Régulation de l expression des génomes

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Régulation de l expression des génomes"

Transcription

1 Cours Module L5-BH-05 Régulation de l expression des génomes Mercredi de 13h30 à 15h30 & Jeudi de 8h00 à 10h00 (sem. 0 à 5/6) S. Bourgerie Université d Orléans UFR Sciences & Centre de Biophysique Moléculaire UPR4301 1

2 PLAN des COURS n 1 & n 2 1- Introduction 1.1 pourquoi y-a-t-il régulation? 1.2 niveaux de régulation 1.3 quelques définitions 1.4 notion d opéron 2- Régulation de la transcription 2.1 stratégies de contrôle de l initiation de la transcription 2.2 contrôles positif-négatif 2.3 rappels sur l initiation de la transcription chez les procaryotes 3- Opéron lactose 3.1 organisation générale 3.2 phénomène d induction - inducteur 3.3 lacz - lacy - laca 3.4 mutants de l opéron 3.5 régulations négative (répresseur) expérience Pajamo rôle du répresseur structure du répresseur opérateur positive : répression catabolique diauxie AMPc scénarios structure-fonction CRP opérateurs 3.6 récapitulatif 2

3 Introduction Pourquoi y-a-t-il régulation de l expression des gènes? Pour répondre aux conditions changeantes de l environnement immédiat Sept mécanismes susceptibles de modifier la concentration à l équilibre d une protéine ; Sites possibles de régulation : 1- synthèse du transcrit primaire 2- maturation post-transcriptionnelle de l ARNm 3- dégradation de l ARNm 4- synthèse protéique 5- modifications post-traductionnelles 6- ciblage et transport des protéines 7- dégradation des protéines 3

4

5 Quelques définitions Les séquences codant des produits agissant en trans Les séquences agissant en cis Un locus agit en cis sur un autre locus s il est sur la même molécule d ADN ; L opérateur est un élément d activation en cis car il fonctionne uniquement s il est fixé sur le gène dont il contrôle l expression. Un locus agit en trans s il peut contrôler un autre locus, même à partir d une molécule d ADN différente. Le gène du répresseur du lactose (laci) agit en trans car il peut réguler l expression de l opéron lactose même s il est enlevé du génome d E. coli et placé sur un plasmide. élément régulateur en cis : site pour une protéine de liaison à l ADN, situé le plus souvent, en amont du gène régulé. élément agissant en trans : protéine elle-même, qui diffuse dans la cellule depuis son site de synthèse jusqu à son site de liaison sur l ADN. 5

6 Quelques définitions (2) Gène structural gène qui code une protéine (ou un ARN) Gène régulateur gène structural qui code une protéine impliquée dans la régulation de l expression d autres gènes. 6

7 Quelques définitions (3) OPERON Gènes structuraux organisés en groupes contenant des gènes codant des protéines dont les fonctions sont apparentées (gènes co-transcrits pour former une molécule d ARN polycistronique) À côté de ces gènes, on retrouve : - des séquences adjacentes requises pour la transcription (promoteurs, opérateurs) - des séquences impliquées dans la régulation. Exemple : Les gènes des enzymes successives d une voie métabolique 7

8 Quelques rappels sur l initiation de la transcription chez les procaryotes «Idées fortes» l ARN polymérase copie en ARN un brin du duplex d ADN une unité de transcription est une séquence d ADN transcrite en un ARN unique, qui débute au niveau du promoteur et se termine au terminateur la transcription a lieu dans une «bulle», à l intérieur de laquelle l ARN est synthétisé par appariement des bases avec un brin d ADN de la région transitoirement déroulée au fur et à mesure de la progression de la bulle, le duplex d ADN se reforme après son passage. l ARN polymérase catalyse la formation d une liaison phosphodiester qui résulte d une attaque du groupement 3 -OH du dernier nucléotide de la chaîne sur le groupement 5-triphosphate du nucléotide entrant, ce qui s accompagne d une libération de pyrophosphate la transcription comprend 4 étapes qui impliquent différents types d interactions entre l ARN polymérase et l ADN : 1- reconnaissance de la matrice 2- initiation 3- élongation 4- terminaison le facteur σ contrôle la liaison à l ADN de l ARN polymérase. la reconnaissance du promoteur dépend de séquences consensus. il existe deux modes principaux de terminaison. 8

9 Promoteurs bactériens : organisation ARN polymérase β β σ α ω Schematic representation of the major form of E. coli RNA polymerase bound to DNA. 9

10 ARN polymérase : organisation - structure 10

11 INDUCTION régulation de la transcription LORSQUE LE CONTRÔLE DE LA TRANSCRIPTION EST NEGATIF : Répresseur : protéine qui empêche l expression d un gène. Opérateur : site cible de la protéine répresseur. Lorsque la protéine répresseur r se fixe à l opérateur, l ARN l polymérase ne peut plus initier la transcription ce qui empêche l expression l du gène. g En vert : gène régulateur En bleu : gène structural Cas du répresseur lac avec l IPTG p.e. répresseur inducteur répresseur inactif REPRIME INDUIT 11

12 régulation de la transcription CONTRÔLE NEGATIF DE LA TRANSCRIPTION REPRESSION répresseur actif Répresseur inactif corépresseur INDUIT REPRIME 12

13 LORSQUE LE CONTRÔLE DE LA TRANSCRIPTION EST POSITIF : régulation de la transcription Un facteur de transcription doit assister l ARN polymérase pour l initiation au niveau du promoteur. INDUCTION ARN polymérase activateur inactif inducteur activateur actif REPRIME INDUIT Cas de la CRP associée au l AMPc 13

14 régulation de la transcription CONTRÔLE POSITIF DE LA TRANSCRIPTION REPRESSION activateur actif corépresseur activateur inactif INDUIT REPRIME 14

15 L opéron lac : organisation Opéron lactose 1040 pb 3510 pb 780 pb 825 pb 3 gènes structuraux: z, y & a - codant pour les enzymes impliquées dans le métabolisme du lactose - sont exprimés continuellement à faible taux - sont induits environ 1000 fois quand le lactose est présent - sont modulés par le taux de glucose du milieu laci : un gène adjacent n appartenant pas à l opéron, codant pour le répresseur lac 15

16 Opéron lactose Lactose Glucose Lactose Glucose Glucose-6P glycolyse Galactose Galactose-1P Glucose-1P Croissance d E. coli sur un mélange de glucose et lactose 16

17 Les enzymes du métabolisme du lactose sont inductibles Opéron lactose Cinétique d induction de l activité β-galactosidase chez E. coli (d après Cohn, M. J. Bacteriol. (1957) 21, 156) ARNm 2 8 Temps (min) 17

18 Les inducteurs de l opéron lac Opéron lactose Lactose, (substrate de l opéron), converti en son isomère (par transglycosylation), l allolactose. Allolactose, inducteur naturel (ou inducteur physiologique, isomère du lactose). inducteur gratuit : induit l opéron mais pas métabolisé. Par exemple : isopropylthiogalactoside (IPTG) OH OH OH OH OH O O O HO OH O HO OH OH HO OH O O lactose HO HO OH OH OH O allolactose OH CH 3 HO OH S C H CH 3 IPTG ou isopropylthiogalactoside 18

19 lacz Opéron lactose code l enzyme β-galactosidase dont la forme active est un tétramère d environ 500kDa Réaction catalysée : coupe les β-galactosides et libère les sucres qui les constituent Exemple : le lactose est hydrolysé en glucose et galactose Equation de la réaction catalysée par la β-galactosidase 19

20 E2 E1 Opéron lactose Ext. CYCLE de TRANSPORT Membrane Int. lactose H+ E2 E1 H + + lactose E2-H + -lactose E1-H + -lactose 20

21 Opéron lactose 21

22 Opéron lactose 22

23 Opéron lactose RECAPITULATIF mutations O c Les mutations de l opérateur sont constitutives, car le promoteur est incapable de fixer la protéine répresseur; Ceci permet à l ARN polymérase d avoir libre accès au promoteur. Les mutations O c agissent en cis, car elles ne touchent que les gènes structuraux qui leur sont contigus. mutations du type laci - Les mutations qui inactivent le gène laci entraînent l expression constitutive de l opéron, car la protéine du répresseur mutant ne peut plus se fixer sur l opérateur. Les mutations constitutives du gène laci sont récessives. Les mutations non inductibles laci S sont dominantes. 23

24 Quel est la nature du produit codé par le gène I? Expérience PAJAMO (Pardee AB et al. (1959) J. Mol. Biol. 1, 173) Opéron lactose Conjugaison Hfr I + Z + x F - I - Z - On ne s intéresse qu aux cellules receveuses; les cellules donneuses sont tuées. Démonstration de l existence du répresseur lac : Expérience de conjugaison 24

25 Fonctionnement de l opéron lac d E. coli en l absence de lactose Opéron lactose La protéine répresseur se fixe à l opérateur et empêche la transcription. L ARN polymérase peut se fixer au promoteur quand le répresseur est présent sur l opérateur mais il ne peut y avoir initiation de la transcription. 25

26 Fonctionnement de l opéron lac d E. coli en présence de lactose Opéron lactose 26

27 répresseur lac Répresseur lac (suite) Opéron lactose Le répresseur lac : - un tétramère de sous-unités identiques de 360 résidus disposées selon 3 axes de symétrie d ordre 2, mutuellement complémentaires (chaque sous-unité lie une molécule d IPTG avec une constante de dissociation K = 10-6 M) 1- en l absence d inducteur, liaison non spécifique du répresseur sous forme tétramérique à l ADN double brin (K = 10-4 M) 2- en présence d inducteur, liaison spécifique du répresseur opérateur lac (affinité supérieure K = M). Deux domaines fonctionnels pour chaque sous-unité : - un domaine N-terminal de 58 résidus : liaison à l ADN (mais pas à l IPTG) - le restant : liaison à l IPTG. Le répresseur lac trouve l opérateur en se liant de façon non spécifique à l ADN et en diffusant sur sa longueur selon une recherche à une dimension. Le répresseur se fixe à un ADN double-brin contenant la séquence de l'opérateur lac de type sauvage. Le répresseur ne se fixe pas à un ADN de mutant O c. L'addition d IPTG in vitro libère le répresseur de l'adn opérateur. 27

28 répresseur lac Opéron lactose Pièce maîtresse Fixation à l opérateur cœur Fixation de l inducteur Domaine C-terminal Oligomérisation (Lewis et al. (1996) Science 271, 1247) Structure de la sous-unité du répresseur lac. Il existe plusieurs domaines indépendants dans la molécule. 28

29 répresseur lac Opéron lactose IMPLICATIONS STRUCTURALES de l INDUCTION Changement de la structure du noyau par l inducteur : les pièces maîtresses d un répresseur ne sont plus dans une orientation qui permet la fixation à l ADN. En bleu : domaine de fixation à l ADN En rouge : hélices α impliquées dans la tétramérisation En vert : sites de fixation de l inducteur En jaune: petites hélices de liaison Structure d un dimère du répresseur lac 29

30 opérateur Opéron lactose Opérateur lac - l opérateur lac occupe ~ 35 bp - il est situé en aval du promoteur et couvre celui-ci - il présente 2 séquences symétriques (séq. palidromique imparfaite) - ~22 bp sont protégées des nucléases lors d une expérience d empreinte - l affinité du répresseur pour l opérateur est 4x10 6 plus forte que pour une séquence d ADN quelconque Séquence de l opérateur 30

31 opérateur Interactions entre l opérateur et le répresseur Opéron lactose La séquence des bases de l opérateur lac 31

32 Opéron lactose résumé Séquence nucléotidique de la région promoteur lac-opérateur lac d E. coli, depuis la région C-terminale de laci (à gauche) à la région N-terminale de lacz. Les séquences palindromiques de l opérateur et le site de liaison de CAP sont surlignées ou soulignées (d après Dickson RC et al., Science , 32) Le répresseur et l ARN polymérase se fixent sur des sites qui se chevauchent au niveau du point de départ de l opéron lac. 32

33 opérateur Opéron lactose L opéron lac comprend 3 sites de fixation pour le répresseur lac. 33

34 Répression catabolique : mis en évidence Opéron lactose Phénomène de diauxie Le colibacille (E. coli) utilise le glucose du milieu comme source d énergie. Si on remplace le glucose par du lactose, la croissance cesse. La croissance reprend rapidement lorsque les cellules ont produit les enzymes nécessaires à la conversion du lactose en glucose. Quand deux sources de carbone particulière sont présentes ensembles dans le milieu de culture, la courbe de croissance est biphasique : phénomène de diauxie. 34

35 Répression catabolique Opéron lactose Cinétique de synthèse de l ARNm de l opéron lac suite à l induction par l IPTG puis après addition de glucose. Glucose : métabolite de choix d E. coli 35

36 Entrée du glucose dans la cellule bactérienne Opéron lactose Glucose Glucose-6-phosphate EN PRESENCE DE GLUCOSE Production d AMPc ACTIVATION de GENES 36

37 Répression catabolique Opéron lactose CRP (cyclic AMP [camp] receptor protein), également appelée CAP (catabolite activator protein) L AMPc s accumule quand le glucose est absent. Quand le glucose est présent - l adénylate cyclase est inhibée - AMPc phosphodiestérase est activée. glucose - Adénylcyclase AMPc ATP AMPc phosphodiestérase + glucose AMP 37

38 Répression catabolique Opéron lactose Sucre(s) dans le milieu de culture Quantité relative de β- galactosidase Glucose 1 induction répression Glucose + lactose 50 Lactose

39 Opéron lactose CAP est un régulateur positif et l AMPc la molécule inductrice Le produit du gène I (répresseur lac) est un régulateur négatif; le lactose ou l IPTG la molécule inductrice. 39

40 CRP Opéron lactose CAP : ce qu il faut retenir 1- active la transcription de plus de 100 promoteurs (facteur de transcription global). 2- protéine d environ 45 kda qui se fixe à l ADN sous la forme d un dimère (2 sousunités identiques. 3- le 1 er des activateurs transcriptionnels a avoir été isolé (1970) et le 1 er pour lequel la structure 3D a été déterminée. 4- en présence d AMPc, forme un complexe (CRP-AMPc) qui se fixe à une séquence cible de 22pb, située près ou au sein du promoteur qu il contrôle 5- active la transcription du fait de contacts protéine-protéine avec l ARN polymérase 40

41 La protéine CRP : organisation structurale Opéron lactose 41

42 Opéron lactose La fixation coopérative du répresseur lac entraîne la formation d une boucle sur l ARN. Lac Repressor = tetramer O 1 O 2 42

43 CRP Opéron lactose Site de fixation de l AMPc-CAP Mutations rendant le promoteur indifférent à CAP A T T A ATGTGAGTTAGCTCACACATT 3 TACACTCAATCGAGTGTGTAA Axe de symétrie Nucléotides aux contacts de l AMPc-CAP Promoteur 43

44 Opéron lactose Positions et séquences des 3 opérateurs Effets de mutations sur chacun des 3 opérateurs 44

45 Opéron lactose Le répresseur lac inhibe la transcription en formant une boucle dans l ADN Différents modèles 1- région promotrice de l opéron lac 2- transcription 3- répression : modèle 1 : fixation du répresseur en O 1 & O 3, promoteur libre, site CAP toujours occupé ARN pol. pas fixée au promoteur 4- répression : modèle 2 : fixation du répresseur lac en O 1 & O 2, site CAP toujours occupé, ARN pol fixée au promoteur mais pas de synthèse d ARN car blocage de l ARN pol. par le répresseur 45

46 Pour résumer Opéron lactose -en l absence de lactose, une protéine tétramérique, possédant deux sites de fixation à l ADN se fixe, en premier lieu, sur le principal opérateur O 1 puis soit sur O 2 soit sur O 3. Deux des quatre sous-unités du répresseur reconnaissent O 1 ; les deux restantes reconnaissant soit O 2 soit O 3. - en général le répresseur se fixe en O 1 & O 3 provoquant la formation d une structure en boucle de l ADN entre les deux sites ce qui empêche l ARN polymérase de se fixer au promoteur et donc d initier la transcription. - en fait la transcription n est pas complètement bloquée : une faible transcription a lieu même en la présence du répresseur fixé en ses opérateurs. -en présence de lactose, la lactose perméase permet, dans un premier temps, l entrée d une petite quantité de lactose, lequel est transformé en allolactose (un isomère structural du lactose) par la β-galactosidase. - l allolactose se fixe alors en des sites de la protéine répresseur provoquant un changement de conformation de celle-ci ce qui la rend incapable de se fixer aux séquences opérateur. - ainsi, avec l opérateur «libéré» du répresseur, l ARN polymérase peut se fixer à la région promotrice et initier la transcription. 46

47 α-peptide site actif α-peptide site actif lacz délétion de 90pb lacz ( M15) lacz Protéine dimérique INACTIVE α-complémentation α-peptide Protéine tétramérique ACTIVE Protéine ACTIVE 47

Contrôle exercé par le répresseur

Contrôle exercé par le répresseur Contrôle de la transcription de l opéron lac Les gènes de l opéron lac sont contrôlés par une REGULATION NEGATIVE Ils sont transcrits sauf s ils sont sous la coupe d une protéine régulatrice Contrôle exercé

Plus en détail

REGULATION DE L EXPRESSION DES GENES

REGULATION DE L EXPRESSION DES GENES REGULATION DE L EXPRESSION DES GENES 1. Circuits fondamentaux de contrôle Ce sont des circuits de contrôle permettant d ajuster les synthèses protéiques en fonction des besoins. Pour cela, les cellules

Plus en détail

COURS DE REGULATION GENETIQUE CHEZ LES BACTERIES: OPERONS CATABOLIQUES & ANABOLIQUES

COURS DE REGULATION GENETIQUE CHEZ LES BACTERIES: OPERONS CATABOLIQUES & ANABOLIQUES UM V FSR COURS DE REGULATION GENETIQUE CHEZ LES BACTERIES: OPERONS CATABOLIQUES & ANABOLIQUES Filière SVI- Semestre 5 2014/2015 Comprendre la régulation génétique chez les bactéries et son rôle. Savoir

Plus en détail

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE 1. L opéron lactose STRUCTURE DU LACTOSE liaison β-galactosidique β-galactosidase galactose lactose glucose CROISSANCE BACTÉRIENNE EN PRÉSENCE DE GLUCOSE

Plus en détail

PLAN INTRODUCTION RÉGULATION CHEZ LES PROCARYOTES RÉGULATION CHEZ LES EUCARYOTES. 1ère année Module: Génétique

PLAN INTRODUCTION RÉGULATION CHEZ LES PROCARYOTES RÉGULATION CHEZ LES EUCARYOTES. 1ère année Module: Génétique 1ère année Module: Génétique Your Logo Dr H. BOULENOUAR Année Universitaire : 2016/2017 PLAN INTRODUCTION RÉGULATION CHEZ LES PROCARYOTES RÉGULATION CHEZ LES EUCARYOTES 1 INTRODUCTION Les cellules peuvent

Plus en détail

Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus

Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus Une représentation du complexe répresseur lac-adn, telle qu elle a été déterminée par crystallographie aux rayons X

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA I- INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène Expression moléculaire du gène Clase II A B C Transcription

Plus en détail

TRANSCRIPTION. Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines.

TRANSCRIPTION. Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines. TRANSCRIPTION Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines. I) Comparaison procaryotes et eucaryotes. A) Vue générale Procaryotes

Plus en détail

LA TRANSCRIPTION. II / MECANISME GENERAL DE LA TRANSCRIPTION :(schéma 1)

LA TRANSCRIPTION. II / MECANISME GENERAL DE LA TRANSCRIPTION :(schéma 1) FACULTE DE MEDECINE D ALGER MODULE DE GENETIQUE Dr BOUDIAF R. I / DEFINITION / GENERALITES : LA TRANSCRIPTION La transcription est la synthèse enzymatique de tous les ARNS à partir d un ADN matrice. Celle-ci

Plus en détail

Tutorat Santé de Caen. Biologie moléculaire

Tutorat Santé de Caen. Biologie moléculaire Tutorat Santé de Caen Biologie moléculaire Structure des acides nucléiques Liaison ester entre le C5 de l ose et le phosphate Liaison N-Osidique entre le C1 de l ose et la base azotée NucléoTide = Phosphate

Plus en détail

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1 La TRANSCRIPTION La synthèse des protéines Eucaryotes Procaryotes La TRANSCRIPTION cours_bm_2015_transcription_pr_makrelouf 1 MÉCANISME GÉNÉRAL DE LA TRANSCRIPTION La transcription est une biosynthèse

Plus en détail

Variabilité et régulation de l expression génique

Variabilité et régulation de l expression génique BIOLOGIE CELLULAIRE - Stage de Pré-Rentrée UE1 - - 2010/2011 - Variabilité et régulation de l expression génique Objectifs Comprendre la séquence des différentes étapes menant du gène à la protéine Comprendre

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

Physique des objets biologiques: du nanomètre au micron. 1 Mécanismes de régulation. 2 Introduction à l opéron lactose

Physique des objets biologiques: du nanomètre au micron. 1 Mécanismes de régulation. 2 Introduction à l opéron lactose Ecole Polytechnique PHY552B Physique des objets biologiques: du nanomètre au micron Rémi Monasson Amphi 6 : Réseaux de régulation 1 Mécanismes de régulation 2 Introduction à l opéron lactose 3 Modélisation

Plus en détail

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène 5 A B C 3 ARNm ARNr ARNt Protéine fonctionnelle Flux de l information génétique

Plus en détail

Cours Module L5-BH-05

Cours Module L5-BH-05 Cours Module L5-BH-05 Régulation de l expression des génomes Cours n 3 S. Bourgerie Université d Orléans UFR Sciences & Centre de Biophysique Moléculaire UPR4301 Plan du cours n 3 Opéron arabinose 1- introduction

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

Cours de Biologie Moléculaire SVI- S5 ( )

Cours de Biologie Moléculaire SVI- S5 ( ) Cours de Biologie Moléculaire SVI- S5 (2014-15) Le dogme centrale de la Biologie Moléculaire Représente le mécanisme d expression de l information génétique (Francis Crick (fin des années 50) et Nature

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Contrôle de la maturation

Contrôle de la maturation Régulation de l''expression des gènes Chez les eucaryotes I_ Mise en evidence et signification de la régulation A. Mise en évidence Les cellules peuvent s'adapter pour utiliser les ressources du milieu

Plus en détail

COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION

COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION - Processus qui permet de transmettre l information contenue dans l ADN de générations en générations - Phénomène qui permet de dupliquer l ADN (doublement

Plus en détail

Cours Module L5-BH-05

Cours Module L5-BH-05 Cours Module L5-BH-05 Régulation de l expression des génomes Mercredi de 13h30 à 15h30 & Jeudi de 8h00 à 10h00(sem. 0 à 5/6) S. Bourgerie Université d Orléans UFR Sciences & Centre de Biophysique Moléculaire

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail

Un modèle de régulation - la répression catabolique et l opéron lac chez Escherichia coli

Un modèle de régulation - la répression catabolique et l opéron lac chez Escherichia coli BMC421-2009 Un modèle de régulation - la répression catabolique et l opéron lac chez Escherichia coli cours de Guennadi SEZONOV Les diapos du cours en couleur peuvent être téléchargées sur : http:// les

Plus en détail

Biologie Moléculaire

Biologie Moléculaire Biologie Moléculaire Sommaire Des liaisons chimiques à la structure des acides nucléiques La Transcription Maturation du transcrit La Traduction La Réplication Les Télomères 1 Des liaisons chimiques à

Plus en détail

Notions de régulation du métabolisme

Notions de régulation du métabolisme A quoi conduisent les régulations? Notions de régulation du métabolisme Vincent Sauveplane AgroParisTech - MICALIS 78352 JOUY-EN-JOSAS cedex Vincent.sauveplane@agroparistech.fr Master BIP Régulation du

Plus en détail

Chapitre D. (ancien programme) (Nouveau programme)

Chapitre D. (ancien programme) (Nouveau programme) Chapitre D LA COMPLEXITE DES RELATIONS ENTRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT (ancien programme) DES GENES A LA REALISATION DES GENOTYPES (Nouveau programme) 1 Au cours du Chapitre A, nous avons vu que

Plus en détail

ADN. Night tutorat UE 1

ADN. Night tutorat UE 1 ADN Night tutorat UE 1 L ADN est une molécule allongée qui peut être linéaire ou circulaire, elle subit également différent degrés de compaction. Chez les procaryotes: molécule généralement circulaire

Plus en détail

Régulation de l'activité enzymatique.

Régulation de l'activité enzymatique. Régulation de l'activité enzymatique. Les organismes doivent être capables de moduler l'activité enzymatique cellulaire de façon à s'adapter aux changements métaboliques. De cette façon, les enzymes peuvent

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES»

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» 76 IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» Avec l étude de l opéron lactose, François Jacob, Jacques Monod et André Lwoff ont été les premiers scientifiques à décrire

Plus en détail

L EPISSAGE. I- Introduction

L EPISSAGE. I- Introduction L EPISSAGE I- Introduction Lors de la transcription des gènes codant les protéines par l ARN polymérase II, il y a synthèse d un ARN prémessager qui contient l ensemble nucléotidique du gène comprise entre

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

Tut Rentrée Cours 2. Le tutorat est gratuit. Toute reproduction ou vente est interdite

Tut Rentrée Cours 2. Le tutorat est gratuit. Toute reproduction ou vente est interdite Tut Rentrée 2016 1 Cours 2 2 Synthèse des protéines o Code génétique o Traduction d un ARNm o Mutations Régulation de l expression d un gène o Généralités o Régulation des gènes procaryotes o Régulation

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

La transcription. La transcription se fait avant l'interphase, on ne peut pas transcrire en même temps que la réplication de l'adn.

La transcription. La transcription se fait avant l'interphase, on ne peut pas transcrire en même temps que la réplication de l'adn. 5/03/13 La transcription I Principe généraux de la transcription La transcription est la 1 ère étape de l'expression génique. Toutes les cellules d'un organisme ont le même génome. Les transcrits produiront

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Cours 30 août 2013 1 Les acides nucléiques Il existe plusieurs types d'acides nucléiques, mais essentiellement deux vont nous intéresser,

Plus en détail

TRANSFERT DE L'INFORMATION GENETIQUE

TRANSFERT DE L'INFORMATION GENETIQUE TRASFERT DE L'IFRMATI GEETIQUE 1. LA TRASCRITI Gène codant pour les AR (exemple d un ARr) début de transcription unité de transcription AD intercalaire 5' 3' région codante espace non codant Gène codant

Plus en détail

Travaux dirigés de Biologie Moléculaire 8 semaine 10

Travaux dirigés de Biologie Moléculaire 8 semaine 10 Travaux dirigés de Biologie Moléculaire 8 semaine 10 Exercice 23 : Question 1 Gène Sous-unité Poids Fonction Rpo A 2 α 40 kda chacune Assemblage de l enzyme Reconnaissance du promoteur Rpo B β 155 Centre

Plus en détail

Module 3 La régulation de l'expression des gènes chez les procaryotes

Module 3 La régulation de l'expression des gènes chez les procaryotes Module 3 La régulation de l'expression des gènes chez les procaryotes 1 Où trouver l'information complémentaire? MCB-10 et 11, GVII-9, 10, et 11. Les différents types cellulaires qui caractérisent un organisme

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

Web 13 Fiche 13.1 MÉCANISMES D ACTIVATION DE LA TRANSCRIPTION PAR L ACTIVATEUR CRP-AMPC. C. Guterriez

Web 13 Fiche 13.1 MÉCANISMES D ACTIVATION DE LA TRANSCRIPTION PAR L ACTIVATEUR CRP-AMPC. C. Guterriez Web 13 Fiche 13.1 MÉCANISMES D ACTIVATION DE LA TRANSCRIPTION PAR L ACTIVATEUR CRP-AMPC C. Guterriez La protéine Crp (Cyclic-AMP-receptor-protein), également appelée Cap (Catabolite Activator Protein)

Plus en détail

Les protéines, les gènes et les milieux. L adaptation de l individu et l évolution des espèces.

Les protéines, les gènes et les milieux. L adaptation de l individu et l évolution des espèces. 3 ème ou Les protéines, les gènes et les milieux. L adaptation de l individu et l évolution des espèces. Chapitre 14. Le cellules, l individu et le milieu : l adaptation se fait par des modifications transitoires

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

Sujet d examen 1 ère session (1h) CORRECTION

Sujet d examen 1 ère session (1h) CORRECTION Régulation de l Expression du Génome S. Bourgerie L. Mollet C. Hano Sujet d examen 1 ère session 2004-2005 (1h) CORRECTION Question n 1 : rappeler le principe de la régulation exercée par le complexe CRP-AMPc

Plus en détail

Cours : Les enzymes, des protéines actives dans le fonctionnement cellulaire

Cours : Les enzymes, des protéines actives dans le fonctionnement cellulaire Cours : Les enzymes, des protéines actives dans le fonctionnement cellulaire Problèmes : Quelles sont les propriétés des enzymes qui expliquent leur omniprésence dans les réactions chimiques des organismes

Plus en détail

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM )

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM ) BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM1 2006-2007) CHAPITRE 1. INTRODUCTION CHAPITRE 2. LES ACIDES NUCLEIQUES I.

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES I-Introduction - définition gène 5 A B C 3 transcription Traduction mrna AA1-AA2-AA3 AAn Protéines fonctionnelles

Plus en détail

Chapitre 3 Le matériel nucléaire 3.2 Régula6on de l expression des gènes Enseignante : Pascale Perrin montp2.

Chapitre 3 Le matériel nucléaire 3.2 Régula6on de l expression des gènes Enseignante : Pascale Perrin montp2. Chapitre 3 Le matériel nucléaire 3.2 Régula6on de l expression des gènes Enseignante : Pascale Perrin Pascale.Perrin@univ- montp2.fr Chap 3-2 : Régula/on de l expression des gènes I. Régula/on de la transcrip/on

Plus en détail

Cours Biologie cellulaire

Cours Biologie cellulaire Cours Biologie cellulaire GLBE102_ L1-S1 Le Noyau et la Transcription Généralités Un organite interphasique (disparaît en fin de prophase) Contient l ADN de la cellule = génome (sauf ADN mito. et chloroplastique)

Plus en détail

La β galactosidase d Escherichia coli.

La β galactosidase d Escherichia coli. Banque «Agro-Véto» PRO-12.09 BIOLOGIE Epreuve B Durée : 3 heures 30 minutes L usage de la calculatrice, d abaques et de tables est interdit pour cette épreuve. Si, au cours de l épreuve, un candidat repère

Plus en détail

REPLICATION DE L ADN

REPLICATION DE L ADN REPLICATION DE L ADN I/ Caractéristiques fondamentales de la réplication 1. Modèle de réplication: La réplication peut se faire suivant 3 modèles représentés sur la figure 1. -Modèle conservatif : Les

Plus en détail

Le métabolisme du glycogène

Le métabolisme du glycogène Chap V. Le métabolisme du glycogène I. Introduction Glycogène = forme de mise en réserve du glucose facilement mobilisable réserves de glucose = 40 kcal réserves de glycogène = 600 kcal Stockage dans foie

Plus en détail

Partie 2: Expression génétique

Partie 2: Expression génétique belkadibouchra@yahoo.fr Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014

Plus en détail

Modulation de l activite enzymatique

Modulation de l activite enzymatique FACULTE DE MEDECINE UNIVERSITE 3 DE CONSTANTINE 1 ERE ANNEE MEDECINE Modulation de l activite enzymatique Dr l.belkacem M.A BIOCHIMIE Introduction Modulation de l activité enzymatique Les organismes doivent

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-2 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Partie 1 : Les acides uncléiques. Chapitre 1 La structure des nucléotides Les bases Les oses Les nucléosides 9

Partie 1 : Les acides uncléiques. Chapitre 1 La structure des nucléotides Les bases Les oses Les nucléosides 9 Avant-propos III Partie 1 : Les acides uncléiques Chapitre 1 La structure des nucléotides 2 1. Les bases 2 2. Les oses 8 3. Les nucléosides 9 4. L acide phosphorique 10 5. Les nucléotides 11 6. Les polynucléotides

Plus en détail

li.3 Régulation de la Signalisation

li.3 Régulation de la Signalisation li.3 Régulation de la Signalisation I.3.1 Régulation de la signalisation endocrinienne Le système endocrinien et le système nerveux sont reliés physiquement et fonctionnellement au niveau de l hypothalamus.

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb.

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb. TD TRANSCRIPTION 1 Problème 1 A) Un chercheur a cloné, dans un vecteur plasmidique, un insert de 5 kb, correspondant à une très petite portion du chromosome d Escherichia coli (génome complet d E. coli

Plus en détail

Du génotype aux phénotypes. M1 Phytem ENS Cachan

Du génotype aux phénotypes. M1 Phytem ENS Cachan Du aux phénotypes M1 Phytem ENS Cachan 2013-2014 Les pois de Mendel (1866) Parents x P. sativum Pois lisse Pois ridé F1 Un croisement de deux lignées pures différant par un caractère donne une F1 homogène.

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 3 TRADUCTION C est le mécanisme par lequel le flux d information va passer de la forme acide nucléique (alphabet à 4 lettres) à la forme protéine (alphabet à 20 lettres) selon

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Toxicité des antirétroviraux

Toxicité des antirétroviraux Le VIH est un virus appartenant à la Famille des Rétrovirus (Virus à ARN), il rétrotranscrit l ARN en ADN grâce à la Transcriptase Inverse. Virus sphérique (80 à 100 nm), à Symétrie combinée (appelée encore

Plus en détail

Unité de Biologie Moléculaire

Unité de Biologie Moléculaire Le dogme central de la Biologie Moléculaire Unité de Biologie Moléculaire Cours général (Transcription et Traduction) C. Jourlin-Castelli Acide DéoxyriboNucléique () Transcription Biologie Moléculaire

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-1 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

Régulation de l expression du message génétique

Régulation de l expression du message génétique Chapitre 7 : UE1 : Biochimie Biologie moléculaire Régulation de l expression du message génétique Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Ces exercices seront corrigés et expliqués dans l'armature de biologie moléculaire qui aura lieu le 15/11/12. Nous

Plus en détail

Biologie cellulaire et moléculaire : L Energétique cellulaire

Biologie cellulaire et moléculaire : L Energétique cellulaire Biologie cellulaire et moléculaire : L Energétique cellulaire Introduction L existence de la cellule est définie par sa capacité à maintenir à l intérieur de sa membrane un milieu différent de ce qui se

Plus en détail

TD N 3 : BIOSYNTHESE DES PROTEINES CHEZ LES EUCARYOTES:

TD N 3 : BIOSYNTHESE DES PROTEINES CHEZ LES EUCARYOTES: 1 TD N 3 : BISYNTESE DES PRTEINES CEZ LES EUCARYTES: 1. Introduction - Avant que commence la synthèse des protéines par les ribosomes, il s effectue dans le noyau une transcription de l information portée

Plus en détail

TRANSPORT ET STABILITE DES ARNs

TRANSPORT ET STABILITE DES ARNs TRANSPORT ET STABILITE DES ARNs I- Transport des ARNm Après sa maturation dans le noyau, l ARNm reste associé avec des protéines spécifiques pour former des complexes ribonucléoprotéiques (mrnp). L assemblage

Plus en détail

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat

Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences Rabat REGULATION GENETIQUE CHEZ LES BACTERIES: OPERONS CATABOLIQUES & ANABOLIQUES Comprendre la régulation génétique chez les bactéries

Plus en détail

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant Thème 1 A Chapitre LA TERRE DANS L UNIVERS, la vie et l évolution du vivant (5 semaines) EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE Introduction : Les cellules de l'organisme, à l'exception

Plus en détail

La transcription. Brins d'adn 5'-TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG-3' 3'-ACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTAC-5'

La transcription. Brins d'adn 5'-TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG-3' 3'-ACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTAC-5' La transcription Sens Matrice Brins d'adn 5'-TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG-3' 3'-ACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTAC-5' 5' pppauugugagcggauaacaauuucacacaggaaacagcuaugaccaug-3'

Plus en détail

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN I- Définition moléculaire du gène Génos qui donne naissance Classe II (structure) Classe III Classe I Gène A Gène B Gène C mrna trna rrna Protéines

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN Généralités Premières notions La réplication C est l opération qui va permettre de perpétrer la molécule d ADN, support de l information génétique. C est une opération très complexe

Plus en détail

RÉGULATION DE L EXPRESSION DES GÈNES

RÉGULATION DE L EXPRESSION DES GÈNES RÉGULATION DE L EXPRESSION DES GÈNES Comme nous l avons vu, le programme de transcription n est pas fixe. La cellule sait adapter ce programme aux conditions extérieures, au mieux de son économie. Chez

Plus en détail

4.3. Les transporteurs secondaires

4.3. Les transporteurs secondaires 4.3. Les transporteurs secondaires 4. 3.1. Généralités - Le transport actif primaire fournit un gradient électrochimique d ion ou de soluté utilisé par le transporteur secondaire (primaire = flux d électrons

Plus en détail

COMMUNICATION HORMONALE (12)

COMMUNICATION HORMONALE (12) COMMUNICATION HORMONALE (12) Cinétique de la liaison au récepteur Modèle d analyse d une relation hormone-récepteur. On étudie la liaison sur son récepteur du Cyanopindolol, analogue équivalent à l adrénaline.

Plus en détail

ED 4 - Biochimie UE1 2012/13 (version du 16/10/2012)

ED 4 - Biochimie UE1 2012/13 (version du 16/10/2012) ED 4 - Biochimie U 2012/13 (version du 16/10/2012) QCM 1 : Digestion et absorption des glucides A L hydrolyse de l amidon en n molécules de glucose nécessite uniquement l intervention de l alpha-amylase.

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen 1 (Corrections 1) -- Examen 2 (Corrections 2) -- Examen 1 - Partie

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Première session de Sujet d Annie Martel. Les sujets doivent être composés sur des copies différentes

Première session de Sujet d Annie Martel. Les sujets doivent être composés sur des copies différentes Première session de 2013 Sujet d Annie Martel U.E. Biotechnologies et Environnement (LV376) Les sujets doivent être composés sur des copies différentes Des bactéries comme agents de détection (durée 45min)

Plus en détail

Chapitre I : Génomique structurale et fonctionnelle Partie B : L expression du génome: la transcription et son contrôle

Chapitre I : Génomique structurale et fonctionnelle Partie B : L expression du génome: la transcription et son contrôle Chapitre I : Génomique structurale et fonctionnelle Partie B : L expression du génome: la transcription et son contrôle Test de Brachet sur des cellules de racine d Oignon (M.O.) Le vert de méthyle colore

Plus en détail

La traduction. E. Grelier Lycée J. Mo oulin

La traduction. E. Grelier Lycée J. Mo oulin La traduction I. Le code génétique II. Eléments intervenants dans la traduction III. Mécanismes de la traduction IV. Modifications post-traductionnelles V. Adressage des protéines 1 2oulin E. Grelier Lycée

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Le Métabolisme une Introduction. Régulation métabolique

Le Métabolisme une Introduction. Régulation métabolique Le Métabolisme une Introduction Régulation métabolique Régulation du métabolisme Les voies métaboliques sont fortement régules Tous les différentes réactions sont coordonnées Les cellules ne dégradent

Plus en détail

TD4 Microbiologie. 1. Transfer d'adn d'une cellule donneuse à une cellule receveuse par un bactériophage: c. transduction

TD4 Microbiologie. 1. Transfer d'adn d'une cellule donneuse à une cellule receveuse par un bactériophage: c. transduction # Andrew Tolonen (atolonen@genoscope.cns.fr) # mars 2014 TD4 Microbiologie Exercice 1: Associez les termes proposés aux définitions des questions. a. conjugaison b. transcription c. transduction d. transformation

Plus en détail

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Elément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail