL rotéine d échange ras GD GT rotéine Effectrice Conduction du SIGNAL rotéine G : régulation allostérique activité GTase sos : protéine d échange Raf1 : protéine effectrice GA : GTase activating protein 1. ras.gd inactive 2. Echange GD-GT 3. Ras GT active 4. Interaction protéine effectrice 5. Hydrolyse du GT 22

12 Structure de la Kinase Raf-1 CR : conserved region CRD : cystein rich domain RBD : ras binding domain S : sérine T : thréonine : tyrosine 23 Modèle d activation d de Raf Ras et raf inactives 2. Activation ras - interaction raf 3. Activation de raf et déplacement de la protéine raf: sérine/thréonine kinase, phosphorylable par Src ou prot X (Current Opinion in Cell Biology (1997) 9: ) 24

13 Activation d une d cascade de Kinases Raf1 MEK Ser Ser AT AD Ser Ser Noyau MAK Thr Tyr AT AD Thr Tyr activation de la transcription MEK : MAK ou ERK Kinase MAK : Mitogen-Activated rotein Kinase 1. Raf1 ser/thr kinase sur MEK 2. MEK thr/tyr kinase sur MAK 3. Translocation MAK nucléaire 25 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 26

14 Inhibition pharmacologique des voies de signalisation oints d impact sur la voie mitogénique de l EGF Facteur de croissance RTK Inhibiteur Tyrosine Kinase Inhibiteur de SH3 Anticorps SH2 Grb2, Shc Inhibiteur de SH2 sos Inhibiteur d échange Ras Inhibiteur de Ras Raf Inhibiteur de Raf Inhibiteur de MAKK LCg I3K T Inhibiteur de farnésylation de Ras MAKK MAK Inhibiteur Inhibiteur Inhibiteur Inhibiteur de MAK Noyau 27 Inhibition pharmacologique des voies de signalisation 28

15 Stratégies de modification d une d voie de signalisation (1) Antisens RNA silencing Transfection cellulaire Transgénèse chez l animal Antisens RNA silencing Théorie du RNAi (RNA interférence) rix Nobel de médecine et de physiologie 2006 : Andrew Fire et Craig Mello. Éléments de régulation cellulaire Outils d étude 29 Stratégies de modification d une d voie de signalisation (2) RNA silencing Dicer: hélicase/rnase RISC : RNA-induced silencing complexes Application: synthèse in vitro de sirna ciblé et transfection dans les cellules 30

16 Stratégies de modification d une d voie de signalisation (3) Transfection cellulaire Transfection d un gène normal ou muté dans une cellule hôte Surexpression de forme mutée «dominant négatif» 31 Stratégies de modification d une d voie de signalisation (4) Transgénèse chez l animal Surexpression d un gène : transgénèse additive Invalidation d un gène : transgénèse substitutive par recombinaison homologue : souris Knock-Out (KO) Cellules ES : cellules souches embryonnaires 32

17 Stratégies de modification d une d voie de signalisation (5) Invalidation d un gène : souris hétérozygotes et homozygotes Knock-out conditionnel et spécifique de tissu: système CRE-Lox rocessus de recombinaison sous contrôle d un promoteur spécifique de tissu Substitution d un gène par un autre : souris Knock-in (KI) 33 b. Intégration des 3 dimensions : nature, lieu, temps Quelle spécificité du signal? Car nombreux éléments communs : rincipes d activation Intermédiaires communs Interactions protéine-protéine Effets biologiques Régulation spatio-temporelle : Compartimentalisation Cinétique des activations 34

18 Nature : spécificit cificité des signaux et des récepteurs r (1) Diversité des ligands Dimérisation de diverses isoformes du récepteur à l EGF : - HER1 (ou EGFR ou erbb1), HER2, HER3 et HER4. Rq: HER3 est dépourvu d activité tyrosine kinase. - Homo- ou hétérodimères - Expression variable 35 Nature : spécificit cificité des signaux et des récepteurs r (2) Dimérisation et diversité des effets biologiques. 36

19 Nature : voies des MAKs Familles de MAK : ERK1, 2, 3 JNK1, 2, 3 p38 α,β,γ,δ Activation par cascade de phosphorylation: MAKKK (MEKK) : ser/thr kinase MAKK (MEK): ser/thr et tyr kinases Signaux cellulaires: Cycle cellulaire Différenciation Survie/apoptose Localisation des cibles: Cytosolique Nucléaire 37 LIEU : SCAFFOLD, ANCHOR, DOCKING, ADATOR rotéines d assemblage d de complexes macromoléculaires culaires 3 rôles clés dans les voies de tranduction de signaux : 1. Reproupe les composants de la voie de signalisation dans un complexe multiprotéique très spécifique 2. Efficacité : présente les substrats aux enzymes séquentiellement et dans une orientation idéale pour une efficacité optimum. 3. Cible le complexe et donc le signal vers une localisation cellulaire spécifique 38

20 Complexe multiprotéique ique avec KSR Localisation cytosolique KSR constitutivement associé : MEK, , phosphatase inactive (2A) IM (impedes mitogenic signal propagation) kinases (C-TAK, etc ) Régulation par phosphorylation/dépho s-phorylation 39 Compartimentalisation et durée e du signal Réponses différentielles des ERK aux facteurs de croissance: EGF et DGF Réponse spatio- temporelle spécifique sur des fibroblastes 40

21 Bilan des régulations r spatio-temporelles temporelles d ERK et des réponses r cellulaires Effet spécifique dépend du type cellulaire Fibroblastes Cellules C12 : EGF : prolfération cellulaire NGF : différentiation neuronale Effet spécifique dépend de la durée, de l intensité et de la localisation cellulaire du signal. Ebisuya, M. et al. J Cell Sci 2005;118: II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs a. Domaines spécialisés d interaction b. Familles de récepteurs c. Diversité des relais 2. léïotropie d un signal 3. Intégration de signaux par la cellule 42

22 Domaines protéiques pour des interactions spécifiques Site secondaire Site primaire SH2 I --X-X-hy- Domaine «Src Homology 2» 100 aa Spécificité: phosphotyrosine et environnement côté C-terminal SH3 Domaine «Src Homology 3» 60 aa Spécificité: proline TB I -hy-x-n--x-- Domaine «hospho-tyrosine Binding» 200 aa Spécificité: phosphotyrosine et environnement côté N-terminal --X-X--X- WW Domaine avec Tryptophane (W) 40 aa Spécificité: proline I -R-S-X-S-X-- DZ Dimère de protéine Spécificité: phosphosérine Domaine 100 aa Spécificité: extrémité C-terminale ---X-- H hospholipides Domaine «leckstrin Homology» 100 aa Spécificité: interaction avec phospholipides membranaires -E-S/T-D-V-COOH 43 Familles de récepteursr 44

23 rotéines relais et Domaines d Interactiond 45 Activation de relais protéiques sans activité catalytique Amarrage «docking» Adaptateur rotéine G GD Inactif effecteur effecteur GT Activé effecteur effecteur Interactions effectrices effecteur GT effecteur 46

24 léï éïotropie d un signal (1) Récepteur à l EGF : protéine d amarrage Mb Shc Grb2 -sos LCγ rolifération Motilité Différenciation Apoptose I3K 47 léï éïotropie d un signal (2) 48

25 Intégration de différents signaux Régulation de la croissance cellulaire Inter-relations entre différentes voies de signalisation : a. S/u Gα activée pour différents récepteurs couplés aux protéines G b. Transactivation de récepteurs Tyrosine kinases par RCG c. Diversité liée à hétérodimérisation de RTK d. Interaction nucléaire avec les signaux stéroïdiens 49 Requiem du cancer Implication des voies de signalisation de la prolifération ration cellulaire. 50

étude des voies de signalisation

étude des voies de signalisation Olivier Lascols Faculté de Médecine ierre et Marie Curie Stratégie d éd étude des voies de signalisation 1 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique

Plus en détail

Les récepteurs à activité enzymatique intrinsèque

Les récepteurs à activité enzymatique intrinsèque Les récepteurs à activité enzymatique intrinsèque Différentes activités enzymatiques intrinsèques ont été mise en évidence : Activité tyrosine kinase (TK) Ex : le récepteur au DGF, à l EGF ou les récepteurs

Plus en détail

VOIE DES PHOSPHOINOSITIDES

VOIE DES PHOSPHOINOSITIDES VOIE DES HOSHOINOSITIDES LE DIACYLGLYCEROL ACTIVE LA KC L INOSITOL TRI HOSHATE (I3) ROVOQUE LA LIBERATION DE Ca ++ INTRACELLULAIRE (10-6 M Ca ++ ) Ca ++ pompe [Ca ++ ] extra-cellulaire (sang) 2.5 mm (2,5.10-3

Plus en détail

réponse cellulaire: Prolifération, Différenciation, survie,apoptose

réponse cellulaire: Prolifération, Différenciation, survie,apoptose Signalisation : Concept Stimuli extérieurs: Facteurs de croissance, Hormones Cytokines Interaction cellule/cellule Récepteur cellule ropagation du signal Somme des évènements moléculaires Intracellulaires

Plus en détail

Les bases de la transduction du signal des lymphocytes T

Les bases de la transduction du signal des lymphocytes T Frédéric VELY frederic.vely@ap-hm.fr MCU-PH Laboratoire d Immunologie - Hôpital de la Conception Lab of NK cells and Innate Immunity - Centre d Immunologie de Marseille-Luminy Les bases de la transduction

Plus en détail

Anomalies moléculaires et ciblage thérapeutique

Anomalies moléculaires et ciblage thérapeutique Anomalies moléculaires et ciblage thérapeutique Tumeurs solides Jacques Robert ISERM U916 Institut Bergonié Université de Bordeaux 2 Anomalies moléculaires des cancers Autosuffisance en facteurs de croissance

Plus en détail

LA PROLIFÉRATION CELLULAIRE. Pr J-L. MERLIN

LA PROLIFÉRATION CELLULAIRE. Pr J-L. MERLIN ASECTS MOLÉCULAIRES DE LA ROLIFÉRATION CELLULAIRE r J-L. MERLIN ASECTS MOLECULAIRES DE LA ROLIFERATION «Vers de nouvelles cibles thérapeutiques» r. Jean-Louis Merlin Faculté de harmacie, Université Henri

Plus en détail

Partie III: Récepteurs membranaires. RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines

Partie III: Récepteurs membranaires. RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines Partie III: Voies de signalisation des récepteurs Tyrosine kinases (RTK) Récepteurs membranaires À activité enzymatique Sans activité enzymatique RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines

Plus en détail

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE TOUT D ABORD UN PETIT HISTORIQUE 1910: Peyton ROUS découvre le virus qui porte son nom 1976: les oncogènes de certains virus ont une contrepartie cellulaire

Plus en détail

Le récepteur de l insuline

Le récepteur de l insuline Le récepteur de l insuline Tarik ISSAD Directeur de Recherche CNRS Institut Cochin Département de Biologie Cellulaire 22 rue Méchain, 75014 PARIS issad@cochin.inserm.fr 1. Quelques rappels : le rôle de

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Durée de l'épreuve: 3 heures. (Pas de documents autorisés) Sujet 1 (8 points). Pathologies des cils et des flagelles, et kinésines.

Durée de l'épreuve: 3 heures. (Pas de documents autorisés) Sujet 1 (8 points). Pathologies des cils et des flagelles, et kinésines. Université de la Méditerranée Année universitaire 2002-2003 Faculté des Sciences de Luminy Département de Biologie Maîtrise de Biologie Cellulaire Module optionnel "Dynamique Cellulaire" Première session

Plus en détail

TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B

TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B M1 immuno 11/12/07 RT : Sauvet gabriella TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B 1- Stimulation des lymphocytes par l antigène 2- Plusieurs protéines membranaires «aident» le récepteur de l antigène

Plus en détail

un exercice d équilibre

un exercice d équilibre un exercice d équilibre hysiologique athologique Trafic intracellulaire, Actine ADN Ras ATM Raf, I3K, Ral MAK Cdc25B S G2 Transcription, rolifération, Différenciation G1 M Contrôle du cycle, Réparation,

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

FRET ( Förster / fluorescence resonance energy transfer )

FRET ( Förster / fluorescence resonance energy transfer ) FRET ( Förster / fluorescence resonance energy transfer ) I - Théorie II - Méthodes de mesure III - Applications à des études biologiques IV - Un exemple de l utilisation du FRET : étude de l interaction

Plus en détail

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus : implication des voies de signalisation intracellulaire du processus de RVD. Audrey Fouchs Confrontées

Plus en détail

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin.

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin. INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I La transfection Responsable : Valérie Chopin LBH semestre 6 Faculté des Sciences Laboratoire de Physiologie Cellulaire et

Plus en détail

Docteur Serge BOTTARI

Docteur Serge BOTTARI Biologie Cellulaire Chapitre 5 : L adhérence cellulaire : les protéines d adhérence cellule-matrice extracellulaire Docteur Serge BOTTARI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble

Plus en détail

Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2

Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2 Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2 1 DOMAINE D UTILISATION DES ANTICORPS IN VITRO ET IN VIVO B)Utilisation des Anticorps in vitro - dosages

Plus en détail

A) Domaines et prényls de protéines RAS (super-famille)

A) Domaines et prényls de protéines RAS (super-famille) CHAPITRE 2 : PROTÉINES G MONOMÉRIQUES Ce sont des intégrateurs moléculaires des voies de signalisation, des «commutateurs multipositions». Elles sont constituées d une sous-unité α, existent chez les eucaryotes

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk actif Différentes Cdk peuvent s associer avec différentes Cyclines Cdk active: tyrosine et thréonine Kinase (phosphoryle

Plus en détail

II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux

II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux Neurones et cellules gliales 2) neurone Schéma d un motoneurone Les nombreux prolongements cytoplasmiques (dendrites

Plus en détail

BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30. Sujet avec documents type ENS (partiel) - durée : 2h30

BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30. Sujet avec documents type ENS (partiel) - durée : 2h30 BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30 Sujet avec documents type ENS (partiel) - durée : 2h30 Exercice n 1 : La lignification : un marqueur de la différenciation cellulaire. La lignification

Plus en détail

Les voies de signalisation intracellulaire : la protéine Rab5

Les voies de signalisation intracellulaire : la protéine Rab5 UMR CNRS : 7213 Laboratoire de biophotonique et pharmacologie Equipe de signalisation cellulaire : Signalisation intracellulaire et protéines transmembranaires Les voies de signalisation intracellulaire

Plus en détail

Oncogènes et anti-oncogenes C. Hourioux

Oncogènes et anti-oncogenes C. Hourioux Oncogènes et anti-oncogenes C. Hourioux Définitions : Cancer Multiplication anarchique de cellules échappant aux mécanismes normaux de différenciation et de régulation de leur multiplication Capacité à

Plus en détail

V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE-

V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE- Page : 45/ 77 V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE- PROTEINE : CAS DES RECEPTEURS COUPLES AUX PROTEINES G (RCPG) Les RCPG sont des protéines à sept domaines transmembranaires

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

SIGNALISATION DES RECEPTEURS A ITAM ET ITIM

SIGNALISATION DES RECEPTEURS A ITAM ET ITIM Cours d Immunologie Ronéo-Typeur : Anne-Laure Hermann Mardi 4 décembre 17h-19h Sylvain Latour SIGNALISATION DES RECEPTEURS A ITAM ET ITIM SIGNALISATION DES RECEPTEURS A ITAM I)Généralités A.Localisation

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation

Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation Mitose Mitose Mitose Interphase Interphase Interphase Activité MPF Quantité de cycline B Corrélation

Plus en détail

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser.

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser. AVERTISSEMENT Au fil de l ouvrage, les termes ou les notions importantes développés dans le livre de cours Bases cellulaires et moléculaires du développement (Ellipses, 2007), sont notés (I) ou (I, p.x).

Plus en détail

Génération d anticorps monoclonaux par immunisation génique

Génération d anticorps monoclonaux par immunisation génique Génération d anticorps monoclonaux par immunisation génique Gen2Bio 2010 Saint-Malo, mardi 30 mars 2010 Un partenariat Demandeur PADAM In Cell Art Projet Anticorps monoclonaux Gen2Bio 2010 Saint-Malo,

Plus en détail

Correction du concours 2010/ 2011 :

Correction du concours 2010/ 2011 : Correction du concours 2010/ 2011 : Chez les mammifères, la dégradation oxydative des acides gras à chaîne longue joue un rôle majeur dans le métabolisme énergétique. Le principal d entre eux est l acide

Plus en détail

Colle UE2 N 2 2015/2016 Enoncé

Colle UE2 N 2 2015/2016 Enoncé Colle UE2 N 2 2015/2016 Enoncé Ayham ALKASSAB & Julien GARYGA Ce sujet de biologie cellulaire est composé de 10 QCM. L épreuve dure 60 minutes. Chaque QCM compte pour 5 points. L ensemble correspond donc

Plus en détail

Insulinorésistance et cancers

Insulinorésistance et cancers Insulinorésistance et cancers L insulinorésistance est présente dans de nombreuses situations comme (Godsland I.F. 2009) : - Le vieillissement ; - La sédentarité ; - L obésité abdominale ; - Le diabète

Plus en détail

Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? Année 2005-06

Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? Année 2005-06 Année 2005-06 Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? MENARD Baptiste LABORDE DIT PERE Samuel 1 SOMMAIRE RESUME..3 I.INTRODUCTION....4 A. Le

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Docteur Laurent PELLETIER

Docteur Laurent PELLETIER Biologie Cellulaire Chapitre 4 : La communication inter-cellulaire via les récepteurs membranaires Partie 2 Docteur Laurent PELLETIER MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble -

Plus en détail

Oncogène 2: Types d altérations génétiques associées aux cancers

Oncogène 2: Types d altérations génétiques associées aux cancers Oncogène 2: Types d altérations génétiques associées aux cancers Partie 1 - Oncogènes dominants, - Oncogènes récessifs, suppresseurs de tumeur - Convergence et ciblage des fonctions Oncogènes physiologiquement

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

Signalisation insuline en physiologie et pathologie

Signalisation insuline en physiologie et pathologie UE Métabolisme Energétique P Ferré 2006-2007 Faculté de Médecine Pierre et Marie Curie Jacqueline Capeau Signalisation insuline en physiologie et pathologie Métabolisme énergétique en situation post-prandiale

Plus en détail

Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr

Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr UE méthodologique : «Outils de manipulations des génomes et d expression des gènes

Plus en détail

CRIBLAGE D UN GENE PAR L ARN INTERFERENCE

CRIBLAGE D UN GENE PAR L ARN INTERFERENCE JANOT Caroline Master Immunotechnologies Paris VI TAP Julien Master Biodiversité Paris VI CRIBLAGE D UN GENE PAR L ARN INTERFERENCE Responsables : Linda Kohl Philippe Bastin 2006 Objectifs Le but de notre

Plus en détail

LES CONSTITUANTS MOLÉCULAIRES DU VIVANT

LES CONSTITUANTS MOLÉCULAIRES DU VIVANT Préparation à l Agrégation Interne Paris VI 2009-2010 Séances des 19 et 23 septembre LES CONSTITUANTS MOLÉCULAIRES DU VIVANT Les mots clés : Lipide, glucide, protide, acide nucléique, monomère, polymère,

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010

Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010 Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010 Dr Laurent ARNOULD Département de Biologie et de Pathologie des Tumeurs Centre G-F

Plus en détail

Il s'agit d'une proposition de plan, tout autre plan intégrant les idées maîtresses énoncées ci-dessous étant également valable.

Il s'agit d'une proposition de plan, tout autre plan intégrant les idées maîtresses énoncées ci-dessous étant également valable. Rapport concernant le sujet d'écrit de biologie Traiter un sujet de ce type nécessite à la fois : une construction de l'exposé dégageant les idées maîtresses, avec un plan structuré apparent et comportant

Plus en détail

METABOLISME DES VEGETAUX TD N 1

METABOLISME DES VEGETAUX TD N 1 METABOLISME DES VEGETAUX TD N 1 Exercice n 1 Les séquences nucléotidiques des gènes sont proches. 1 Production ATPase: On part de l'adnc de la levure pour savoir si la régulation se fait par la protéine

Plus en détail

THESE. Carla SAMPAIO. RÔLE DE GAB1 DANS L INTERCONNECTION ENTRE LES VOIES Ras/MAPK ET PI3K EN AVAL DU RECEPTEUR DE L EGF

THESE. Carla SAMPAIO. RÔLE DE GAB1 DANS L INTERCONNECTION ENTRE LES VOIES Ras/MAPK ET PI3K EN AVAL DU RECEPTEUR DE L EGF UNIVERSITE TOULOUSE III- PAUL SABATIER U.F.R Sciences THESE En vue de l obtention du DOCTORAT DE L UNIVERSITE DE TOULOUSE délivré par l Université Toulouse III- Paul Sabatier Discipline : Physiopathologie

Plus en détail

Liste de publication recommandées pour le cours sur les MAP kinases:

Liste de publication recommandées pour le cours sur les MAP kinases: Hervé Enslen INSERM U536 17 rue du Fer à Moulin 75005, Paris Tél: 01-45-87-6157 E-mail: enslen@fer-a-moulin.inserm.fr Liste de publication recommandées pour le cours sur les MAP kinases: - Revues:. Widmann

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

LES COMMUNICATIONS INTERCELLULAIRES PAR LES VOIES DE SIGNALISATION. Principes généraux 03

LES COMMUNICATIONS INTERCELLULAIRES PAR LES VOIES DE SIGNALISATION. Principes généraux 03 Chapitre 7 LES COMMUNICATIONS INTERCELLULAIRES AR LES VOIES DE SIGNALISATION SOMMAIRE 1 ère partie rincipes généraux 03 1. La signalisation intracellulaire ou réseau de protéines intracellulaire de signalisation

Plus en détail

Les chimiothérapies du cancer colorectal :

Les chimiothérapies du cancer colorectal : Les chimiothérapies du cancer colorectal : Facteurs prédictifs d efficacité des thérapies ciblées Pr Thierry CONROY Centre Alexis Vautrin et CHU de Nancy La voie d EGFR EGF TGFα ligands EGF-r surexprimé

Plus en détail

L adhérence cellulaire

L adhérence cellulaire UE2 : Biologie cellulaire Migration cellulaire, domiciliation et cancer Chapitre 2 : L adhérence cellulaire Pierre CAVAILLES Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire UE09s Méthodes d étude et analyse du génome Applications des techniques du génie génétique à la thérapie des maladies acquises Exemples en cancérologie Thérapie ciblée Théranostique Plan du cours Introduction

Plus en détail

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 (D après Carpino, N., et al. (2004) Immunity 20:37) Exercice I (noté sur 14 points) Les lymphocytes T jouent un rôle central dans la reconnaissance

Plus en détail

Le RNA silencing: mécanisme d inactivation de l expression des gènes

Le RNA silencing: mécanisme d inactivation de l expression des gènes Le RNA silencing: mécanisme d inactivation de l expression des gènes Patrice Crété Laboratoire de Génétique et de Biophysique des plantes UMR6191,Faculté des Sciences de Luminy INTRODUCTION Chez les plantes,

Plus en détail

La voie EGFR. Définition des Bio Marqueurs. ML KOTTLER coordinatrice plateforme GENECAN Service de génétique CHU de CAEN

La voie EGFR. Définition des Bio Marqueurs. ML KOTTLER coordinatrice plateforme GENECAN Service de génétique CHU de CAEN La voie EGFR Définition des Bio Marqueurs ML KOTTLER coordinatrice plateforme GENECAN Service de génétique CHU de CAEN Kottler ML RéseauOncoBasseNormandie 20mai2015 Kottler ML RéseauOncoBasseNormandie

Plus en détail

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1 UFR Sciences et Techniques Licence 2 ème année BiologieBiochimie Module S4B0100 Biologie Cellulaire 3Immunologie 1 TD de Biologie Cellulaire Joelle Gaschet (joelle.gaschet@univnantes.fr) Xavier Saulquin

Plus en détail

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Introduction Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Informatique: - stocker les données - éditer les données - analyser les données (computational

Plus en détail

Il existe trois isoformes de CPT1 (CPT1A, CPT1B, CPT1C) qui sont exprimées à des niveaux différents selon les tissus.

Il existe trois isoformes de CPT1 (CPT1A, CPT1B, CPT1C) qui sont exprimées à des niveaux différents selon les tissus. PARTIE BIOCHIMIE INTRODUCTION Chez les mammifères, la dégradation oxydative des acides gras à chaîne longue joue un rôle majeur dans le métabolisme énergétique. Le principal d entre eux est l acide palmitique

Plus en détail

CANCER BRONCHIQUE AVEC TRANSLOCATION ALK CIBLES ET DIAGNOSTIC

CANCER BRONCHIQUE AVEC TRANSLOCATION ALK CIBLES ET DIAGNOSTIC Faculté de Médecine CANCER BRONCHIQUE AVEC TRANSLOCATION ALK CIBLES ET DIAGNOSTIC Florian CABILLIC Laboratoire Cytogénétique RÉCEPTEURS À TYROSINE KINASE Domaine TK 90 tyrosine kinases 58 récepteurs, répartis

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3 TABLE DES MATIERES AVANT-PROPOS XI PARTIE A BIOLOGIE MOLECULAIRE 1. LES ACIDES NUCLEIQUES 3 1.1 STRUCTURE DE LA CHAINE POLYNUCLEOTIDIQUE 4 Les bases 4 Les pentoses 5 Nucléosides et nucléotides 5 La chaîne

Plus en détail

Croissance bactérienne et expression des protéines

Croissance bactérienne et expression des protéines Croissance bactérienne et expression des protéines Stéphane Delbecq Laboratoire de Biologie Cellulaire et Moléculaire EA 4558 «vaccination antiparasitaire» Faculté de Pharmacie sdelbecq@univ-montp1.fr

Plus en détail

Contrôle moléculaire des adaptations musculaires à l exercice

Contrôle moléculaire des adaptations musculaires à l exercice Contrôle moléculaire des adaptations musculaires à l exercice Professeur Frédéric CHARBONNIER Laboratoire de Neurobiologie des Réseaux Sensorimoteurs- CNRS/Université Paris Descartes Les travaux que je

Plus en détail

Communication intercellulaire : Les Cytokines

Communication intercellulaire : Les Cytokines PCEM 2- Cours de Biologie cellulaire n 8 Professeur : M. COHEN-SOLAL Jeudi 13 Décembre 2007, 10h30 Ronéotypeur : DENIAU Benjamin Communication intercellulaire : Les Cytokines 1 SOMMAIRE I/ INTRODUCTION

Plus en détail

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 Introduction Théorie cellulaire : toute cellule est issue d une cellule L information génétique est transmise aux 2 cellules filles à chaque division Le génome

Plus en détail

Plasticité cellulaire. et progression tumorale

Plasticité cellulaire. et progression tumorale Plasticité cellulaire et progression tumorale TEM TME Académie Nationale de Médecine 2 Février 2011 A. Puisieux Centre de Recherche en Cancérologie de Lyon Cancérogenèse: un processus multi-étapes Epithélium

Plus en détail

BIOLOGIE. Durée : 4 heures. L usage de la calculatrice, d abaques et de tables est interdit pour cette épreuve.

BIOLOGIE. Durée : 4 heures. L usage de la calculatrice, d abaques et de tables est interdit pour cette épreuve. Concours B ENSA B-0112B BIOLOGIE Durée : 4 heures L usage de la calculatrice, d abaques et de tables est interdit pour cette épreuve. Si, au cours de l épreuve, un candidat repère ce qui lui semble être

Plus en détail

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de vos projets

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de vos projets Mabsolys-2015-FR:Mise en page 1 03/07/15 14:02 Page1 le département prestataire de services de MABSolys de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Les anticorps : un outil pour la biologie moléculaire

Les anticorps : un outil pour la biologie moléculaire Master 2-Biotechnologies Parcours Cytologie Moléculaire Appliquée UE Immunoinformatique-Immunotechnologies Les anticorps : un outil pour la biologie moléculaire Ounissa AÏT AHMED Institut de Génétique

Plus en détail

Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO

Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO Fabrice SONCIN Directeur de Recherche INSERM Institut de Biologie de

Plus en détail

THESE DE L UNIVERSITE DE LYON. Délivrée par UNIVERSITE CLAUDE BERNARD LYON 1 ECOLE DOCTORALE BMIC (BIOLOGIE MOLECULAIRE INTEGREE ET COGNITIVE)

THESE DE L UNIVERSITE DE LYON. Délivrée par UNIVERSITE CLAUDE BERNARD LYON 1 ECOLE DOCTORALE BMIC (BIOLOGIE MOLECULAIRE INTEGREE ET COGNITIVE) N d ordre :XXXXX THESE DE L UNIVERSITE DE LYON Délivrée par UNIVERSITE CLAUDE BERNARD LYON 1 ECOLE DOCTORALE BMIC (BIOLOGIE MOLECULAIRE INTEGREE ET COGNITIVE) DIPLOME DE DOCTORAT Soutenue publiquement

Plus en détail

RÉGULATION DE L EXPRESSION DES GÈNES

RÉGULATION DE L EXPRESSION DES GÈNES RÉGULATION DE L EXPRESSION DES GÈNES Comme nous l avons vu, le programme de transcription n est pas fixe. La cellule sait adapter ce programme aux conditions extérieures, au mieux de son économie. Chez

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

CANCÉROLOGIE. Cours n 3 :

CANCÉROLOGIE. Cours n 3 : UE2 : Cancérologie Pr Lehmann-Che et Pouessel Mercredi 26 septembre 10h30-12h30 Ronéotypeuse : Aurore Valentin Ronéolectrice : Marion Whiston CANCÉROLOGIE Cours n 3 : De la biologie moléculaire des cancers

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME..... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 LA RETINOPATHIE DIABETIQUE.. 31 I-LE DIABETE SUCRE ET SES COMPLICATIONS 31 1-Le

Plus en détail

1) Catalogue non exhaustif des voies de signalisation. 2) Discussions sur la signalisation lymphocytaire T

1) Catalogue non exhaustif des voies de signalisation. 2) Discussions sur la signalisation lymphocytaire T M2 Biologie des Eucaryotes T cell signaling : from physiology to pathology Jacques Nunès 1) Catalogue non exhaustif des voies de signalisation 2) Discussions sur la signalisation lymphocytaire T Institut

Plus en détail

Dossier : réceptologie

Dossier : réceptologie Hétérodimères de récepteurs à sept domaines transmembranaires : enfin la démonstration de leur implication dans une pathologie V. Contesse* vitro sur des modèles de cellules transfectées révèlent notamment

Plus en détail

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée.

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée. Les thérapies ciblées du cancer Dictionnaire anglais-français autorisé. Calculatrice autorisée. Une thérapie ciblée est un traitement qui agit par un mécanisme spécifique sur des altérations biologiques

Plus en détail

Thérapies ciblées et sujets âgés

Thérapies ciblées et sujets âgés Thérapies ciblées et sujets âgés Dr Marie-Paule Sablin Service inter-hospitalier Beaujon-Bichat de cancérologie Le plan Que sont les thérapies ciblées? Leurs indications En pratique chez les sujets agés

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Pattern d expression chez les rongeurs, dans l ovaire humain, et fonction de reproduction dans des modèles de souris transgéniques

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

La fonction des complexes CDKcyclines et la transition G1-S

La fonction des complexes CDKcyclines et la transition G1-S La fonction des complexes CDKcyclines et la transition G1-S Dr Gerardo Ferbeyre Département de biochimie, E515 g.ferbeyre@umontreal.ca Nous avons étudiés en détaille la structure et la régulation des différents

Plus en détail

SCIENCES DE LA VIE ET DE LA TERRE Durée : 3 heures. Ocytocine, progestérone et parturition chez les Mammifères

SCIENCES DE LA VIE ET DE LA TERRE Durée : 3 heures. Ocytocine, progestérone et parturition chez les Mammifères Banque «Agro-Véto» AT-0113 SCIENCES DE LA VIE ET DE LA TERRE Durée : 3 heures L'usage d'abaques, de tables, de calculatrice et de tout instrument électronique susceptible de permettre au candidat d'accéder

Plus en détail

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction Anisotrope : Se dit d'un corps dont les propriétés varient suivant la direction Tropisme : réaction d'orientation des organes d'une plante à une anisotropie de milieu. Exemples : la lumière, la gravité,

Plus en détail

HIBRYDATION IN SITU METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009

HIBRYDATION IN SITU METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009 METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009 HIBRYDATION IN SITU Dr Mokrane Yacoub. AHU Histologie Faculté de médecine de Poitiers Service d anatomie pathologique PLAN I- Définition et principes

Plus en détail

Leptine et diabète LA LEPTINE POSSEDE DEUX TYPES DE RECEPTEURS

Leptine et diabète LA LEPTINE POSSEDE DEUX TYPES DE RECEPTEURS Leptine et diabète La leptine est une hormone protéique de 16 KDa (précédé d une séquence signal hydrophobe) comportant 167 acides aminés produite à partir du "gène de l'obésité" ob, principalement par

Plus en détail