voies de signalisation

Dimension: px
Commencer à balayer dès la page:

Download "voies de signalisation"

Transcription

1 Olivier Lascols Faculté de Médecine ierre et Marie Curie Généralités s sur les voies de signalisation 1 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? 2. Quels relais intracellulaires? 3. Spécificité de ces relais intracellulaires? II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs 2. léïotropie d un signal 3. Intégration de signaux par la cellule 2

2 La transduction des signaux: généralitg ralités Début des années 1980 ligand Système d amplification arrivée du signal membrane R transduction par récepteur? émission intracellulaire du signal quels seconds messagers? quels relais? Cibles cellulaires effets biologiques 3 La transduction des signaux aujourd hui ligand 1 ligand 2 ligand 3 Stratégie de signalisation : Directe : ligand 1 Indirecte: ligand 2 ou 3 R Transports R R Etablissement de réseaux complexes par les progrès en biologie cellulaire et moléculaire : Clonage de gènes NOAU Métabolisme Modèles cellulaires : Modification d expression de protéines Mutagénèse dirigée Modèles animaux : Souris Knock-out Souris Knock-in 4

3 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF (Epidermal( Growth Factor) 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 5 Méthodologie d éd étude des récepteursr ETAE MATERIEL METHODES RESULTATS Localisation. tissus. Test de liaison. cellules -autoradiographie - microscopie prolifération électronique différenciation. Effets biologiques apoptose Localisation.membranes. fractionnement Cellulaire. cytosol subcellulaire capacité. test de liaison spécificité Caractérisation protéines. solubilisation. Structure. Activité solubilisées. test de liaison nature, taille enzyme. électrophorèse. immunoprécipitation. test d activité Sélection. récepteurs. chromatographie purifiés d affinité (Ab, ligand). test de liaison Clonage. ADNc. Criblage de banque. Séquence protéique. Domaines spécialisés. Expression du récepteur Structure /. récepteurs. Mutagénèse dirigée. Mode de transduction Fonction mutés. transfection. cellules cystéine transmb TK tyrosines 6

4 Interaction Ligand Récepteur L + R Spécificité *L : ligand radioactif LR LR totale *L + R + X *LR + *LX fixation totale *L + R *LR fixation spécifique L : excès de ligand «froid» *L + L + X *LX + LX fixation non spécifique Réversible spécifique non spécifique Saturable : nombre de site récepteur défini = Ro 7 Etude de la structure du récepteurr Structure fixant l EGF liaison de 125 I-EGF 125 I-EGF + R 125 I-EGF/R pontage covalent 125 I-EGF + R 125 I-EGF/R électrophorèse en SDS autoradiographie Identification par Western blot DSS 8

5 Clonage d une d protéine cellule rotéine purifiée ARNm séquence partielle en acides aminés Lys-prol-trp-tyr-asp-ser-cys-ala séquence nucléotidique AAGTCCTGCGGTGACAACGGTCG = SONDE ADNc vecteur recombinant Banque d ADNc Criblage de la banque Séquence I en aa de la protéine ADNc du gène Séquence nucléotidique complète Expression de la protéine Mutagénèse dirigée roduction d anticorps 9 Etude structure fonction Construction de mutants du récepteur à l EGF Répétitions riche en leucine Domaine riches en cystéine Autophosphorylation des mutants EGFR Domaine Tyrosine Kinase Domaine C-terminal 10

6 Activation d un d récepteur r tyrosine kinase (TK) Mb 2. hosphorylation sur des résidus tyrosines de substrats endogènes TK AT TK AD 1. Autophosphorylation sur des résidus tyrosines du récepteur substrat substrat AT AD 11 Activation par dimérisation et transphosphorylation Apport de la cristallographie et de la bioinformatique : Structure 3D a. Forme repliée d EGFR: -faible affinité de liaison de l EGF - pas d activité kinase b. Fixation de l EGF: - changement conformationnel du monomère (allostérie) - démasquage de la boucle de dimérisation. b. Dimérisation: - dos à dos - activation de la tyrosine kinase 12

7 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 13 Etude des interactions : entre molécules connues Activation par le ligand Immunoprécipitation des complexes formés avec anticorps spécifique Séparation des constituants du complexe par électrophorèse Visualisation des protéines par immunoblot avec des anticorps spécifiques 14

8 Application Implication de Grb2 dans la voie de signalisation induite par EGF I : immunoprécipitation IB : immunoblot Lors de l activation par EGF: 1. Le récepteur à l EGF change de taille apparente 2. Le récepteur à l EGF est phosphorylé sur une tyrosine 3. Induction d une interaction entre EGFR et Grb2 15 Clonage d un d nouveau partenaire Fragment EGFR marqué Banque d expression d ADNc I Criblage de la banque Clones positifs radioactifs Séquençage des ADN Expression de la protéine roduction d anticorps Immunoprécipitation Immunoblot 16

9 Système double hybride (1) BD : Binding Domain AD : Activating Domain UAS : Upstream Activating Sequence 17 Système double hybride (2) Criblage d une d librairie d expressiond 18

10 Etude de la localisation d un d relais ADNc de protéine relais ADNc de protéine TAG ADNc de protéine chimère Expression de la protéine chimère stimulation par le ligand Localisation de la protéine chimère si TAG fluorescent Ex: GF Green Fluorescent rotein si TAG non fluorescent Ab fluorescent anti-tag Microscopie confocale en lumière fluorescente 19 b. La voie d activation d des MAK par l EGF l : recrutement d un d premier relais par EGFR activé Domaine SH2 Domaine SH3 Mb TK TK TK TK Grb2 : Growth Receptor Bound rotein sos : son of sevenless Grb2 sos 1. Complexe Grb2/sos 2. Interaction entre Tyr- et SH2 Grb2 sos Grb2 sos 3. Localisation à la membrane de sos 20

11 Activation d un d 2ème 2 relais membranaire Mb TK TK Grb2 sos ras GD ras GT ras : petite protéine G myristoylée localisation membranaire 1. Interaction sos ras 2. Echange GD-GT 21 Cycle d activationd activation-inactivation inactivation de la protéine ras ras GD i GT GTase GA SIGNAL rotéine d échange ras GD GT rotéine Effectrice Conduction du SIGNAL rotéine G : régulation allostérique activité GTase sos : protéine d échange Raf1 : protéine effectrice GA : GTase activating protein 1. ras.gd inactive 2. Echange GD-GT 3. Ras GT active 4. Interaction protéine effectrice 5. Hydrolyse du GT 22

12 Structure de la Kinase Raf-1 CR : conserved region CRD : cystein rich domain RBD : ras binding domain S : sérine T : thréonine : tyrosine 23 Modèle d activation d de Raf Ras et raf inactives 2. Activation ras - interaction raf 3. Activation de raf et déplacement de la protéine raf: sérine/thréonine kinase, phosphorylable par Src ou prot X (Current Opinion in Cell Biology (1997) 9: ) 24

13 Activation d une d cascade de Kinases Raf1 MEK Ser Ser AT AD Ser Ser Noyau MAK Thr Tyr AT AD Thr Tyr activation de la transcription MEK : MAK ou ERK Kinase MAK : Mitogen-Activated rotein Kinase 1. Raf1 ser/thr kinase sur MEK 2. MEK thr/tyr kinase sur MAK 3. Translocation MAK nucléaire 25 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 26

14 Inhibition pharmacologique des voies de signalisation oints d impact sur la voie mitogénique de l EGF Facteur de croissance RTK Inhibiteur Tyrosine Kinase Inhibiteur de SH3 Anticorps SH2 Grb2, Shc Inhibiteur de SH2 sos Inhibiteur d échange Ras Inhibiteur de Ras Raf Inhibiteur de Raf Inhibiteur de MAKK LCg I3K T Inhibiteur de farnésylation de Ras MAKK MAK Inhibiteur Inhibiteur Inhibiteur Inhibiteur de MAK Noyau 27 Inhibition pharmacologique des voies de signalisation 28

15 Stratégies de modification d une d voie de signalisation (1) Antisens RNA silencing Transfection cellulaire Transgénèse chez l animal Antisens RNA silencing Théorie du RNAi (RNA interférence) rix Nobel de médecine et de physiologie 2006 : Andrew Fire et Craig Mello. Éléments de régulation cellulaire Outils d étude 29 Stratégies de modification d une d voie de signalisation (2) RNA silencing Dicer: hélicase/rnase RISC : RNA-induced silencing complexes Application: synthèse in vitro de sirna ciblé et transfection dans les cellules 30

16 Stratégies de modification d une d voie de signalisation (3) Transfection cellulaire Transfection d un gène normal ou muté dans une cellule hôte Surexpression de forme mutée «dominant négatif» 31 Stratégies de modification d une d voie de signalisation (4) Transgénèse chez l animal Surexpression d un gène : transgénèse additive Invalidation d un gène : transgénèse substitutive par recombinaison homologue : souris Knock-Out (KO) Cellules ES : cellules souches embryonnaires 32

17 Stratégies de modification d une d voie de signalisation (5) Invalidation d un gène : souris hétérozygotes et homozygotes Knock-out conditionnel et spécifique de tissu: système CRE-Lox rocessus de recombinaison sous contrôle d un promoteur spécifique de tissu Substitution d un gène par un autre : souris Knock-in (KI) 33 b. Intégration des 3 dimensions : nature, lieu, temps Quelle spécificité du signal? Car nombreux éléments communs : rincipes d activation Intermédiaires communs Interactions protéine-protéine Effets biologiques Régulation spatio-temporelle : Compartimentalisation Cinétique des activations 34

18 Nature : spécificit cificité des signaux et des récepteurs r (1) Diversité des ligands Dimérisation de diverses isoformes du récepteur à l EGF : - HER1 (ou EGFR ou erbb1), HER2, HER3 et HER4. Rq: HER3 est dépourvu d activité tyrosine kinase. - Homo- ou hétérodimères - Expression variable 35 Nature : spécificit cificité des signaux et des récepteurs r (2) Dimérisation et diversité des effets biologiques. 36

19 Nature : voies des MAKs Familles de MAK : ERK1, 2, 3 JNK1, 2, 3 p38 α,β,γ,δ Activation par cascade de phosphorylation: MAKKK (MEKK) : ser/thr kinase MAKK (MEK): ser/thr et tyr kinases Signaux cellulaires: Cycle cellulaire Différenciation Survie/apoptose Localisation des cibles: Cytosolique Nucléaire 37 LIEU : SCAFFOLD, ANCHOR, DOCKING, ADATOR rotéines d assemblage d de complexes macromoléculaires culaires 3 rôles clés dans les voies de tranduction de signaux : 1. Reproupe les composants de la voie de signalisation dans un complexe multiprotéique très spécifique 2. Efficacité : présente les substrats aux enzymes séquentiellement et dans une orientation idéale pour une efficacité optimum. 3. Cible le complexe et donc le signal vers une localisation cellulaire spécifique 38

20 Complexe multiprotéique ique avec KSR Localisation cytosolique KSR constitutivement associé : MEK, , phosphatase inactive (2A) IM (impedes mitogenic signal propagation) kinases (C-TAK, etc ) Régulation par phosphorylation/dépho s-phorylation 39 Compartimentalisation et durée e du signal Réponses différentielles des ERK aux facteurs de croissance: EGF et DGF Réponse spatio- temporelle spécifique sur des fibroblastes 40

21 Bilan des régulations r spatio-temporelles temporelles d ERK et des réponses r cellulaires Effet spécifique dépend du type cellulaire Fibroblastes Cellules C12 : EGF : prolfération cellulaire NGF : différentiation neuronale Effet spécifique dépend de la durée, de l intensité et de la localisation cellulaire du signal. Ebisuya, M. et al. J Cell Sci 2005;118: II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs a. Domaines spécialisés d interaction b. Familles de récepteurs c. Diversité des relais 2. léïotropie d un signal 3. Intégration de signaux par la cellule 42

22 Domaines protéiques pour des interactions spécifiques Site secondaire Site primaire SH2 I --X-X-hy- Domaine «Src Homology 2» 100 aa Spécificité: phosphotyrosine et environnement côté C-terminal SH3 Domaine «Src Homology 3» 60 aa Spécificité: proline TB I -hy-x-n--x-- Domaine «hospho-tyrosine Binding» 200 aa Spécificité: phosphotyrosine et environnement côté N-terminal --X-X--X- WW Domaine avec Tryptophane (W) 40 aa Spécificité: proline I -R-S-X-S-X-- DZ Dimère de protéine Spécificité: phosphosérine Domaine 100 aa Spécificité: extrémité C-terminale ---X-- H hospholipides Domaine «leckstrin Homology» 100 aa Spécificité: interaction avec phospholipides membranaires -E-S/T-D-V-COOH 43 Familles de récepteursr 44

23 rotéines relais et Domaines d Interactiond 45 Activation de relais protéiques sans activité catalytique Amarrage «docking» Adaptateur rotéine G GD Inactif effecteur effecteur GT Activé effecteur effecteur Interactions effectrices effecteur GT effecteur 46

24 léï éïotropie d un signal (1) Récepteur à l EGF : protéine d amarrage Mb Shc Grb2 -sos LCγ rolifération Motilité Différenciation Apoptose I3K 47 léï éïotropie d un signal (2) 48

25 Intégration de différents signaux Régulation de la croissance cellulaire Inter-relations entre différentes voies de signalisation : a. S/u Gα activée pour différents récepteurs couplés aux protéines G b. Transactivation de récepteurs Tyrosine kinases par RCG c. Diversité liée à hétérodimérisation de RTK d. Interaction nucléaire avec les signaux stéroïdiens 49 Requiem du cancer Implication des voies de signalisation de la prolifération ration cellulaire. 50

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus : implication des voies de signalisation intracellulaire du processus de RVD. Audrey Fouchs Confrontées

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Introduction Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Informatique: - stocker les données - éditer les données - analyser les données (computational

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée.

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée. Les thérapies ciblées du cancer Dictionnaire anglais-français autorisé. Calculatrice autorisée. Une thérapie ciblée est un traitement qui agit par un mécanisme spécifique sur des altérations biologiques

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

CANCÉROLOGIE. Cours n 3 :

CANCÉROLOGIE. Cours n 3 : UE2 : Cancérologie Pr Lehmann-Che et Pouessel Mercredi 26 septembre 10h30-12h30 Ronéotypeuse : Aurore Valentin Ronéolectrice : Marion Whiston CANCÉROLOGIE Cours n 3 : De la biologie moléculaire des cancers

Plus en détail

Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO

Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO Techniques de modifications d expression génique au niveau ADN et ARN : ARN interférence, cellules souches embryonnaires, souris KO Fabrice SONCIN Directeur de Recherche INSERM Institut de Biologie de

Plus en détail

L adhérence cellulaire

L adhérence cellulaire UE2 : Biologie cellulaire Migration cellulaire, domiciliation et cancer Chapitre 2 : L adhérence cellulaire Pierre CAVAILLES Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Pattern d expression chez les rongeurs, dans l ovaire humain, et fonction de reproduction dans des modèles de souris transgéniques

Plus en détail

Plan du cours «Biologie du développement»

Plan du cours «Biologie du développement» Plan du cours «Biologie du développement» Partie I : Notions de base de la biologie du développement. Définitions, les principales étapes de l embryogenèse Les facteurs moléculaires contrôlant les processus

Plus en détail

Les techniques de préparation des coupes pour les microscopies optique et électronique

Les techniques de préparation des coupes pour les microscopies optique et électronique Université Mohammed V-Agdal Faculté des Sciences de Rabat Laboratoire de Zoologie et de Biologie générale Les techniques de préparation des coupes pour les microscopies optique et électronique Histologie-Embryologie

Plus en détail

ÉCOLES NORMALES SUPÉRIEURES ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES CONCOURS D ADMISSION SESSION 2013 FILIÈRE BCPST COMPOSITION DE BIOLOGIE

ÉCOLES NORMALES SUPÉRIEURES ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES CONCOURS D ADMISSION SESSION 2013 FILIÈRE BCPST COMPOSITION DE BIOLOGIE ÉCOLES NORMALES SUPÉRIEURES ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES CONCOURS D ADMISSION SESSION 2013 FILIÈRE BCPST COMPOSITION DE BIOLOGIE Épreuve commune aux ENS de Cachan, Lyon, Paris et de l ENPC Durée

Plus en détail

Le rôle de l endocytose dans les processus pathologiques

Le rôle de l endocytose dans les processus pathologiques UE7 Cours n 9 C. LAMAZE 24.11.11 Elise GODEAU (partie1) Guillaume MERGENTHALER (partie2) Le rôle de l endocytose dans les processus pathologiques SOMMAIRE : I. L endocytose à récepteurs : la voie des clathrines

Plus en détail

Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique

Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique Tuteur : Anne Muhr-Tailleux cardiovasculaires et diabète (Equipe 1) Institut

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES L OUTIL IDEAL POUR TOUTES LES DETECTIONS IMMUNOCHIMIQUES pour toutes les techniques immunodosages (EIA/ELISA) dot/ westernblot immunohistochimie immunocytochimie cytométrie en flux quel que soit le système

Plus en détail

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

1 er sujet : ancre GPI et association aux rafts (64 points)

1 er sujet : ancre GPI et association aux rafts (64 points) Université Joseph Fourier - Grenoble I Année 2007-2008 Epreuve de BIO121 1 ère session mai 2008 Durée : 2 heures Les documents, la calculette et le téléphone portable ne sont pas autorisés. Total des points

Plus en détail

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux COUSIN Fabien KERGOURLAY Gilles 19 octobre 2007 Inhibition des défenses de l hôte par les bactéries pathogènes Master 2 MFA Responsable : UE Incidence des paramètres environnementaux Gwennola ERMEL I Détection

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Les cytokines et leurs récepteurs. Laurence Guglielmi laurence.guglielmi@univ-montp1.frli

Les cytokines et leurs récepteurs. Laurence Guglielmi laurence.guglielmi@univ-montp1.frli Les cytokines et leurs récepteurs Laurence Guglielmi laurence.guglielmi@univ-montp1.frli l i@ i 1 Les cytokines et leurs récepteurs 2 mécanismes principaux d interactions cellulaires : - contact membranaire

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral.

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral. - La cytométrie en flux est une méthode d analyse de cellules en suspension, véhiculées à grande vitesse jusqu à une chambre d analyse traversée par des faisceaux lasers. L interaction des cellules avec

Plus en détail

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/ Cours 5 Transmission et remaniement de l information génétique http://rna.igmors.u-psud.fr/gautheret/cours/ 1 Plan Rappels sur la réplication de l ADN Le cycle cellulaire et ses contrôles La mitose Recombinaisons

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada Développement d un traitement pour l ataxie de Friedreich Dr. Jacques P. Tremblay Université Laval Québec, Canada Ataxie de Friedreich Maladie héréditaire Transmission récessive Liée au chromosome 9 Due

Plus en détail

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICE 1 PAGE 406 : EXPERIENCES A INTERPRETER Question : rôles respectifs du thymus et de la moelle osseuse dans la production des lymphocytes.

Plus en détail

L immunoenzymologie. Technique puissante couramment utilisée e en recherche et en diagnostic cificité des anticorps pour leurs nes

L immunoenzymologie. Technique puissante couramment utilisée e en recherche et en diagnostic cificité des anticorps pour leurs nes L immunoenzymologie Technique puissante couramment utilisée e en recherche et en diagnostic Basée e sur la très s grande spécificit cificité des anticorps pour leurs antigènes nes Test qualitatif Détection

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

Imagerie biologique. CARDINET RémyR LARRAUFIE Pierre MASSUÉ Cyriac 24/09/2009

Imagerie biologique. CARDINET RémyR LARRAUFIE Pierre MASSUÉ Cyriac 24/09/2009 Imagerie biologique Etude d articles d scientifiques CARDINET RémyR LARRAUFIE Pierre MASSUÉ Cyriac 24/09/2009 Imagerie biologique Quelques éléments de biologie cellulaire Etude d article d : Limitation

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Master Professionnel. Expression Génique et. e-mail : dess.biotech@ipbs.fr / Tel : +33 (0) 5 61 17 58 59 http://www.m2p-egpr.ups-tlse.

Master Professionnel. Expression Génique et. e-mail : dess.biotech@ipbs.fr / Tel : +33 (0) 5 61 17 58 59 http://www.m2p-egpr.ups-tlse. 24/10/2011 1 Master Professionnel Biotechnologie Master Protéines Recombinantes Expression Génique et Protéines Recombinantes e-mail : dess.biotech@ipbs.fr / Tel : +33 (0) 5 61 17 58 59 http://www.m2p-egpr.ups-tlse.fr/

Plus en détail

Dosages à réactifs marqués

Dosages à réactifs marqués Dosages à réactifs marqués Principe = réaction Ag-Ac un des deux réactifs (Ag ou Ac) est marqué par un traceur Différentes méthodes selon que le traceur est radioactif (RIA), enzymatique (EIA) ou luminescent

Plus en détail

Génie Génétique. Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris L3 IMS ISSBA

Génie Génétique. Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris L3 IMS ISSBA L3 IMS ISSBA Génie Génétique Characterization of a Brassica napus Myrosinase Expressed and Secreted by Pichia pastoris COLONIER Thomas, DOMEN Robin, GUERIN Nathan Filière Biotechnologie L3 IMS ISSBA La

Plus en détail

Immunité adaptative : activation et polarisation des lymphocytes T.

Immunité adaptative : activation et polarisation des lymphocytes T. Immunité adaptative : activation et polarisation des lymphocytes T. Marcelo de Carvalho, Olivier Adotévi, Valérie Frenkel, Gilles Thibault, Richard Le Naour I-Introduction... 2 II-Activation des lymphocytes

Plus en détail

Chapitre 7 : Structure de la cellule Le noyau cellulaire

Chapitre 7 : Structure de la cellule Le noyau cellulaire UE2 : Structure générale de la cellule Chapitre 7 : Structure de la cellule Le noyau cellulaire Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

Les grandes voies de transmission du signal en cancérologie : où en sommes-nous?

Les grandes voies de transmission du signal en cancérologie : où en sommes-nous? Les grandes voies de transmission du signal en cancérologie : où en sommes-nous? Dynamique des réseaux de signalisation et réponse aux thérapies ciblées Pascal GAUDUCHON Unité "Biologie et Thérapies Innovantes

Plus en détail

Le cycle cellulaire: Introduction

Le cycle cellulaire: Introduction Le cycle cellulaire: Introduction Dr Gerardo Ferbeyre Département de biochimie, E515 g.ferbeyre@umontreal.ca A étudier pour l examen L étude du cycle cellulaire est fascinante: Permet la compréhension

Plus en détail

ULBI 101 Biologie Cellulaire L1. Le Système Membranaire Interne

ULBI 101 Biologie Cellulaire L1. Le Système Membranaire Interne ULBI 101 Biologie Cellulaire L1 Le Système Membranaire Interne De la nécessité d un SMI Le volume augmente comme le cube de la dimension linéaire, alors que la surface n'est augmentée que du carré Une

Plus en détail

L INSTITUT DE RECHERCHE EN

L INSTITUT DE RECHERCHE EN 1 L INSTITUT DE RECHERCHE EN IMMUNOLOGIE ET EN CANCÉROLOGIE COMMERCIALISATION DE LA RECHERCHE VISION Être un centre reconnu internationalement pour ses activités de maximisation de la valeur de la recherche

Plus en détail

La reconnaissance moléculaire: la base du design rationnel Modélisation moléculaire: Introduction Hiver 2006

La reconnaissance moléculaire: la base du design rationnel Modélisation moléculaire: Introduction Hiver 2006 La reconnaissance moléculaire: la base du design rationnel En 1890 Emil Fisher a proposé le modèle "serrure et clé" pour expliquer la façon de fonctionner des systèmes biologiques. Un substrat rentre et

Plus en détail

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1)

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) Apport de la Biologie Cellulaire et Moléculaire aux innovations médicales (bases et prérequis de biologie cellulaire

Plus en détail

Bêta-oxydation des acides gras

Bêta-oxydation des acides gras O C N C 2 O C 2 SO 3 O O acide taurocholique O C N C 2 COO O O O acide glycocholique Figure.2 Structure d un sel biliaire formé par conjugaison entre un acide biliaire (ici l acide cholique) soit avec

Plus en détail

AMINES BIOGENIQUES. Dopamine/Noradrénaline/Adrénaline (CATECHOLAMINES) Sérotonine/Histamine/Dopamine

AMINES BIOGENIQUES. Dopamine/Noradrénaline/Adrénaline (CATECHOLAMINES) Sérotonine/Histamine/Dopamine AMINES BIOGENIQUES Dopamine/Noradrénaline/Adrénaline (CATECHOLAMINES) Sérotonine/Histamine/Dopamine Effets physiologiques des bioamines via le systeme nerveux autonome Cardiovasculaire: Augmentation du

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Introduction à la microscopie confocale

Introduction à la microscopie confocale Introduction à la microscopie confocale Sylvette CHASSEROT-GOLAZ Unité CNRS UPR 2356, Strasbourg Principe de la microscopie confocale La microscopie confocale est l'une des percées les plus notables de

Plus en détail

EXAMEN Deuxième Année des Etudes Médicales

EXAMEN Deuxième Année des Etudes Médicales Université Joseph Fourier FACULTE DE MEDECINE 38700 LA TRONCHE Année Universitaire 2012/2013 EXAMEN Deuxième Année des Etudes Médicales 1ère SESSION UE 5.1 : Biochimie 1 Lundi 4 février 2013 8h30 à 9h30

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

ETUDES FONCTIONELLES SUR MODELES CELLULAIRES

ETUDES FONCTIONELLES SUR MODELES CELLULAIRES ETUDES FONCTIONELLES SUR MODELES CELLULAIRES - LES TECHNIQUES DE FRACTIONNEMENT TISSULAIRE ET CELLULAIRE - LA CYTOMETRIE EN FLUX - LES CULTURES CELLULAIRES Professeur Jean CAMBAR Laboratoire de Biologie

Plus en détail

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire Produire une protéine recombinante Principes et Méthodes de Biologie Moléculaire Gabrielle Potocki-Veronese INSA-Laboratoire Biotechnologie-Bioprocédés Toulouse Equipe Ingénierie Enzymatique Moléculaire

Plus en détail

Caractérisation des interactions protéine ligand par échange 1 H/ 3 H : Application au complexe entre la protéine hasf1 et l histone H3

Caractérisation des interactions protéine ligand par échange 1 H/ 3 H : Application au complexe entre la protéine hasf1 et l histone H3 ORSAY N D ORDRE : 8658 Université de Paris Sud U.F.R. Scientifique d Orsay THESE de DOCTORAT Présentée par : Guillaume Mousseau Pour obtenir le grade de DOCTEUR EN SCIENCES DE L UNIVERSITE PARIS XI ORSAY

Plus en détail

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments»

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» Master In silico Drug Design Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» 30NU01IS INITIATION A LA PROGRAMMATION (6 ECTS) Responsables : D. MESTIVIER,

Plus en détail

Thérapies ciblées : comment déterminer la cible? Myriam Remmelink, MD, PhD Service d Anatomie Pathologique, Bruxelles

Thérapies ciblées : comment déterminer la cible? Myriam Remmelink, MD, PhD Service d Anatomie Pathologique, Bruxelles Thérapies ciblées : comment déterminer la cible? Myriam Remmelink, MD, PhD Service d Anatomie Pathologique, Bruxelles Introduction Le cancer du poumon est le responsable majeur du décès par cancer 1.4

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

Les plateformes de génétique

Les plateformes de génétique Thérapies ciblées : de l anatomopathologie th l à la biothérapie i Les plateformes de génétique moléculaire PO Schischmanoff UF Génétique moléculaire et oncogénétique CHU Avicenne ACP FHF 29 mars 2012

Plus en détail

Chapitre 4. Génotype, phénotype et environnement

Chapitre 4. Génotype, phénotype et environnement Chapitre 4 Génotype, phénotype et environnement Comment s établit le phénotype macroscopique? Le phénotype ne se résume pas toujours à la simple expression du génome, les relations entre génotypes et phénotypes

Plus en détail

Université Louis Pasteur Strasbourg I Ecole Doctorale des Sciences de la Vie et de la Santé THESE. En vue de l obtention du grade de

Université Louis Pasteur Strasbourg I Ecole Doctorale des Sciences de la Vie et de la Santé THESE. En vue de l obtention du grade de Université Louis Pasteur Strasbourg I Ecole Doctorale des Sciences de la Vie et de la Santé THESE En vue de l obtention du grade de Docteur de l Université Louis Pasteur de Strasbourg Discipline : Aspects

Plus en détail

ORIGINE ET DIFFERENTS TYPES DE RYTHMES BIOLOGIQUES. Carine Bécamel carine.becamel@igf.cnrs.fr 04 67 14 29 83

ORIGINE ET DIFFERENTS TYPES DE RYTHMES BIOLOGIQUES. Carine Bécamel carine.becamel@igf.cnrs.fr 04 67 14 29 83 ORIGINE ET DIFFERENTS TYPES DE RYTHMES BIOLOGIQUES Carine Bécamel carine.becamel@igf.cnrs.fr 04 67 14 29 83 INTRODUCTION Rythmes biologiques: définition Tout être vivant (humain, animal, végétal) est soumis

Plus en détail

Université Victor Segalen Bordeaux 2 UFR Science de la Vie

Université Victor Segalen Bordeaux 2 UFR Science de la Vie Université Victor Segalen Bordeaux 2 UFR Science de la Vie Licence Professionnelle «Techniques et Applications en Biologie Cellulaire et Biologie Moléculaire» Examen 2006-2007 UE1 : «Technologies en Biologie

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

la lettre sur la cancérologie a e L es N 7 Juillet 2013 Un regard différent

la lettre sur la cancérologie a e L es N 7 Juillet 2013 Un regard différent ONCO n e w s CA H P P sur la cancérologie c s iblé e i p a e r é Tu m eu qu id es L es s th la lettre i l rs solides et Un regard différent N 7 Juillet 2013 Editorial Bonjour, La CAHPP s est volontairement

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Utilisation des substrats énergétiques

Utilisation des substrats énergétiques Utilisation des substrats énergétiques Collège des Enseignants de Nutrition Date de création du document 2010-2011 Table des matières I Les organes et les substrats... 3 I.1 Les substrats énergétiques...

Plus en détail

DU GÉNOTYPE AU PHÉNOTYPE, RELATIONS AVEC L ENVIRONNEMENT

DU GÉNOTYPE AU PHÉNOTYPE, RELATIONS AVEC L ENVIRONNEMENT DU GÉNOTYPE AU PHÉNOTYPE, RELATIONS AVEC L ENVIRONNEMENT activités Notions construites Mots clés Demander de décrire morphologiquement voisin/ voisine, lui demander son groupe sanguin, ses performances

Plus en détail

Angiogénèse et cancers gynécologique

Angiogénèse et cancers gynécologique Angiogénèse et cancers gynécologique Dr Thibault de La Motte Rouge Compréhension de la biologie tumorale : les années 2000 Perte de l apoptose Auto-suffisance en signal de croissance Insensibilité aux

Plus en détail

Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique,

Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique, Interaction entre les voies de transduction intracellulaire : exemple des puces à ADN. et analyse protéomique, et 1 Niveau d analyse en biologie Interactions Cellule/Cellule TB Génome Transcriptome Voies

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

Survie cellulaire : différences et différenciation Pierre H. Vachon

Survie cellulaire : différences et différenciation Pierre H. Vachon MEDECINE/SCIENCES 2006 ; 22 : 423-9 > Les mécanismes de la régulation de la survie cellulaire et de l apoptose sont d une nature très complexe, impliquant de nombreux intervenants et de nombreuses voies

Plus en détail

La nutrigénomique: l avenir en nutrition animale

La nutrigénomique: l avenir en nutrition animale La nutrigénomique: l avenir en nutrition animale Yves Tarte, dmv Vétérinaire chargé du développement vétérinaire Hill s Pet Nutrition Canada Inc A.T.S.A.Q. Février 2009 La nutrigénomique Science toute

Plus en détail

Les biologistes ont l habitude de représenter le cycle cellulaire par un cercle ou un anneau divisé en quartiers,

Les biologistes ont l habitude de représenter le cycle cellulaire par un cercle ou un anneau divisé en quartiers, ANNEXE XIIIIII CONTRÔLE DU CYCLE CELLULAIRE Les biologistes ont l habitude de représenter le cycle cellulaire par un cercle ou un anneau divisé en quartiers, correspondant aux quatre phases principales

Plus en détail

UE 2 Biologie cellulaire Endocytose- Exocytose 22/09/2011

UE 2 Biologie cellulaire Endocytose- Exocytose 22/09/2011 UE 2 Biologie cellulaire Endocytose- Exocytose 22/09/2011 Hicham Bouhlal Laboratoire d Immunologie UFR Médecine, Amiens hicham.bouhlal@u- picardie.fr 009/2010 PCEM 1 Biologie Cellulaire P. Lemarchand IntroducKon

Plus en détail

Identification de mécanismes de régulation des fonctions des interférons: Rôle de la palmitoylation du récepteur de l interféron de type I

Identification de mécanismes de régulation des fonctions des interférons: Rôle de la palmitoylation du récepteur de l interféron de type I Identification de mécanismes de régulation des fonctions des interférons: Rôle de la palmitoylation du récepteur de l interféron de type I Julie Claudinon To cite this version: Julie Claudinon. Identification

Plus en détail

5.5.5 Exemple d un essai immunologique

5.5.5 Exemple d un essai immunologique 5.5.5 Exemple d un essai immunologique Test de grossesse Test en forme de bâtonnet destiné à mettre en évidence l'hormone spécifique de la grossesse, la gonadotrophine chorionique humaine (hcg), une glycoprotéine.

Plus en détail

Les cellules vivantes sont les briques élémentaires du. Mécano-sensibilité cellulaire : adaptation physique à la rigidité

Les cellules vivantes sont les briques élémentaires du. Mécano-sensibilité cellulaire : adaptation physique à la rigidité Mécano-sensibilité cellulaire : adaptation physique à la rigidité La rigidité des tissus joue un rôle important dans de nombreux processus physiologiques comme la migration cellulaire ou la différentiation

Plus en détail

Durée i1 24 h. TD 24 h Semestre 3 Objectifs. Savoir présenter un rapport de travail en anglais et commenter le déroulement d une expérimentation.

Durée i1 24 h. TD 24 h Semestre 3 Objectifs. Savoir présenter un rapport de travail en anglais et commenter le déroulement d une expérimentation. SOM3AG23 scientifique 2 Le semestre 3 et 4 Maquette enseignements Intitulé ECTS Coeff. CM TD TP scientifique 2 3 3 24 Biostatistiques 2 3 3 12 12 Synthèse documentaire et projet stage 2 2 6 Filières professionnelles

Plus en détail

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr Biologie Appliquée Dosages Immunologiques TD9 Mai 2015 Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr 1 ELISA 2 3 4 [Ac] 5 6 7 8 9 Correction : Faire la moyenne D0-1 et D0-2 pour toute les valeurs

Plus en détail

Structure et fonction des protéines

Structure et fonction des protéines Structure et fonction des protéines 2012-2013 Partie 1 : Repliement et structure tertiaire marie-line.garron@afmb.univ-mrs.fr L2 Structures des polypeptides Structure Primaire: séquence linéaire des acides

Plus en détail

Chapitre 2 - Complexité des relations entre génotype et phénotype

Chapitre 2 - Complexité des relations entre génotype et phénotype Chapitre 2 - Complexité des relations entre génotype et phénotype Chaque chromosome est en double exemplaire Donc chaque gène (situé sur son locus) est en double exemplaires : et peut être sous différente

Plus en détail

E.I.A CARDIO : BIOLOGIE

E.I.A CARDIO : BIOLOGIE E.I.A CARDIO : BIOLOGIE A SAVOIR ABSOLUMENT( ou pas ) - La formule de Friedewald et ses conditions d application - Les différentes classes de dyslipidémie - Les différents facteurs de risques cardiovasculaires

Plus en détail

METABOLISME DES LIPOPROTEINES

METABOLISME DES LIPOPROTEINES 1 Chapitre 19 Pr Claude ZINSOU METABOLISME DES LIPOPROTEINES OBJECTIFS De l enseignant Compléter les connaissances relatives au métabolisme des lipides, dans lequel nous avons insisté sur leur dégradation

Plus en détail

Contrôle de l'expression génétique : Les régulations post-transcriptionnelles

Contrôle de l'expression génétique : Les régulations post-transcriptionnelles Contrôle de l'expression génétique : Les régulations post-transcriptionnelles http://perso.univ-rennes1.fr/serge.hardy/ utilisateur : biochimie mot de passe : 2007 L'ARNm, simple intermédiaire entre le

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Hépatite chronique B Moyens thérapeutiques

Hépatite chronique B Moyens thérapeutiques Hépatite chronique B Moyens thérapeutiques Dr Olfa BAHRI Laboratoire de Virologie Clinique Institut Pasteur de Tunis INTRODUCTION Plus de 300. 10 6 porteurs chroniques de VHB dans le monde Hépatite chronique

Plus en détail

Biotechnologies chez le lapin

Biotechnologies chez le lapin La partie de l'image avec l'id de relation rid4 n'a pas été trouvé dans le fichier. 24/10/2012 Biotechnologies chez le lapin Thierry JOLY & Marielle AFANASSIEFF GFPC 23/10/2012 Pourquoi le lapin? Elevage:

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail