voies de signalisation

Dimension: px
Commencer à balayer dès la page:

Download "voies de signalisation"

Transcription

1 Olivier Lascols Faculté de Médecine ierre et Marie Curie Généralités s sur les voies de signalisation 1 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? 2. Quels relais intracellulaires? 3. Spécificité de ces relais intracellulaires? II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs 2. léïotropie d un signal 3. Intégration de signaux par la cellule 2

2 La transduction des signaux: généralitg ralités Début des années 1980 ligand Système d amplification arrivée du signal membrane R transduction par récepteur? émission intracellulaire du signal quels seconds messagers? quels relais? Cibles cellulaires effets biologiques 3 La transduction des signaux aujourd hui ligand 1 ligand 2 ligand 3 Stratégie de signalisation : Directe : ligand 1 Indirecte: ligand 2 ou 3 R Transports R R Etablissement de réseaux complexes par les progrès en biologie cellulaire et moléculaire : Clonage de gènes NOAU Métabolisme Modèles cellulaires : Modification d expression de protéines Mutagénèse dirigée Modèles animaux : Souris Knock-out Souris Knock-in 4

3 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF (Epidermal( Growth Factor) 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 5 Méthodologie d éd étude des récepteursr ETAE MATERIEL METHODES RESULTATS Localisation. tissus. Test de liaison. cellules -autoradiographie - microscopie prolifération électronique différenciation. Effets biologiques apoptose Localisation.membranes. fractionnement Cellulaire. cytosol subcellulaire capacité. test de liaison spécificité Caractérisation protéines. solubilisation. Structure. Activité solubilisées. test de liaison nature, taille enzyme. électrophorèse. immunoprécipitation. test d activité Sélection. récepteurs. chromatographie purifiés d affinité (Ab, ligand). test de liaison Clonage. ADNc. Criblage de banque. Séquence protéique. Domaines spécialisés. Expression du récepteur Structure /. récepteurs. Mutagénèse dirigée. Mode de transduction Fonction mutés. transfection. cellules cystéine transmb TK tyrosines 6

4 Interaction Ligand Récepteur L + R Spécificité *L : ligand radioactif LR LR totale *L + R + X *LR + *LX fixation totale *L + R *LR fixation spécifique L : excès de ligand «froid» *L + L + X *LX + LX fixation non spécifique Réversible spécifique non spécifique Saturable : nombre de site récepteur défini = Ro 7 Etude de la structure du récepteurr Structure fixant l EGF liaison de 125 I-EGF 125 I-EGF + R 125 I-EGF/R pontage covalent 125 I-EGF + R 125 I-EGF/R électrophorèse en SDS autoradiographie Identification par Western blot DSS 8

5 Clonage d une d protéine cellule rotéine purifiée ARNm séquence partielle en acides aminés Lys-prol-trp-tyr-asp-ser-cys-ala séquence nucléotidique AAGTCCTGCGGTGACAACGGTCG = SONDE ADNc vecteur recombinant Banque d ADNc Criblage de la banque Séquence I en aa de la protéine ADNc du gène Séquence nucléotidique complète Expression de la protéine Mutagénèse dirigée roduction d anticorps 9 Etude structure fonction Construction de mutants du récepteur à l EGF Répétitions riche en leucine Domaine riches en cystéine Autophosphorylation des mutants EGFR Domaine Tyrosine Kinase Domaine C-terminal 10

6 Activation d un d récepteur r tyrosine kinase (TK) Mb 2. hosphorylation sur des résidus tyrosines de substrats endogènes TK AT TK AD 1. Autophosphorylation sur des résidus tyrosines du récepteur substrat substrat AT AD 11 Activation par dimérisation et transphosphorylation Apport de la cristallographie et de la bioinformatique : Structure 3D a. Forme repliée d EGFR: -faible affinité de liaison de l EGF - pas d activité kinase b. Fixation de l EGF: - changement conformationnel du monomère (allostérie) - démasquage de la boucle de dimérisation. b. Dimérisation: - dos à dos - activation de la tyrosine kinase 12

7 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 13 Etude des interactions : entre molécules connues Activation par le ligand Immunoprécipitation des complexes formés avec anticorps spécifique Séparation des constituants du complexe par électrophorèse Visualisation des protéines par immunoblot avec des anticorps spécifiques 14

8 Application Implication de Grb2 dans la voie de signalisation induite par EGF I : immunoprécipitation IB : immunoblot Lors de l activation par EGF: 1. Le récepteur à l EGF change de taille apparente 2. Le récepteur à l EGF est phosphorylé sur une tyrosine 3. Induction d une interaction entre EGFR et Grb2 15 Clonage d un d nouveau partenaire Fragment EGFR marqué Banque d expression d ADNc I Criblage de la banque Clones positifs radioactifs Séquençage des ADN Expression de la protéine roduction d anticorps Immunoprécipitation Immunoblot 16

9 Système double hybride (1) BD : Binding Domain AD : Activating Domain UAS : Upstream Activating Sequence 17 Système double hybride (2) Criblage d une d librairie d expressiond 18

10 Etude de la localisation d un d relais ADNc de protéine relais ADNc de protéine TAG ADNc de protéine chimère Expression de la protéine chimère stimulation par le ligand Localisation de la protéine chimère si TAG fluorescent Ex: GF Green Fluorescent rotein si TAG non fluorescent Ab fluorescent anti-tag Microscopie confocale en lumière fluorescente 19 b. La voie d activation d des MAK par l EGF l : recrutement d un d premier relais par EGFR activé Domaine SH2 Domaine SH3 Mb TK TK TK TK Grb2 : Growth Receptor Bound rotein sos : son of sevenless Grb2 sos 1. Complexe Grb2/sos 2. Interaction entre Tyr- et SH2 Grb2 sos Grb2 sos 3. Localisation à la membrane de sos 20

11 Activation d un d 2ème 2 relais membranaire Mb TK TK Grb2 sos ras GD ras GT ras : petite protéine G myristoylée localisation membranaire 1. Interaction sos ras 2. Echange GD-GT 21 Cycle d activationd activation-inactivation inactivation de la protéine ras ras GD i GT GTase GA SIGNAL rotéine d échange ras GD GT rotéine Effectrice Conduction du SIGNAL rotéine G : régulation allostérique activité GTase sos : protéine d échange Raf1 : protéine effectrice GA : GTase activating protein 1. ras.gd inactive 2. Echange GD-GT 3. Ras GT active 4. Interaction protéine effectrice 5. Hydrolyse du GT 22

12 Structure de la Kinase Raf-1 CR : conserved region CRD : cystein rich domain RBD : ras binding domain S : sérine T : thréonine : tyrosine 23 Modèle d activation d de Raf Ras et raf inactives 2. Activation ras - interaction raf 3. Activation de raf et déplacement de la protéine raf: sérine/thréonine kinase, phosphorylable par Src ou prot X (Current Opinion in Cell Biology (1997) 9: ) 24

13 Activation d une d cascade de Kinases Raf1 MEK Ser Ser AT AD Ser Ser Noyau MAK Thr Tyr AT AD Thr Tyr activation de la transcription MEK : MAK ou ERK Kinase MAK : Mitogen-Activated rotein Kinase 1. Raf1 ser/thr kinase sur MEK 2. MEK thr/tyr kinase sur MAK 3. Translocation MAK nucléaire 25 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique de l EGF 1. Quel récepteur? Méthodologie d étude des récepteurs localisation, nature, spécificité, activité, clonage, structure/fonction 2. Quels relais intracellulaires? a. Méthodes d étude test de protéines connues, recherche de nouveaux partenaires, localisation b. La voie d activation des MA Kinases par l EGF 3. Spécificité de ces relais intracellulaires? a. Méthodes d étude inhibiteurs pharmacologiques, stratégie antisens, transgénèse b. Intégration des 3 dimensions : nature, lieu, temps 26

14 Inhibition pharmacologique des voies de signalisation oints d impact sur la voie mitogénique de l EGF Facteur de croissance RTK Inhibiteur Tyrosine Kinase Inhibiteur de SH3 Anticorps SH2 Grb2, Shc Inhibiteur de SH2 sos Inhibiteur d échange Ras Inhibiteur de Ras Raf Inhibiteur de Raf Inhibiteur de MAKK LCg I3K T Inhibiteur de farnésylation de Ras MAKK MAK Inhibiteur Inhibiteur Inhibiteur Inhibiteur de MAK Noyau 27 Inhibition pharmacologique des voies de signalisation 28

15 Stratégies de modification d une d voie de signalisation (1) Antisens RNA silencing Transfection cellulaire Transgénèse chez l animal Antisens RNA silencing Théorie du RNAi (RNA interférence) rix Nobel de médecine et de physiologie 2006 : Andrew Fire et Craig Mello. Éléments de régulation cellulaire Outils d étude 29 Stratégies de modification d une d voie de signalisation (2) RNA silencing Dicer: hélicase/rnase RISC : RNA-induced silencing complexes Application: synthèse in vitro de sirna ciblé et transfection dans les cellules 30

16 Stratégies de modification d une d voie de signalisation (3) Transfection cellulaire Transfection d un gène normal ou muté dans une cellule hôte Surexpression de forme mutée «dominant négatif» 31 Stratégies de modification d une d voie de signalisation (4) Transgénèse chez l animal Surexpression d un gène : transgénèse additive Invalidation d un gène : transgénèse substitutive par recombinaison homologue : souris Knock-Out (KO) Cellules ES : cellules souches embryonnaires 32

17 Stratégies de modification d une d voie de signalisation (5) Invalidation d un gène : souris hétérozygotes et homozygotes Knock-out conditionnel et spécifique de tissu: système CRE-Lox rocessus de recombinaison sous contrôle d un promoteur spécifique de tissu Substitution d un gène par un autre : souris Knock-in (KI) 33 b. Intégration des 3 dimensions : nature, lieu, temps Quelle spécificité du signal? Car nombreux éléments communs : rincipes d activation Intermédiaires communs Interactions protéine-protéine Effets biologiques Régulation spatio-temporelle : Compartimentalisation Cinétique des activations 34

18 Nature : spécificit cificité des signaux et des récepteurs r (1) Diversité des ligands Dimérisation de diverses isoformes du récepteur à l EGF : - HER1 (ou EGFR ou erbb1), HER2, HER3 et HER4. Rq: HER3 est dépourvu d activité tyrosine kinase. - Homo- ou hétérodimères - Expression variable 35 Nature : spécificit cificité des signaux et des récepteurs r (2) Dimérisation et diversité des effets biologiques. 36

19 Nature : voies des MAKs Familles de MAK : ERK1, 2, 3 JNK1, 2, 3 p38 α,β,γ,δ Activation par cascade de phosphorylation: MAKKK (MEKK) : ser/thr kinase MAKK (MEK): ser/thr et tyr kinases Signaux cellulaires: Cycle cellulaire Différenciation Survie/apoptose Localisation des cibles: Cytosolique Nucléaire 37 LIEU : SCAFFOLD, ANCHOR, DOCKING, ADATOR rotéines d assemblage d de complexes macromoléculaires culaires 3 rôles clés dans les voies de tranduction de signaux : 1. Reproupe les composants de la voie de signalisation dans un complexe multiprotéique très spécifique 2. Efficacité : présente les substrats aux enzymes séquentiellement et dans une orientation idéale pour une efficacité optimum. 3. Cible le complexe et donc le signal vers une localisation cellulaire spécifique 38

20 Complexe multiprotéique ique avec KSR Localisation cytosolique KSR constitutivement associé : MEK, , phosphatase inactive (2A) IM (impedes mitogenic signal propagation) kinases (C-TAK, etc ) Régulation par phosphorylation/dépho s-phorylation 39 Compartimentalisation et durée e du signal Réponses différentielles des ERK aux facteurs de croissance: EGF et DGF Réponse spatio- temporelle spécifique sur des fibroblastes 40

21 Bilan des régulations r spatio-temporelles temporelles d ERK et des réponses r cellulaires Effet spécifique dépend du type cellulaire Fibroblastes Cellules C12 : EGF : prolfération cellulaire NGF : différentiation neuronale Effet spécifique dépend de la durée, de l intensité et de la localisation cellulaire du signal. Ebisuya, M. et al. J Cell Sci 2005;118: II. Le réseau r de la signalisation cellulaire 1. Interactions et transducteurs a. Domaines spécialisés d interaction b. Familles de récepteurs c. Diversité des relais 2. léïotropie d un signal 3. Intégration de signaux par la cellule 42

22 Domaines protéiques pour des interactions spécifiques Site secondaire Site primaire SH2 I --X-X-hy- Domaine «Src Homology 2» 100 aa Spécificité: phosphotyrosine et environnement côté C-terminal SH3 Domaine «Src Homology 3» 60 aa Spécificité: proline TB I -hy-x-n--x-- Domaine «hospho-tyrosine Binding» 200 aa Spécificité: phosphotyrosine et environnement côté N-terminal --X-X--X- WW Domaine avec Tryptophane (W) 40 aa Spécificité: proline I -R-S-X-S-X-- DZ Dimère de protéine Spécificité: phosphosérine Domaine 100 aa Spécificité: extrémité C-terminale ---X-- H hospholipides Domaine «leckstrin Homology» 100 aa Spécificité: interaction avec phospholipides membranaires -E-S/T-D-V-COOH 43 Familles de récepteursr 44

23 rotéines relais et Domaines d Interactiond 45 Activation de relais protéiques sans activité catalytique Amarrage «docking» Adaptateur rotéine G GD Inactif effecteur effecteur GT Activé effecteur effecteur Interactions effectrices effecteur GT effecteur 46

24 léï éïotropie d un signal (1) Récepteur à l EGF : protéine d amarrage Mb Shc Grb2 -sos LCγ rolifération Motilité Différenciation Apoptose I3K 47 léï éïotropie d un signal (2) 48

25 Intégration de différents signaux Régulation de la croissance cellulaire Inter-relations entre différentes voies de signalisation : a. S/u Gα activée pour différents récepteurs couplés aux protéines G b. Transactivation de récepteurs Tyrosine kinases par RCG c. Diversité liée à hétérodimérisation de RTK d. Interaction nucléaire avec les signaux stéroïdiens 49 Requiem du cancer Implication des voies de signalisation de la prolifération ration cellulaire. 50

étude des voies de signalisation

étude des voies de signalisation Olivier Lascols Faculté de Médecine ierre et Marie Curie Stratégie d éd étude des voies de signalisation 1 I. Caractérisation risation d une d voie de transduction d un d signal Exemple du Signal Mitogénique

Plus en détail

Les récepteurs à activité enzymatique intrinsèque

Les récepteurs à activité enzymatique intrinsèque Les récepteurs à activité enzymatique intrinsèque Différentes activités enzymatiques intrinsèques ont été mise en évidence : Activité tyrosine kinase (TK) Ex : le récepteur au DGF, à l EGF ou les récepteurs

Plus en détail

VOIE DES PHOSPHOINOSITIDES

VOIE DES PHOSPHOINOSITIDES VOIE DES HOSHOINOSITIDES LE DIACYLGLYCEROL ACTIVE LA KC L INOSITOL TRI HOSHATE (I3) ROVOQUE LA LIBERATION DE Ca ++ INTRACELLULAIRE (10-6 M Ca ++ ) Ca ++ pompe [Ca ++ ] extra-cellulaire (sang) 2.5 mm (2,5.10-3

Plus en détail

réponse cellulaire: Prolifération, Différenciation, survie,apoptose

réponse cellulaire: Prolifération, Différenciation, survie,apoptose Signalisation : Concept Stimuli extérieurs: Facteurs de croissance, Hormones Cytokines Interaction cellule/cellule Récepteur cellule ropagation du signal Somme des évènements moléculaires Intracellulaires

Plus en détail

TYROSINES KINASES ET CANCER

TYROSINES KINASES ET CANCER I/ GÉNÉRALITÉ SUR SIGNALISATION CELLULAIRE TYROSINES KINASES ET CANCER Les cellules fonctionnent en harmonie via des transferts d information, c est la signalisation. Le signal passe directement dans la

Plus en détail

Les bases de la transduction du signal des lymphocytes T

Les bases de la transduction du signal des lymphocytes T Frédéric VELY frederic.vely@ap-hm.fr MCU-PH Laboratoire d Immunologie - Hôpital de la Conception Lab of NK cells and Innate Immunity - Centre d Immunologie de Marseille-Luminy Les bases de la transduction

Plus en détail

Anomalies moléculaires et ciblage thérapeutique

Anomalies moléculaires et ciblage thérapeutique Anomalies moléculaires et ciblage thérapeutique Tumeurs solides Jacques Robert ISERM U916 Institut Bergonié Université de Bordeaux 2 Anomalies moléculaires des cancers Autosuffisance en facteurs de croissance

Plus en détail

LA PROLIFÉRATION CELLULAIRE. Pr J-L. MERLIN

LA PROLIFÉRATION CELLULAIRE. Pr J-L. MERLIN ASECTS MOLÉCULAIRES DE LA ROLIFÉRATION CELLULAIRE r J-L. MERLIN ASECTS MOLECULAIRES DE LA ROLIFERATION «Vers de nouvelles cibles thérapeutiques» r. Jean-Louis Merlin Faculté de harmacie, Université Henri

Plus en détail

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE TOUT D ABORD UN PETIT HISTORIQUE 1910: Peyton ROUS découvre le virus qui porte son nom 1976: les oncogènes de certains virus ont une contrepartie cellulaire

Plus en détail

Les récepteurs à activité tyrosine kinase

Les récepteurs à activité tyrosine kinase Les récepteurs à activité tyrosine kinase Introduction Dr de Cremoux Hôpital Saint Louis, Université aris Diderot Récepteurs à activité tyrosine kinase latelet-derived growth factor Epidermal growth factor

Plus en détail

Le récepteur de l insuline

Le récepteur de l insuline Le récepteur de l insuline Tarik ISSAD Directeur de Recherche CNRS Institut Cochin Département de Biologie Cellulaire 22 rue Méchain, 75014 PARIS issad@cochin.inserm.fr 1. Quelques rappels : le rôle de

Plus en détail

INTERACTIONS PROTEINE - PROTEINE

INTERACTIONS PROTEINE - PROTEINE INTERACTIONS PROTEINE - PROTEINE 1. Introduction Les génomes de différentes espèces ayant été séquencés ces dernières années, la majorité des efforts de la communauté scientifique se porte aujourd hui

Plus en détail

Les différentes voies de transduction. Transduction du signal : De la membrane au noyau. Récepteurs tyrosine kinase-linked

Les différentes voies de transduction. Transduction du signal : De la membrane au noyau. Récepteurs tyrosine kinase-linked Les différentes voies de transduction Transduction du signal : De la membrane au noyau Molécules liposolubles à récepteur membranaire prostaglandines et leukotriènes Peptides et protéines récepteurs membranaires

Plus en détail

TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B

TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B M1 immuno 11/12/07 RT : Sauvet gabriella TRANSDUCTION DU SIGNAL DES RECEPTEURS T ET B 1- Stimulation des lymphocytes par l antigène 2- Plusieurs protéines membranaires «aident» le récepteur de l antigène

Plus en détail

Partie III: Récepteurs membranaires. RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines

Partie III: Récepteurs membranaires. RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines Partie III: Voies de signalisation des récepteurs Tyrosine kinases (RTK) Récepteurs membranaires À activité enzymatique Sans activité enzymatique RTK RTP Canaux Couplés R (RYK) (RYP) ioniques Prot G cytokines

Plus en détail

Durée de l'épreuve: 3 heures. (Pas de documents autorisés) Sujet 1 (8 points). Pathologies des cils et des flagelles, et kinésines.

Durée de l'épreuve: 3 heures. (Pas de documents autorisés) Sujet 1 (8 points). Pathologies des cils et des flagelles, et kinésines. Université de la Méditerranée Année universitaire 2002-2003 Faculté des Sciences de Luminy Département de Biologie Maîtrise de Biologie Cellulaire Module optionnel "Dynamique Cellulaire" Première session

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin.

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin. INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I La transfection Responsable : Valérie Chopin LBH semestre 6 Faculté des Sciences Laboratoire de Physiologie Cellulaire et

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

un exercice d équilibre

un exercice d équilibre un exercice d équilibre hysiologique athologique Trafic intracellulaire, Actine ADN Ras ATM Raf, I3K, Ral MAK Cdc25B S G2 Transcription, rolifération, Différenciation G1 M Contrôle du cycle, Réparation,

Plus en détail

II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux

II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux II/ Exemple de cellules différenciées : les cellules nerveuses 1) Structure du tissu nerveux Neurones et cellules gliales 2) neurone Schéma d un motoneurone Les nombreux prolongements cytoplasmiques (dendrites

Plus en détail

Docteur Serge BOTTARI

Docteur Serge BOTTARI Biologie Cellulaire Chapitre 5 : L adhérence cellulaire : les protéines d adhérence cellule-matrice extracellulaire Docteur Serge BOTTARI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble

Plus en détail

Polykystose hépatique. ADPK(L)D Histologie. Cytokératine 7. Mucicarmin

Polykystose hépatique. ADPK(L)D Histologie. Cytokératine 7. Mucicarmin olykystose hépatique ADK(L)D Histologie Cytokératine 7 A B HES C Mucicarmin D rolifération cellulaire (C. Housset) 1.1. Le cycle cellulaire 1. Le cycle cellulaire 2. oints de contrôle du cycle cellulaire

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

BC4223 Mécanismes moléculaires SIGNALISATION 3.2 RÉCEPTEURS CATALYTIQUES

BC4223 Mécanismes moléculaires SIGNALISATION 3.2 RÉCEPTEURS CATALYTIQUES Controle de l'activite cellulaire transduction Mise à jour: 20 03 07 BC4223 Mécanismes moléculaires SIGNALISATION 32 RÉCEPTEURS CATALYTIQUES Hormones impliquées récepteurs autophosphorylation autres composantes

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus : implication des voies de signalisation intracellulaire du processus de RVD. Audrey Fouchs Confrontées

Plus en détail

UE Communication Cellulaire Les récepteurs catalytiques

UE Communication Cellulaire Les récepteurs catalytiques UE Communication Cellulaire Les récepteurs catalytiques Cours LBM L2 S3 10 octobre 2013 (3h) Les récepteurs liés à une activité enzymatique 1-Récepteurs-Enzyme : Définition 2-Structure et activité enzymatique

Plus en détail

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk actif Différentes Cdk peuvent s associer avec différentes Cyclines Cdk active: tyrosine et thréonine Kinase (phosphoryle

Plus en détail

Les voies de signalisation intracellulaire : la protéine Rab5

Les voies de signalisation intracellulaire : la protéine Rab5 UMR CNRS : 7213 Laboratoire de biophotonique et pharmacologie Equipe de signalisation cellulaire : Signalisation intracellulaire et protéines transmembranaires Les voies de signalisation intracellulaire

Plus en détail

SIGNALISATION CELLULAIRE

SIGNALISATION CELLULAIRE SIGNALISATION CELLULAIRE Voies de communication cellulaire A distance Par contact direct Voies de communication cellulaire SIGNALISATION (en) signal transduction - Terme specifique MEDLINE - 1972-3 elements

Plus en détail

Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation

Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation Corrélation entre l activité MPF et le taux de cycline Mesures dans l embryon de xénope après fécondation Mitose Mitose Mitose Interphase Interphase Interphase Activité MPF Quantité de cycline B Corrélation

Plus en détail

FRET ( Förster / fluorescence resonance energy transfer )

FRET ( Förster / fluorescence resonance energy transfer ) FRET ( Förster / fluorescence resonance energy transfer ) I - Théorie II - Méthodes de mesure III - Applications à des études biologiques IV - Un exemple de l utilisation du FRET : étude de l interaction

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

A) Domaines et prényls de protéines RAS (super-famille)

A) Domaines et prényls de protéines RAS (super-famille) CHAPITRE 2 : PROTÉINES G MONOMÉRIQUES Ce sont des intégrateurs moléculaires des voies de signalisation, des «commutateurs multipositions». Elles sont constituées d une sous-unité α, existent chez les eucaryotes

Plus en détail

La découverte de médicaments en biotechnologie. Recherche ou innovation?

La découverte de médicaments en biotechnologie. Recherche ou innovation? La découverte de médicaments en biotechnologie La découverte de médicaments en biotechnologie Initiation du projet Quel type de médicament? Processus complet Quelques exemples 2 1 février 2007 Initiation

Plus en détail

Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010

Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010 Pourquoi et comment participer à la collecte d échantillons en cancérologie? Conférence-débat Dijon le 8 octobre 2010 Dr Laurent ARNOULD Département de Biologie et de Pathologie des Tumeurs Centre G-F

Plus en détail

Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2

Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2 Biochimie Mme Botti et Mme tchillian Le 22/10/07 Defresne Diane TD N 3 DE BIOCHIMIE LES ANTICORPS 2 1 DOMAINE D UTILISATION DES ANTICORPS IN VITRO ET IN VIVO B)Utilisation des Anticorps in vitro - dosages

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

REGULATION DE L EXPRESSION DES GENES.

REGULATION DE L EXPRESSION DES GENES. REGULATION DE L EXPRESSION DES GENES. Modification épigénétiques : viennent s ajouter à la séquence nucléotidique. La séquence nucléotidique est transmise intacte de la cellule mère à la cellule fille.

Plus en détail

Signalisation cellulaire. Cours n 2 (19/09/13)

Signalisation cellulaire. Cours n 2 (19/09/13) Signalisation cellulaire Cours n 2 (19/09/13) C) Les protéines de la signalisation : Les protéines kinases Les protéines phosphatases Les Guanosines Triphosphatases (GTPases) Les protéines adaptatrices

Plus en détail

Génération d anticorps monoclonaux par immunisation génique

Génération d anticorps monoclonaux par immunisation génique Génération d anticorps monoclonaux par immunisation génique Gen2Bio 2010 Saint-Malo, mardi 30 mars 2010 Un partenariat Demandeur PADAM In Cell Art Projet Anticorps monoclonaux Gen2Bio 2010 Saint-Malo,

Plus en détail

Docteur Laurent PELLETIER

Docteur Laurent PELLETIER Biologie Cellulaire Chapitre 4 : La communication inter-cellulaire via les récepteurs membranaires Partie 2 Docteur Laurent PELLETIER MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble -

Plus en détail

Récepteurs tyrosine kinases et cancer

Récepteurs tyrosine kinases et cancer Récepteurs tyrosine kinases et cancer Olivier Schischmanoff Biochimie et biologie moléculaire CHU Avicenne 05 nov 2012 Bichat Plan Généralités sur la signalisation cellulaire Les récepteurs tyrosine kinase

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

SIGNALISATION CELLULAIRE

SIGNALISATION CELLULAIRE SIGNALISATION CELLULAIRE Médiateur Ligand Agoniste Récepteur Seconds messagers Transporter channel altered transport PHYSIOLOGIE ET SIGNALISATION COMMUNICATION CELLULAIRE ET TRANSFERT D'INFORMATION Roles

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

SIGNALISATION DES RECEPTEURS A ITAM ET ITIM

SIGNALISATION DES RECEPTEURS A ITAM ET ITIM Cours d Immunologie Ronéo-Typeur : Anne-Laure Hermann Mardi 4 décembre 17h-19h Sylvain Latour SIGNALISATION DES RECEPTEURS A ITAM ET ITIM SIGNALISATION DES RECEPTEURS A ITAM I)Généralités A.Localisation

Plus en détail

Oncogènes et anti-oncogenes C. Hourioux

Oncogènes et anti-oncogenes C. Hourioux Oncogènes et anti-oncogenes C. Hourioux Définitions : Cancer Multiplication anarchique de cellules échappant aux mécanismes normaux de différenciation et de régulation de leur multiplication Capacité à

Plus en détail

Insulinorésistance et cancers

Insulinorésistance et cancers Insulinorésistance et cancers L insulinorésistance est présente dans de nombreuses situations comme (Godsland I.F. 2009) : - Le vieillissement ; - La sédentarité ; - L obésité abdominale ; - Le diabète

Plus en détail

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser.

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser. AVERTISSEMENT Au fil de l ouvrage, les termes ou les notions importantes développés dans le livre de cours Bases cellulaires et moléculaires du développement (Ellipses, 2007), sont notés (I) ou (I, p.x).

Plus en détail

Signalisation insuline en physiologie et pathologie

Signalisation insuline en physiologie et pathologie UE Métabolisme Energétique P Ferré 2006-2007 Faculté de Médecine Pierre et Marie Curie Jacqueline Capeau Signalisation insuline en physiologie et pathologie Métabolisme énergétique en situation post-prandiale

Plus en détail

V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE-

V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE- Page : 45/ 77 V APPLICATION DES TECHNIQUES DE RET A L ANALYSE DES INTERACTIONS PROTEINE- PROTEINE : CAS DES RECEPTEURS COUPLES AUX PROTEINES G (RCPG) Les RCPG sont des protéines à sept domaines transmembranaires

Plus en détail

CHAP 1: CIBLES DES MEDICAMENTS

CHAP 1: CIBLES DES MEDICAMENTS CHAP 1: CIBLES DES MEDICAMENTS GÉNÉRALITÉS Le Code de la Santé Publique française définit le médicament comme «une substance ou composition présentée comme possédant des propriétés curatives ou préventives

Plus en détail

Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? Année 2005-06

Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? Année 2005-06 Année 2005-06 Inhibition du facteur de transcription Stat 3 par la technique des sirnas, une thérapie à l horizon? MENARD Baptiste LABORDE DIT PERE Samuel 1 SOMMAIRE RESUME..3 I.INTRODUCTION....4 A. Le

Plus en détail

Le cycle cellulaire Régulation normale et pathologique

Le cycle cellulaire Régulation normale et pathologique Année universitaire 2011-2012 MED-2 - Enseignements Thématiques Bases moléculaires et cellulaires des pathologies Le cycle cellulaire Régulation normale et pathologique Planches pour le Campus Virtuel

Plus en détail

APOPTOSE I- CONCEPTS DE L APOPTOSE II- MECANISMES MOLECULAIRES III- APOPTOSE ET PATHOLOGIES IV- PERSPECTIVES THERAPEUTIQUES. A.

APOPTOSE I- CONCEPTS DE L APOPTOSE II- MECANISMES MOLECULAIRES III- APOPTOSE ET PATHOLOGIES IV- PERSPECTIVES THERAPEUTIQUES. A. APOPTOSE I- CONCEPTS DE L APOPTOSE A. Définition B. Circonstances de survenue de l apoptose 1 ) Apoptose physiologique 2 ) Apoptose pathologique C. Modifications morphologiques et biochimiques D. Déroulement

Plus en détail

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3 TABLE DES MATIERES AVANT-PROPOS XI PARTIE A BIOLOGIE MOLECULAIRE 1. LES ACIDES NUCLEIQUES 3 1.1 STRUCTURE DE LA CHAINE POLYNUCLEOTIDIQUE 4 Les bases 4 Les pentoses 5 Nucléosides et nucléotides 5 La chaîne

Plus en détail

L adhérence cellulaire

L adhérence cellulaire UE2 : Biologie cellulaire Migration cellulaire, domiciliation et cancer Chapitre 2 : L adhérence cellulaire Pierre CAVAILLES Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 Introduction Théorie cellulaire : toute cellule est issue d une cellule L information génétique est transmise aux 2 cellules filles à chaque division Le génome

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction Anisotrope : Se dit d'un corps dont les propriétés varient suivant la direction Tropisme : réaction d'orientation des organes d'une plante à une anisotropie de milieu. Exemples : la lumière, la gravité,

Plus en détail

Oncogène 2: Types d altérations génétiques associées aux cancers

Oncogène 2: Types d altérations génétiques associées aux cancers Oncogène 2: Types d altérations génétiques associées aux cancers Partie 1 - Oncogènes dominants, - Oncogènes récessifs, suppresseurs de tumeur - Convergence et ciblage des fonctions Oncogènes physiologiquement

Plus en détail

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 (D après Carpino, N., et al. (2004) Immunity 20:37) Exercice I (noté sur 14 points) Les lymphocytes T jouent un rôle central dans la reconnaissance

Plus en détail

Chapitre 5 : Les modifications post-traductionnelles. Professeur Michel SEVE

Chapitre 5 : Les modifications post-traductionnelles. Professeur Michel SEVE UE1 : Biomolécules (1) : Acides aminés et protéines Chapitre 5 : Les modifications post-traductionnelles Professeur Michel SEVE Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous

Plus en détail

BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30. Sujet avec documents type ENS (partiel) - durée : 2h30

BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30. Sujet avec documents type ENS (partiel) - durée : 2h30 BCPST-Véto 1 Mercredi 14 janvier- Devoir n 4 Durée 3h30 Sujet avec documents type ENS (partiel) - durée : 2h30 Exercice n 1 : La lignification : un marqueur de la différenciation cellulaire. La lignification

Plus en détail

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de vos projets

MAB Solut. MABSolys Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de vos projets Mabsolys-2015-FR:Mise en page 1 03/07/15 14:02 Page1 le département prestataire de services de MABSolys de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Le système endocrine : définitions-généralités

Le système endocrine : définitions-généralités Chapitre 01 : Introduction aux médicaments du système endocrine Page 1 sur 12 Le système endocrine : définitions-généralités Endocrinologie: Science de la régulation à distance des fonctions cellulaires

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

Croissance bactérienne et expression des protéines

Croissance bactérienne et expression des protéines Croissance bactérienne et expression des protéines Stéphane Delbecq Laboratoire de Biologie Cellulaire et Moléculaire EA 4558 «vaccination antiparasitaire» Faculté de Pharmacie sdelbecq@univ-montp1.fr

Plus en détail

Résumé. Delphine Théard

Résumé. Delphine Théard Delphine Théard Département de Biologie Cellulaire, section Biologie Cellulaire des Membranes, Centre Medical Universitaire de Groningue, Université de Groningue, 9713 AV Groningue, Pays-Bas - 135 - Résumé

Plus en détail

Thérapies ciblées et sujets âgés

Thérapies ciblées et sujets âgés Thérapies ciblées et sujets âgés Dr Marie-Paule Sablin Service inter-hospitalier Beaujon-Bichat de cancérologie Le plan Que sont les thérapies ciblées? Leurs indications En pratique chez les sujets agés

Plus en détail

Colle UE2 N 2 2015/2016 Enoncé

Colle UE2 N 2 2015/2016 Enoncé Colle UE2 N 2 2015/2016 Enoncé Ayham ALKASSAB & Julien GARYGA Ce sujet de biologie cellulaire est composé de 10 QCM. L épreuve dure 60 minutes. Chaque QCM compte pour 5 points. L ensemble correspond donc

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr

Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr Olivia Mercier Touzet UMR2724 IRD/CNRS/UM1 Laboratoire de Parasitologie-Mycologie MONTPELLIER olivia.touzet@univ-montp1.fr UE méthodologique : «Outils de manipulations des génomes et d expression des gènes

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

METABOLISME DES VEGETAUX TD N 1

METABOLISME DES VEGETAUX TD N 1 METABOLISME DES VEGETAUX TD N 1 Exercice n 1 Les séquences nucléotidiques des gènes sont proches. 1 Production ATPase: On part de l'adnc de la levure pour savoir si la régulation se fait par la protéine

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

Liste de publication recommandées pour le cours sur les MAP kinases:

Liste de publication recommandées pour le cours sur les MAP kinases: Hervé Enslen INSERM U536 17 rue du Fer à Moulin 75005, Paris Tél: 01-45-87-6157 E-mail: enslen@fer-a-moulin.inserm.fr Liste de publication recommandées pour le cours sur les MAP kinases: - Revues:. Widmann

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm.

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm. M1 Biologie Santé UE Maladies Génétiques et Cancer Année universitaire 2013-2014 ED 1 Jacques Elion jacques.elion@inserm.fr Remerciements Anne Dumay Grégory Gautier CONTEXTE Facteur de transcription Nucléaire

Plus en détail

Les chimiothérapies du cancer colorectal :

Les chimiothérapies du cancer colorectal : Les chimiothérapies du cancer colorectal : Facteurs prédictifs d efficacité des thérapies ciblées Pr Thierry CONROY Centre Alexis Vautrin et CHU de Nancy La voie d EGFR EGF TGFα ligands EGF-r surexprimé

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

De la physico-chimie à la radiobiologie Les radicaux libres

De la physico-chimie à la radiobiologie Les radicaux libres Les nouvelles orientations en radiobiologie et radiopathologie SFRP - 18 novembre 2004 De la physico-chimie à la radiobiologie Les radicaux libres Pr. Monique Gardès-Albert Laboratoire de Chimie-Physique

Plus en détail

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Introduction Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Informatique: - stocker les données - éditer les données - analyser les données (computational

Plus en détail

CRIBLAGE D UN GENE PAR L ARN INTERFERENCE

CRIBLAGE D UN GENE PAR L ARN INTERFERENCE JANOT Caroline Master Immunotechnologies Paris VI TAP Julien Master Biodiversité Paris VI CRIBLAGE D UN GENE PAR L ARN INTERFERENCE Responsables : Linda Kohl Philippe Bastin 2006 Objectifs Le but de notre

Plus en détail

Correction du concours 2010/ 2011 :

Correction du concours 2010/ 2011 : Correction du concours 2010/ 2011 : Chez les mammifères, la dégradation oxydative des acides gras à chaîne longue joue un rôle majeur dans le métabolisme énergétique. Le principal d entre eux est l acide

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Signalisation. (Partie 2) Cours n 2. Mécanismes moléculaires de la transduction des signaux Le métabolisme de l information

Signalisation. (Partie 2) Cours n 2. Mécanismes moléculaires de la transduction des signaux Le métabolisme de l information UE1 Biochimie Pr Hélène CAVE Le 28/09/12 à 15h30 Ronéotypeur: Audrey Campos Ronéolecteur: Anaïs Jenvrin Cours n 2 Signalisation Mécanismes moléculaires de la transduction des signaux Le métabolisme de

Plus en détail

34 -... Les molécules cytoplasmiques ayant un poids moléculaire de plus de 60 kda pénètrent dans le noyau uniquement par transport actif.

34 -... Les molécules cytoplasmiques ayant un poids moléculaire de plus de 60 kda pénètrent dans le noyau uniquement par transport actif. 32 -... Pour pouvoir pénétrer dans le noyau, les protéines nucléaires possèdent toutes au sein de leur séquence le même signal de localisation nucléaire. 33 -... Dans son état inactif, la sous-unité a

Plus en détail

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction

Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Etude des héparan sulfates protéoglycans anticoagulant dans la reproduction Pattern d expression chez les rongeurs, dans l ovaire humain, et fonction de reproduction dans des modèles de souris transgéniques

Plus en détail

ETUDE DE LA TRIMETHYLATION DE LA LYSINE 27 DE L HISTONE L H3 DANS LE CANCER DE LA PROSTATE Marjolaine NGOLLO Doctorante en première année 15/02/2013 Directeur de thèse: Professeur L. GUY DONNEES EPIDEMIOLOGIQUES

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME..... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 LA RETINOPATHIE DIABETIQUE.. 31 I-LE DIABETE SUCRE ET SES COMPLICATIONS 31 1-Le

Plus en détail

Il s'agit d'une proposition de plan, tout autre plan intégrant les idées maîtresses énoncées ci-dessous étant également valable.

Il s'agit d'une proposition de plan, tout autre plan intégrant les idées maîtresses énoncées ci-dessous étant également valable. Rapport concernant le sujet d'écrit de biologie Traiter un sujet de ce type nécessite à la fois : une construction de l'exposé dégageant les idées maîtresses, avec un plan structuré apparent et comportant

Plus en détail

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1 UFR Sciences et Techniques Licence 2 ème année BiologieBiochimie Module S4B0100 Biologie Cellulaire 3Immunologie 1 TD de Biologie Cellulaire Joelle Gaschet (joelle.gaschet@univnantes.fr) Xavier Saulquin

Plus en détail

ARF1 contrôle la migration des cellules hautement invasives du cancer du sein via Rac1

ARF1 contrôle la migration des cellules hautement invasives du cancer du sein via Rac1 Université de Montréal ARF1 contrôle la migration des cellules hautement invasives du cancer du sein via Rac1 par Sebastian Lewis-Saravalli Département de pharmacologie, Université de Montréal Faculté

Plus en détail